A cosmid-based system for inserting mutations and foreign genes into the simian varicella virus genome

Journal of Virological Methods 130 (2005) 89–94

A cosmid-based system for inserting mutations and foreign genes into the simian varicella virus genome Wayne L. Gray a,∗ , Ravi Mahalingam b a

Department of Microbiology and Immunology, Slot 511, University of Arkansas for Medical Sciences, 4301 W. Markham St., Little Rock, AR 72205, USA b Department of Neurology, University of Colorado Health Sciences Center, Denver, CO 80262, USA Received 17 February 2005; received in revised form 9 June 2005; accepted 14 June 2005 Available online 25 July 2005

Abstract Simian varicella is a natural varicella-like disease of nonhuman primates. The etiologic agent, simian varicella virus (SVV), is genetically related to varicella-zoster virus (VZV) and SVV infection of nonhuman primates is a useful model to investigate VZV pathogenesis and latency. In this study, we report development of a cosmid-based genetic system to generate SVV mutant viruses. SVV subgenomic DNA fragments (32–38 kb) that span the viral genome were cloned into cosmid vectors. Co-transfection of Vero cells with four overlapping cosmid clones representing the entire SVV genome resulted in recombination and generation of infectious virus. SVV mutants were produced by manipulation of one cosmid and substitution into the genetic system. This genetic approach was used to insert a site-specific mutation within the SVV open reading frame 14 which encodes the nonessential glycoprotein C gene. In a subsequent experiment, the green fluorescent protein (GFP) gene was inserted into the SVV genome within ORF 14. These SVV mutants replicate as efficiently as wild-type SVV in cell culture. This cosmid-based genetic system will be useful to investigate the effect of viral mutations on SVV pathogenesis and latency and also to develop and evaluate recombinant varicella vaccines that express foreign antigens. © 2005 Elsevier B.V. All rights reserved.

1. Introduction Simian varicella virus (SVV) is a primate herpesvirus responsible for outbreaks in Old World monkeys of a natural disease that clinically resembles human varicella-zoster virus (VZV) infections. Similar to VZV, SVV establishes latent infection in neural ganglia and may reactivate to cause disease (Mahalingam et al., 1991). SVV and VZV are antigenically related and the viral genomes are similar in size, structure, and genetic content (Fletcher and Gray, 1992; Gray et al., 2001). Therefore, simian varicella is a useful model to investigate varicella pathogenesis and latency and to evaluate antiviral agents and vaccines (Gray, 2004). The development of a genetic approach to insert mutations into the SVV genome is essential to study the roles of viral genes in varicella pathogenesis. Studies on the molecular ∗

Corresponding author. Tel.: +1 501 686 5187; fax: +1 501 686 5359. E-mail address: [email protected] (W.L. Gray).

0166-0934/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2005.06.013

biology and genetics of SVV and VZV are hampered due to the highly cell-associated nature of the viruses. Recently, an insertional mutagenesis approach was utilized to construct a recombinant SVV that expresses the green fluorescent protein (GFP), but has the viral glycoprotein C (gC) gene (open reading frame [ORF] 14) deleted (Gray and Byrne, 2003). A DNA construct consisting of SVV sequences that flank the SVV gC ORF and bracket the GFP gene (under the control of the human cytomegalovirus immediate early gene promoter) was transfected into infected cells. Following homologous recombination, green fluorescent infected cells were selected and the recombinant SVVgC− /GFP virus was plaque-purified. The results demonstrated that the SVV gC, like the VZV gC, is nonessential for viral replication in cell culture. However, this approach for isolating SVV mutants is laborious since the transfection of infected cells results in a mix of wild-type and recombinant virus. The cell-associated nature of SVV makes plaque purification difficult, requiring a strong reporter gene, such as the GFP, for selection of recombinant viruses.

90

W.L. Gray, R. Mahalingam / Journal of Virological Methods 130 (2005) 89–94

A genetic approach for generating VZV mutants, which utilizes subgenomic 32–40 kb VZV DNAs cloned into cosmid vectors, has advanced our understanding of VZV biology (Cohen and Seidel, 1993; Kemble et al., 2000; Niizuma et al., 2005; Mallory et al., 2005). The system involves transfection of cells with four individual VZV cosmid DNAs, which collectively span the entire VZV genome, and genetic recombination, resulting in generation of infectious virus. Genetic manipulation of specific viral genes within individual cosmids is used to create VZV mutants. The method is being exploited to determine the role of specific viral genes in VZV replication and in viral pathogenesis and latency (Sato et al., 2002; Moffat et al., 1998). In addition, the approach has been used to introduce foreign genes into the VZV Oka vaccine virus genome for evaluation as a recombinant varicella vaccine (Arvin et al., 1999; Heineman et al., 2004). This report describes the development of a cosmid-based recombination system for inserting mutations and foreign genes into the SVV genome. This genetic approach will provide an opportunity for using the simian varicella model to investigate the molecular basis of varicella pathogenesis and to develop and evaluate improved varicella vaccines.

2. Materials and methods 2.1. Virus culture and isolation of SVV DNA The Delta herpesvirus strain of SVV was originally isolated from an infected patas monkey at the Tulane Regional Primate Center in Covington, Louisiana (Allen et al., 1974). Low passage (<5) SVV was propagated in African green monkey kidney (Vero) cells in growth media (Eagle’s minimal essential medium [EMEM] supplemented with penicillin [5000 U/ml], streptomycin [5000 U/ml] and 5% newborn calf serum). The virus was passaged by cocultivation of infected and uninfected cells at ratio of 1:4, respectively. SVV DNA was purified from viral nucleocapsids derived from infected Vero cells (Gray et al., 1992). 2.2. Generation of cosmids SVV cosmids were generated using the Epicentre (Madison, WI) pWeb::TNC cosmid cloning system. Briefly, SVV DNA was randomly sheared by passage through a syringe. The sheared DNA was repaired to generate blunt ends and 30–40 kb molecules were selected by electrophoresis through low melting point agarose. The SVV DNA was ligated into the SmaI site of pWEB::TNC cosmid vector and the ligation products were packaged into lambda bacteriophage using Epicentre MaxPlax packaging extract. The titer of the packaged cosmids was determined by transduction of Escherichia coli Epi305 cells and individual clones were selected on Luria-Bertani (LB) agar dishes containing ampicillin and chloramphenicol. Cosmid DNAs were obtained using a commercial midiprep system (Qiagen Corp., Valen-

cia, CA) and the identity of each SVV cosmid clone was initially determined by restriction endonuclease and Southern blot hybridization analyses. The DNA sequence of each end of the cloned SVV DNAs was determined by taking advantage of the T7 and M13 primer sites on the pWEB::TNC vector. SVV cosmids A, B, C, and D were identified as 32–38 kb overlapping cosmids, which collectively represent the entire SVV genome. 2.3. Standard transfection protocol The cosmid DNAs were transfected into Vero cells using the Superfect reagent and protocol (Qiagen Corp., Valencia CA). Briefly, cosmids A, B, C, and D DNAs (1.25 ␮g each) were digested with NotI to release the SVV insert DNA from the pWEB::TNC vector, pooled, phenol-chloroform extracted, and ethanol precipitated. The pooled cosmid DNAs (5 ␮g) were resuspended in 30 ␮l TE buffer ( 0.01 M Tris, 0.001 M EDTA, pH 7.5) and diluted to 150 ␮l in EMEM containing no serum or antibiotics. Plasmid pCMV62 (250 ng), expressing the SVV ORF 62 gene from a human cytomegalovirus (HCMV) immediate early gene promoter, was included in some transfections. Superfect transfection reagent (25 ␮l) was added to the DNA solution and the samples were incubated for ten minutes at 25 ◦ C after which 1 ml of growth media was added. The transfection mix was added to subconfluent Vero cell monolayers on 60 mm dishes for 2 h at 37 ◦ C after which the monolayers were washed with PBS and 4 ml of growth media added. Three days post transfection, the cells were seeded onto 75 cm2 flasks. Viral plaques were generally evident on Vero cell monolayers by 6–10 days post transfection. Virus was propagated in Vero cells for further analysis. 2.4. Mutagenesis of cosmid A For site-specific mutagenesis of SVV ORF 14 (gC gene), cosmid A was cleaved at the unique KpnI restriction endonuclease site (nucleotide 20,422 on the SVV genome) within SVV ORF 14 in order to linearize the cosmid. Two complementary oligonucleotides (5 -CTTAGTTAAGGCGCGCCTTAACTAAGGTAC and 5 -CTTAGTTAAGGCGCGCCTTAACTAAGGTAC) were annealed forming a doublestranded nucleic acid containing an AscI restriction endonuclease site along with stop codons in all three reading frames and bracketed by KpnI sites. This oligonucleotide was ligated into the KpnI site of the linearized cosmid A. The ligation products were packaged into phage heads and transduced into E. coli Epi305 cells. Resistant clones were selected and amplified in media containing ampicillin and chloramphenicol. Cosmid DNA was isolated by the Qiagen midiprep protocol. The mutated cosmid A was transfected along with cosmids B, C, and D and infectious virus was generated as described above. To confirm the presence of the AscI site within the SVVgC− mutant, the polymerase chain reaction (PCR) employing SVV ORF 14 specific primers

W.L. Gray, R. Mahalingam / Journal of Virological Methods 130 (2005) 89–94

(5 -AACAGGATCCAACTCTTCGCATTACTCG and 5AACAGGATCCAACTCTTCGCATTACTCG ) was used to generate a 1489 bp DNA fragment from purified SVVgC− or wild-type DNA. The PCR products were digested with AscI and analyzed by agarose gel electrophoresis and ultraviolet transillumination. DNA sequence analysis was also used to confirm insertion of the stop codons into ORF 14 of the SVV genome. A similar protocol was used to generate SVV recombinant viruses expressing GFP. A cassette was constructed which included the GFP gene expressed from a HCMV immediate early gene promoter and with a SV40 polyadenylation signal sequence (HCMV-GFP-polyA). This cassette is bracketed by KpnI restriction endonuclease sites permitting ligation and direct insertion into the unique KpnI site of cosmid A. The CosA/GFP was transfected along with cosmids B, C, and D and infectious virus was generated as described above. PCR and DNA sequence analysis confirmed the orientation of the cassette within the SVV-GFP recombinant virus genome. 2.5. SVV growth curve The in vitro growth properties of SVV mutants and wildtype SVV were compared in infected Vero cells. Confluent monolayers (25 cm2 flasks) of Vero cells were infected with 5 × 102 SVV-infected cells. At 5, 24, 48, and 72 h p.i., cells were removed with trypsin and resuspended in media. Dilutions of infected cells were added to Vero cell monolayers. At 5 days p.i., monolayers were fixed with methanol and stained with methylene blue. Viral plaques were counted and the titer for each time point was calculated.

3. Results 3.1. Generation of SVV infectious clones using overlapping cosmid DNAs Cosmids containing 32–38 kbp SVV DNA fragments were generated and characterized by restriction endonuclease and DNA sequence analyses. Four cosmids (Cos A, Cos B, Cos C, and Cos D), which contain overlapping SVV DNA sequences and which collectively represent the entire SVV genome, were characterized and used in further experiments. The genomic map locations of each cosmid are illustrated in Fig. 1 and the nucleotide coordinates are provided in Table 1. Each cosmid clone exhibited the expected restriction endonuTable 1 SVV Cosmids SVV cosmid

SVV genome locationa

Total length (kb)

A B C D

1–32,761 29,271–62,890 53,069–88,722 85,698–124,137

32.8 33.6 35.7 38.4

a

Nucleotide number on SVV genome from Gray et al. (2001).

91

Fig. 1. SVV cosmids and transfection procedure. (A) The 124.1 kb SVV genome includes a long (L) component consisting of a unique long (UL) sequence bracketed by 8 bp internal and terminal inverted repeats (IRL and TRL). The L module is covalently linked to a short component, which includes a unique short region (US) flanked by internal and terminal inverted repeats (IRS and TRS). (B) Location of SVV cosmids A, B, C, and D, which include 32–38 kb subgenomic SVV DNA fragments that overlap and collectively represent the entire SVV DNA genome. The location of the unique KpnI site within cosmid A that was used for insertion of stop codons and the GFP expression cassette is indicated. (C) Summary of SVV cosmid transfection protocol.

clease profile after digestion with BamHI, EcoRI, and NotI (data not shown). Transfection of subconfluent Vero cell monolayers on 60 mm dishes with the set of four cosmids yielded infectious virus. Addition to the transfection mix of a vector expressing the SVV open reading frame 62 (pCMV62), which encodes the putative major immediate early gene behind a HCMV promoter/enhancer, appeared to enhance infectivity (sometimes by as much as two-fold), although addition of pCMV62 was not essential to generate infectious virus (data not shown). Viral plaques (ranging from 5 to 60 per dish) were generally evident by 6–10 days post transfection. Restriction endonuclease analysis, including BamHI, BglII, and EcoRI digestions, confirmed that wild-type and cosmid-generated SVV DNAs have identical fingerprint profiles (Fig. 2). 3.2. Site-specific mutagenesis of the SVV gC (ORF 14) gene To demonstrate that the SVV cosmid-based genetic system can be used to generate site-specific mutations, a translational stop codon was inserted near the 3 end of SVV ORF 14, which encodes the SVV gC glycoprotein. A 30 base pair (bp) double-stranded oligonucleotide containing an AscI restriction endonuclease site and translational stop codons bracketed by KpnI sites was inserted into the unique KpnI restriction endonuclease site of cosmid A within ORF 14. Co-transfection of Vero cells with this mutated cosmid A along with cosmids B, C, and D, generated infectious virus, from which viral DNA was purified. Restriction endonuclease analysis demonstrated insertion of a unique AscI site into

92

W.L. Gray, R. Mahalingam / Journal of Virological Methods 130 (2005) 89–94

Fig. 2. Restriction endonuclease profile comparison of viral DNA derived from cosmid-generated SVV and wild-type SVV. Viral DNA was purified from Vero cells infected with cosmid-generated SVV or with wild-type SVV. DNAs digested with BamHI, BglII, and EcoRI were fractionated by agarose gel electrophoresis and analyzed under ultraviolet light transillumination. M1, 1 kb molecular weight markers. M2, high molecular weight markers. See Gray et al. (1992) for further details on sizes of individual SVV DNA fragments.

ORF 14 of the SVV mutant genome (Fig. 3A). DNA sequence analysis confirmed insertion of a stop codon within the SVV ORF 14, which is expected to result in a truncated 481 amino acid gC protein (Fig. 3B). The results demonstrate the utility of the SVV cosmid system to insert a site-specific mutation into the viral genome. 3.3. Insertion of a foreign gene into the SVV genome A recombinant SVV expressing the GFP was generated using the SVV cosmid-recombination system. A 1.9 kb cas-

sette containing the GFP gene expressed under control of the HCMV immediate early promoter was inserted into cosmid A within the unique KpnI site of ORF 14. Two different constructs were created so that the GFP gene was inserted into cosmid A in both orientations (same DNA strand as ORF 14 or the opposite strand). Vero cells were transfected with CosA-GFP along with cosmids B, C, and D. Ten days later infectious SVV clones containing GFP were identified, selected, and amplified. Viral DNA was purified and DNA sequence analysis confirmed the insertion and orientation of the GFP cassette (data not shown). Examination of viral plaques upon ultraviolet illumination revealed fluorescent infected cells demonstrating expression of the GFP gene within the SVV genome (Fig. 4). The orientation of the GFP gene within the SVV genome did not appear to be critical as similar levels of expression were detected whether the GFP gene was inserted into the same DNA strand as ORF 14 (Fig. 4A) or into the opposite strand (Fig. 4B). 3.4. Comparison of in vitro replication of wild-type SVV and recombinant SVV A study was conducted to determine whether the cosmidgenerated SVVgC and SVV-GFP mutants can replicate as efficiently as wild-type SVV in Vero cell culture. Confluent Vero cell monolayers (25 cm2 flasks) were infected with 5 × 102 wild-type SVV, SVVgC truncated mutant virus, and SVV-GFP recombinant virus infected Vero cells. Infected monolayers were harvested at 5, 24, 48, and 72 h p.i., and infectious titers were determined by plaque assay. The results demonstrate that the SVVgC mutant and the SVV-GFP recombinant virus replicate in vitro as efficiently as wild-type SVV (Fig. 5). The findings indicate that cosmid-generated SVV replicates as efficiently as wild-type virus in cell culture. Expression of a truncated, but still functional gC, may

Fig. 3. Site-specific mutagenesis of the SVV gC gene (ORF 14). A 30 bp oligonucleotide containing translational stop codons and an AscI restriction endonuclease site was inserted into the unique KpnI site within ORF 14 of cosmid A. (A) Confirmation of insertion of the AscI site. Viral DNAs (1489 bp expected size) were PCR amplified from SVV wild-type genomic DNA (lane 2) or SVV gC mutant virus genomic DNA (lane 3) templates, digested with AscI, and analyzed by agarose gel electrophoresis and UV transillumination. Digestion of the PCR fragment derived from the SVV gC mutant DNA revealed two DNA fragments near the expected 1076 and 413 bp sizes, demonstrating the presence of the inserted AscI site within the SVV mutant virus. Lane 1, 1 kb molecular weight marker. Lane 4, 100 bp molecular weight marker. (B) DNA and predicted amino acid sequence of the truncated gC of the SVV gC mutant based upon DNA sequence analysis. The AscI site is indicated.

W.L. Gray, R. Mahalingam / Journal of Virological Methods 130 (2005) 89–94

93

Fig. 4. Recombinant SVV expressing GFP. The GFP gene under direction of the HCMV promoter was inserted into the SVV genome oriented in the same direction (A) or opposite to (B) that of SVV ORF 14. SVV plaques were identified by darkfield (left) and fluorescent microscopy (right).

Fig. 5. In vitro growth characteristics of the cosmid-generated SVV gC− mutant (boxes) and the SVVgC-GFP recombinant virus (triangles) compared to growth of wild-type SVV (diamonds) in Vero cells. Confluent monolayers (25 cm2 flasks) of Vero cells were infected with 5 × 102 infected cells, harvested at 5, 24, 48, and 72 h p.i., and the titer was determined by the number of viral plaques per flask. The data represent the average of two replicate experiments.

explain the ability of the SVVgC mutant virus to replicate as efficiently as wild-type SVV in cell culture. However, the results are in agreement with our earlier observation that SVV with a defective gC may replicate efficiently in vitro (Gray and Byrne, 2003).

4. Discussion A genetic system was developed to generate infectious SVV clones following transfection of Vero cells with four overlapping 32–38 kb SVV DNA fragments cloned into cosmid vectors. The approach is similar to the cosmid-based

recombination methods designed for mutagenesis of VZV and other herpesviruses, including herpes simplex virus, pseudorabies virus, and human cytomegalovirus (Cohen and Seidel, 1993; Cunningham and Davison, 1993; Van Zijl et al., 1988). Unlike the VZV cosmid system, in which viral the DNAs are transfected into human melanoma cells (Mewo) by the standard calcium phosphate transfection method (Cohen and Seidel, 1993), the SVV DNA cosmids were transfected into Vero cells of monkey origin using SuperFect, an activated-dendrimer transfection reagent (Tang et al., 1996). Transfection of SVV DNA cosmids into Vero cells using the calcium phosphate technique has not successfully generated infectious virus. SVV generated by the cosmid system has similar molecular and in vitro growth properties as wildtype SVV. A future study will compare the pathogenesis of cosmid-generated SVV and wild-type SVV. The SVV cosmid-based approach is a significant improvement over the previous method of SVV mutagenesis, which required recombination between homologous flanking sequences and selection using a strong reporter gene such as GFP (Gray and Byrne, 2003; Mahalingam et al., 1998). The cosmid-based procedure avoids problems with the cellassociated nature of SVV by not requiring a selectable marker gene or isolation and plaque purification of viral mutants. The SVV cosmid system will be useful to investigate the role of SVV genes in viral replication and pathogenesis. In this report, a site-specific mutation containing a translation stop codon was inserted into the SVV gC gene, which is nonessential for viral replication in cell culture (Gray and Byrne, 2003). The SVV gC is hypothesized to play an important role in viral pathogenesis, since the VZV gC is a virulence factor for viral replication in human skin (Moffat et al., 1998).

94

W.L. Gray, R. Mahalingam / Journal of Virological Methods 130 (2005) 89–94

The SVV gC gene encodes a 540 amino acid protein with 43.8% amino acid identity with the VZV gC, which is located on the viral envelope and within infected cell membranes. The effect of the stop codon insertion is predicted to result in a truncated SVV gC protein with the loss of 66 amino acids from the carboxy terminus (amino acids 475–540), including a hydrophobic region (amino acids 508–540) which may serve as a membrane anchor (Gray and Byrne, 2003). Confirmation of the SVV gC truncation at the protein level will require specific SVV gC antiserum which is not presently available. However, mutagenesis of the SVV gC gene was verified by insertion of a novel AscI restriction endonuclease site and by DNA sequence analysis. The live attenuated VZV vaccine is safe and effective for immunization against chickenpox. In addition, the VZV vaccine virus offers advantages, including a large size genome, for use as a recombinant vaccine against other diseases (Arvin et al., 1999). Several foreign genes including antigens encoded by hepatitis B virus, human immunodeficiency virus, herpes simplex virus, and Epstein-Barr virus have been expressed upon incorporation into the VZV genome (Heineman et al., 2004; Lowe et al., 1987; Shiraki et al., 2001). However, the lack of suitable animal models has limited the ability to evaluate the effectiveness of recombinant VZV vaccines. The simian varicella model offers an opportunity to evaluate recombinant varicella vaccines. In this report, the ability to generate SVV recombinant viruses expressing foreign genes using the SVV cosmid system was demonstrated by expression of the GFP gene upon insertion within the gC open reading frame of the SVV genome. Insertion of foreign genes within the SVV gC gene may have the additional benefit of attenuating the recombinant virus for vaccination. In addition, we have recently modified the cosmid system so that foreign genes can be easily inserted within the intergenic region between SVV ORFs 12 and 13 and no viral genes are disrupted. SVV recombinant viruses expressing other foreign genes, including genes encoding simian immunodeficiency virus (SIV) and respiratory syncytial virus (RSV) antigens, have been constructed and will be evaluated for their ability to effectively immunize and protect nonhuman primates. Acknowledgements This study was supported by Public Health Service Grants AI052373 (WLG) and NS32623 (RM) of the National Institutes of Health. We thank Mary Wellish, Kara Davis, Ben Starnes, Michael White, and Brad Byrne for excellent technical help and Dr. Don Gilden for stimulating discussions. References Allen, W.P., Felsenfeld, A.D., Wolf, R.H., Smetana, H.F., 1974. Recent studies on the isolation and characterization of delta herpesvirus. Lab. Anim. Sci. 24, 222–228.

Arvin, A.M., Mallory, S., Moffat, J.F., 1999. Development of recombinant varicella-zoster virus vaccines. Contrib. Microbiol. 3, 193–200. Cohen, J.I., Seidel, K.E., 1993. Generation of varicella-zoster virus (VZV) and viral mutants from cosmid DNAs: VZV thymidylate synthetase is not essential for replication in vitro. Proc. Natl. Acad. Sci. USA 90, 7376–7380. Cunningham, C., Davison, A.J., 1993. A cosmid-based system for constructing mutants of herpes simplex virus type 1. Virology 197, 116–124. Fletcher III, T.M., Gray, W.L., 1992. Simian varicella virus: Characterization of virion and infected cell polypeptides and the antigenic crossreactivity with varicella-zoster virus. J. Gen. Virol. 73, 1209–1215. Gray, W.L., 2004. Simian varicella: a model for human varicella-zoster virus infections. Rev. Med. Virol. 14, 363–381. Gray, W.L., Byrne, B.H., 2003. Characterization of the simian varicella virus glycoprotein C, which is nonessential for in vitro replication. Arch. Virol. 148, 537–545. Gray, W.L., Pumphrey, C.Y., Ruyechan, W.T., Fletcher, T.M., 1992. The simian varicella virus and varicella zoster virus genomes are similar in size and structure. Virology 186, 562–572. Gray, W.L., Starnes, B., White, M.W., Mahalingam, R., 2001. The DNA sequence of the simian varicella virus genome. Virology 284, 123–130. Heineman, T.C., Pesnicak, L., Mir, A. Ali, Krogmann, T., Krudwig, N., Cohen, J.I., 2004. Varicella-zoster virus expressing HSV-2 glycoproteins B and D induces protection against HSV-2 challenge. Vaccine 22, 2558–2565. Kemble, G.W., Annunziato, P.W., Lungu, O., Winter, R.E., Cha, T., Silverstein, S.J., Spaete, R.R., 2000. Open reading frame S/L of varicellazoster virus encodes a cytoplasmic protein expressed in infected cells. J. Virol. 74, 11311–11321. Lowe, R.S., Keller, P.M., Keech, B.J., Davison, A.J., Whang, Y., Morgan, A.J., Kieff, E., Ellis, R.W., 1987. Varicella-zoster virus as a live vaccine for the expression of foreign genes. Proc. Natl. Acad. Sci. USA 84, 3896–3900. Mahalingam, R., Smith, D., Wellish, M., Wolf, W., Dueland, A.N., Cohrs, R., Soike, K., Gilden, D., 1991. Simian varicella virus DNA in dorsal root ganglia. Proc. Natl. Acad. Sci. USA 88, 2750–2752. Mahalingam, R., Wellish, M., White, T., Soike, K., KleinschmidtDeMasters, B.K., Gilden, D.H., 1998. Infectious simian varicella virus expressing the green fluorescent protein. J. Neurovirol. 4, 438–444. Mallory, S., Sommer, M., Arvin, A.M., 2005. Analysis of the glycoproteins I and E of varicella-zoster virus (VZV) using deletional mutations of VZV cosmids. J. Infect. Dis. 178, 22–S26. Moffat, J.F., Zerboni, L., Kinchington, P., Grose, C., Kaneshima, H., Arvin, A.M., 1998. Attenuation of the vaccine Oka strain of varicellazoster virus and role of glycoprotein C in alphaherpesvirus virulence demonstrated in the SCID-hu mouse. J. Virol. 72, 965–974. Niizuma, T., Zerboni, L., Sommer, M.H., Ito, H., Hinchliffe, S., Arvin, A.M., 2005. Construction of varicella-zoster virus recombinants from parent Oka cosmids and demonstration that ORF65 protein is dispensible for infection of human skin and T cells in the SCID-hu mouse model. J. Virol. 77, 6062–6065. Sato, H., Pesnicak, L., Cohen, J.I., 2002. Varicella-zoster virus open reading frame 2 encodes a membrane phosphoprotein that is dispensible for viral replication and for establishment of latency. J. Virol. 76, 3575–3578. Shiraki, K., Sato, H., Yoshida, Y., Yamamura, J., Tsurita, M., Kurokawa, M., Kageyama, S., 2001. Construction of Oka varicella vaccine expressing human imunodeficiency virus env antigen. J. Med. Virol. 64, 89–95. Tang, M.X., Redemann, C.T., Szoka, F.C., 1996. In vitro gene delivery by degraded polyamidoamine dendrimers. Bioconjugate Chem. 7, 703–714. Van Zijl, M., Quint, W., Briaire, J., deRover, T., Gielkens, A., Berns, A., 1988. Regeneration herpesviruses from molecularly cloned subgenomic fragments. J. Virol. 62, 2191–2195.