A defined intestinal colonization microbiota for gnotobiotic pigs

Veterinary Immunology and Immunopathology 149 (2012) 216–224

Contents lists available at SciVerse ScienceDirect

Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm

Research paper

A defined intestinal colonization microbiota for gnotobiotic pigs Georgina Laycock a,∗ , Leanne Sait a , Charlotte Inman a,1 , Marie Lewis a , Hauke Smidt c , Pauline van Diemen b,2 , Frieda Jorgensen a,3 , Mark Stevens b,4 , Michael Bailey a a Division of Veterinary Pathology, Infection and Immunity, School of Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, United Kingdom b Institute of Animal Health, Compton, Newbury, Berks. RG20 7NN, United Kingdom c Laboratory of Microbiology, Wageningen University, Dreijenplein 10, 6703 HB Wageningen, The Netherlands

a r t i c l e

i n f o

Article history: Received 21 February 2012 Received in revised form 11 July 2012 Accepted 12 July 2012 Keywords: Pig Gnotobiotic Colonization Intestinal microbiota Neonate

a b s t r a c t Maximising the ability of piglets to survive exposure to pathogens is essential to reduce early piglet mortality, an important factor in efficient commercial pig production. Mortality rates can be influenced by many factors, including early colonization by microbial commensals. Here we describe the development of an intestinal microbiota, the Bristol microbiota, for use in gnotobiotic pigs and its influence on synthesis of systemic immunoglobulins. Such a microbiota will be of value in studies of the consequences of early microbial colonization on development of the intestinal immune system and subsequent susceptibility to disease. Gnotobiotic pig studies lack a well-established intestinal microbiota. The use of the Altered Schaedler Flora (ASF), a murine intestinal microbiota, to colonize the intestines of Caesarean-derived, gnotobiotic pigs prior to gut closure, resulted in unreliable colonization with most (but not all) strains of the ASF. Subsequently, a novel, simpler porcine microbiota was developed. The novel microbiota reliably colonized the length of the intestinal tract when administered to gnotobiotic piglets. No health problems were observed, and the novel microbiota induced a systemic increase in serum immunoglobulins, in particular IgA and IgM. The Bristol microbiota will be of value for highly controlled, reproducible experiments of the consequences of early microbial colonization on susceptibility to disease in neonatal piglets, and as a biomedical model for the impact of microbial colonization on development of the intestinal mucosa and immune system in neonates. © 2012 Elsevier B.V. All rights reserved.

1. Introduction ∗ Corresponding author. Tel.: +44 0117 3319128; fax: +44 0117 928 89613. E-mail address: [email protected] (G. Laycock). 1 Current address: School of Cancer Studies, University of Birmingham, Edgbaston, Birmingham, United Kingdom. 2 Current address: The Jenner Institute, Old Road Campus Research Building, Nuffield Department of Medicine, Oxford University, Oxford, United Kingdom. 3 Current address: Health Protection Agency, B23/23, Microbiology Services, Food, Water & Environmental Microbiology Network, Porton Down, Salisbury SP4 OJG, United Kingdom. 4 Current address: The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Easter Bush, Midlothian, United Kingdom. 0165-2427/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2012.07.004

The mature adult microbiota has been predicted to include at least 800 species and >7000 strains, mainly from three of the 55 bacterial divisions (Backhed et al., 2005), but can vary considerably between individuals of the same host species (Eckburg et al., 2005). Variation in post-natal intestinal colonization affects the degree of susceptibility of neonatal piglets to pathogenic intestinal bacteria (Barrow et al., 2001). Indeed, colostrum-deprived piglets reared in conventional conditions succumb to sepsis within 24 h of birth (Owen et al., 1961). The composition of this early microbiota is influenced by the neonatal environment, including mode of birth and feeding (Penders et al.,

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

2006). In early post-natal intestinal colonization the total bacterial number increases rapidly, with initial aerotolerant colonizers succeeded by anaerobic species of bacteria in porcine and human intestinal and faecal samples (Orrhage and Nord, 1999; Swords et al., 1993). High levels of variation are apparent in the microbiota of neonates over time and between individuals (Schwiertz et al., 2003). In addition to affecting susceptibility to intestinal pathogens, variation in initial intestinal colonization has been implicated as a risk factor in a wide range of non-infectious diseases including human infant allergy (Bjorksten et al., 2001; Kuitunen et al., 2009; Verhulst et al., 2008) and colon cancer (Wu et al., 2009). Colonization also affects the ability to develop tolerance to dietary antigens (Prioult et al., 2003; Wannemuehler et al., 1982). These associations indicate that the microbiota influences development of the neonatal immune system, in addition to preventing colonization by potential pathogenic bacteria by competitive exclusion. Given the importance of early bacterial colonization on host susceptibility to disease, there is a clear need for controlled animal models of neonatal colonization in biomedical research. Two approaches have been used to control early colonization; direct control of colonization using defined microbiota in gnotobiotic environments; and manipulation of the early rearing environment in order to influence colonization events in conventionally colonized animals. Gnotobiotic experiments have the advantages of highly controlled, repeatable experimental design, which reduces inter-individual variation. In contrast, experiments using manipulation of conventional colonization are generally more directly applicable to neonates, but more difficult to interpret. In gnotobiotic studies, the composition of the defined microbiota used is pivotal to the results obtained. The Altered Schaedler Flora (ASF) is a well established, 8 species, intestinal microbiota, commonly used in gnotobiotic mice (Orcutt and Judge, 1987; Schaedler et al., 1965). However, the pig is also of value in gnotobiotic studies focussing on early immune development, as there is essentially no transfer of maternal immunity in utero (Butler and Sinkora, 2007; Nguyen et al., 2007) and neonates have a poorly developed mucosal immune system (Rothkotter et al., 1991). Additionally, the digestive physiology of the pig is comparable to that of humans, and pigs are genetically more similar to humans than are mice (Wernersson et al., 2005). Currently, there is no comparable, wellestablished porcine intestinal colonization microbiota. Monocolonization studies have been performed in piglets (Haverson et al., 2007; Wen et al., 2009), but the effects on the host may not be particularly representative of a complex microbiota. Butler et al. (2000) used a 10-species standardized porcine colonization microbiota, originally developed at the Food and Feed Safety Research Unit (USDA-ARS, College Station, Texas): this microbiota did drive expansion of the B cell compartment of the immune system, but the extent to which each species colonized different animals and intestinal sites was not determined. In order to study the impact of colonization in gnotobiotic pigs a defined microbiota which reflects normal host colonization is needed. Here we describe the use, firstly,

217

of a modified form of the ASF to colonize gnotobiotic pigs, and then the development of a new intestinal colonization microbiota for pigs. 2. Materials and methods 2.1. Gnotobiotic piglets Animal experiments were conducted with the ethical approval of the Institute for Animal Health Ethical Review Committee and in accordance with the Animal (Scientific Procedures) Act 1986 (license 30/2485). Commercial hybrid and Babraham piglets were Caesarean-derived at 109 days of gestation (2 days prior to expected full-term) in a sterile surgical isolator unit (Bell Isolation Systems, Livingston, UK) and housed individually or in pairs in sterile gnotobiotic isolator units (Bell Isolation Systems) at the Institute for Animal Health, Compton. All isolator units were supplied with HEPA filtered air under positive pressure to maintain sterility. Piglets were fed a proprietary brand of evaporated milk (Tesco PLC, Dundee, UK) three times daily during the first week, and twice daily thereafter. Swabs taken from surgical sites during the Caesarean section and weekly rectal swabs from piglets were plated onto blood agar for aerobic and anaerobic culture for 48 h to check for bacterial contaminants. All piglets were monitored for lethargy, anorexia, diarrhoea and other potential signs of clinical illness throughout the experiments, particularly post-administration of the microbiota. Rectal temperatures and faecal swabs were checked when potential signs of illness were seen. Six gnotobiotic experiments were performed (Table 1). Commercial hybrid piglets were used in experiments 1 and 2. Piglets from the highly inbred Babraham line (Signer et al., 1999) were used in experiments 3–6. Colonized piglets from experiments 1 and 2 were killed at 27 and 21 days old respectively, 14–16 days after the first colonization. All other piglets were killed at 20–21 days old. All piglets were killed with an intravenous dose of 2% pentobarbital sodium. Cardiac blood for collection of serum was taken immediately after death. Luminal content and mucosal scrapes of the proximal and distal jejunum, terminal ileum, caecum and the mid-ascending colon were taken aseptically and snap-frozen in liquid nitrogen until analysed. 2.2. Measurement of immunoglobulin classes and subclasses Capture ELISA was carried out to determine total serum IgG1 , IgG2 , IgA and IgM. Briefly, microplates were coated with either affinity purified goat anti-pig IgG (H + L), goat anti-pig IgA or goat anti-pig IgM (Bethyl Laboratories, Montgomery, TX, USA). Serial dilutions of serum samples and reference standard were added to coated plates and incubated for 2 h at room temperature. Bound immunoglobulins were detected using isotype-specific monoclonal antibodies (anti-pig IgA K61.1B4, anti-pig IgM K52.1C3, anti-pig IgG1 K139.3C8, anti-pig IgG2 K68.1G2 , Serotec, Kidlington, UK) followed by horseradish peroxidase (HRP)-conjugated goat-anti-mouse IgG1 (Sigma)

218

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

Table 1 Pig breed, number of pigs colonized, bacterial microbiota and the number of days post-Caesarean on which the microbiota was administered to piglets in gnotobiotic experiments 1–6. Experiment

Number of pigs colonized

Breed of pig

Colonization microbiota (contaminants)

Days post-Caesarean microbiota administered

1

6

Commercial hybrid

14, 17

2 3 4

4 5 3

Commercial hybrid Babraham Babraham

5 6

4 2

Babraham Babraham

Modified ASF (Staphylococcus sp.) Modified ASF Modified ASF (Bacillus sp.) New microbiota and R. intestinalis New microbiota New microbiota

6, 9 5, 11 0, 1, 2 0, 1, 2 0, 1, 2

Contaminants of colonized pigs are shown in brackets; no contaminants were detected in germ-free piglets. Modified ASF: Clostridium sp. (ASF356), Lactobacillus sp. (ASF360), Lactobacillus animalis (ASF361), Eubacterium plexicatum (ASF492), Parabacteroides sp. (ASF519) and Propionibacterium sp. New microbiota: Lactobacillus amylovorus DSM 16698T , Clostridium glycolicum and Parabacteroides sp (ASF519). R. intestinalis, Roseburia intestinalis.

and OPD (peroxidase substrate; Sigma). Concentrations of immunoglobulin subclasses were determined by interpolation of samples onto the reference standards.

2.3. Modified ASF A modified form of the ASF, namely Clostridium sp. (ASF356), Lactobacillus sp. (ASF360), Lactobacillus animalis (ASF361), Eubacterium plexicatum (ASF492), Parabacteroides sp. (ASF519) (all Taconic Farms Inc., Lille Skensved, Denmark) and Propionibacterium sp. (unclassified), were used to colonize piglets in experiments 1–3. The members of the original ASF which were not used were the strict anaerobes ASF500 and ASF502, due to inevitable oxygen exposure during oral administration, and a highly mouseadapted strain ASF457.

2.5. Bacterial compatibility Strains in the new microbiota were assessed for effects on the growth of each of the other strains in vitro. Each strain was streaked onto pre-reduced Schaedler agar and cross-streaked with the other strains. The growth of each strain alone was compared with growth at the points where the streaks crossed. The possible effect of bacteriocins, released by dead cells, was assessed by culturing a streak of each species on Schaedler agar overnight. Bacterial cells in streaks were killed and permeabilized by inverting the plates over chloroform for 45 s. Cooled ‘soft-top’ agar, (0.75%), containing the other strains was layered over the streaks, set and cultured overnight. Plates were examined for inhibition of bacterial growth around the original streaks. 2.6. Culture conditions

2.4. Selection of species for the new intestinal colonization microbiota One bacterial strain from each of the four most frequently identified phylogenetic groups identified in the ileum, caecum and colon in 12–18 week old pigs (Leser et al., 2002) was selected for inclusion in the new microbiota as follows (Table 2): Eubacterium and relatives, Roseburia intestinalis, identified in pig intestinal content (Janczyk et al., 2007) and able to grow in media containing a wide range of metabolic carbohydrate substrates, including many simple saccharides (Duncan et al., 2006); Clostridium and relatives, Clostridium glycolicum identified in the luminal content of unweaned pigs (P. Jancyzk, unpublished data); the Bacillus–Lactobacillus–Streptococcus (BLS) subdivision, Lactobacillus amylovorus DSM 16698T (previously known as Lactobacillus sobrius (Konstantinov et al., 2005; Marti et al., 2010)), a porcine isolate, found in unweaned pigs (Konstantinov et al., 2006) which has been shown to be protective against in vivo challenge with enterotoxigenic E. coli, in conventionally colonized pigs (Konstantinov et al., 2008); and the Cytophaga-Flexibacter-Bacteroides (CFB) group, Parabacteroides sp. (ASF519) which was shown to give reliable colonization of the large intestine in experiments 1–3.

All bacteria were cultured on pre-reduced agar plates, in a MK3 Anaerobic Work Station (Don Whitley Scientific Limited, Shipley, UK), with a 10% CO2 , 10% H2 and 80% N2 atmosphere, at 36.5 ◦ C, or incubated at 37 ◦ C in a 2.5 L anaerobic jar containing an AnaeroGen sachet (Oxoid Limited, Basingstoke, UK). Once strains were considered pure, bacterial colonies were anaerobically transferred into prereduced, sterile, anaerobic 50 ml vials containing 15 ml of broth with 0.5 g/L sodium sulphide as a reducing agent and 0.01% (w/v) resazurin as an oxygen indicator. L. amylovorus DSM 16698T was cultured on pre-reduced de Man Rogosa Sharpe (MRS) agar and broth (Oxoid Limited). All other bacterial species were cultured on pre-reduced Schaedler agar and broth (BD Biosciences, Oxford, UK). After transfer, vials were cultured for a further 24–96 h, dependent on bacterial species. Broth cultures were checked for contaminants by light microscopy and by aerobic and anaerobic culture on Schaedler agar and blood agar plates. 2.7. DNA extraction Prior to administering the microbiota to piglets, the identity of each bacterial strain in broth culture was confirmed by DNA sequence analysis of 16S rDNA. DNA was extracted from 6 to 8 ml aliquots of turbid broth culture

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

219

Table 2 Details of the species selected for the new colonization microbiota, including taxonomic phylum, Gram status, mode of respiration and source of the bacterial species selected. Bacteria genus and species Parabacteroides sp. (ASF519) T

Lactobacillus amylovorus DSM 16698 Clostridium glycolicum

Roseburia intestinalis

Phylum

Gram status

Mode of respiration

Isolate source

CFB

−ve

Facultative anaerobe

Firmicutes (BLS subdivision) Firmicutes (Clostridium and relatives)

+ve

Facultative anaerobe

+ve

Anaerobe

+ve

Anaerobe

Murine intestinal isolate. Taconic Farms. Porcine intestinal isolate. DSM 16698 Human intestinal isolate, also found in pigs. DSM 1288 Human intestinal isolate, also found in pigs. DSM 14610

Firmicutes (Eubacterium and relatives)

CFB, Cytophaga-Flexibacter-Bacteroides; BLS, Bacillus–Lactobacillus–Streptococcus; DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, DSMZ, Braunschweig, Germany.

using the QIAamp DNA stool mini kit (Qiagen Limited, Crawley, UK) according to manufacturer’s instructions, with the exception that samples were incubated in ASL buffer at 94 ◦ C for 5 min, then 70 ◦ C for 5 min, instead of incubation at 70 ◦ C for 5 min only.

were as follows: (i) 95 ◦ C for 15 min; (ii) 35 thermal cycles of 95 ◦ C for 15 s, an annealing temperature between 52 and 70 ◦ C for 15 s, and 72 ◦ C for 30 s; (iii) 72 ◦ C for 4 min.

2.8. Confirmation of microbiota species by sequence analysis

Piglets were either maintained germ-free or were given the intestinal colonization microbiota. Each dose of colonization microbiota administered to piglets was freshly prepared by combining 2 ml aliquots from constituent single strain broth cultures into empty, pre-reduced, sterile 50 ml vials. The most aerotolerant bacteria were transferred to empty vials first. Colonization flora was administered to piglets as a single, oral, 2 ml dose. Where a colour change of resazurin indicated exposure of the bacteria to oxygen, broths were discarded and a second dose prepared. In all experiments multiple doses were given to each piglet. The modified ASF was administered twice, at least 5 days after derivation. In contrast, the new microbiota was administered in three doses, the first within 4 h of birth, just before or after the piglets first meal. The number of each strain in doses of the new microbiota administered, as quantified by flow cytometry, were: L. amylovorus DSM 16698T : 6.1–10.1 × 106 bacteria/ml, C. glycolicum: 5.6–8.6 × 106 bacteria/ml and Parabacteroides sp.: 2.9–4.5 × 106 bacteria/ml.

A ∼1.2 kb length of DNA from the 16S rDNA region was amplified using primers (5 –3 ) GAGTTTGATCMTGGCTCAG and GGYTACCTTGTTACGACTT (modified from Lane (1991)). PCR products were purified using the Promega wizard SV PCR clean-up system (Promega UK Limited, Southampton, UK) according to manufacturer’s instructions and sequenced by Eurofins MWG Operon (Ebersberg, Germany). Good quality sections of sequence data were compared to reported DNA sequences using NCBI BLAST. 2.9. Assessment of colonization by PCR Primers specific for constituent bacteria in each colonization microbiota were used to differentiate between bacteria. PCR primers used for members of the modified ASF were identical to those used by Sarma-Rupavtarm et al. (2004). Propionibacterium sp. was not a member of the original ASF but no primers were designed, as the modified ASF was not used for later experiments. Primers to differentiate between members of the new microbiota were designed using Primer 3 software version 0.4.0 (Rozen and Skaletsky, 2000) and M-fold version 3.2 software (Zuker, 2003) before being tested on DNA extracted from all of the new microbiota species. Primers used were: C. glycolicum, Cgly575F, GGGAGACTTGAGTGCAGGAG; Cgly945R, TTAGGCATCGGTCAAAAGGA; L. amylovorus DSM 16698T , Lamy86F, ACTTCGGTAATGACGTTG; Lamy189R, CGGTATTAGCACCTGTTTC and R. intestinalis, Rint565F, CGGTACGGCAAGTCTGATG; Rint1019R, CGATGCTCCGAAGAGAAAAC. Each 50 ␮l PCR mixture contained 2.5 units HotStar Taq DNA polymerase, 1.5–4 mM MgCl2 , 1× PCR buffer, 200 ␮M each dNTP and 5 ␮l of extracted DNA. All primers were used at 20 ␮M, with the exception of CG-575F and CG-945R, which were used at 2 ␮M. Reaction conditions

2.10. Administration of the microbiota

2.11. Bacterial quantification by flow cytometry As quantitative culture was considered unreliable, due to the fastidious nature of some bacterial strains, bacteria were enumerated by flow cytometry. Bacterial preparations and solutions used were kept ice-cold. 2 ml aliquots of bacterial broth, from the single strain broths used to make the colonization microbiota were centrifuged at 13,000 × g for 5 min and the pellet washed in PBS, re-centrifuged and resuspended in 0.5 ml PBS, by vortexing, before adding 1.5 ml 4% paraformaldehyde (w/v). For intestinal samples from piglets, 0.2 g sample was suspended in 1.8 ml PBS by vortexing with 3–4, 1.5–2.5 mm diameter glass beads for 3 min and centrifuged at 100 × g for 3 min at 4 ◦ C to remove large debris. 0.5 ml of the supernatant was added to 1.5 ml 4% paraformaldehyde. All samples in paraformaldehyde solution were vortexed briefly and incubated at 4 ◦ C in

220

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

Table 3 PCR results for the presence of members of the modified ASF in luminal content or mucosal scrapes from the proximal and distal jejunum, terminal ileum, caecum and colon, from piglets from experiments 1–3. Bacteria genus and species

Proximal jejunum

Distal jejunum

Terminal ileum

Caecum

Colon

Total pigs colonized

Clostridium sp. (ASF356) Lactobacillus sp. (ASF360) Lactobacillus animalis (ASF361) Eubacterium plexicatum (ASF492) Parabacteroides sp. (ASF519)

0/15 1/15 6/15 0/15 9/15

0/15 5/15 6/15 0/15 11/15

0/9 5/9 7/9 0/9 9/9

6/15 12/15 15/15 0/15 15/15

6/15 12/15 12/15 0/15 15/15

6/15 14/15 15/15 0/15 15/15

the dark for 18–24 h. Fixed samples were vortexed briefly, centrifuged for 5 min at 13,000 × g, washed in 1 ml PBS and re-centrifuged. The supernatant was removed by blotting. Cells were then fixed in 50% ice-cold ethanol–PBS (v/v) for a minimum of 1 h at −20 ◦ C. Fixed cells were washed in PBS and resuspended in 1 ml staining buffer (1 mM EDTA, 0.01%, polyoxyethylenesorbitan monolaurate (Tween 20) and 0.1% sodium azide in PBS, adjusted to pH 7.4 ± 0.1) containing 1.26 ␮M thiazole orange when used for samples from pure bacterial cultures and 2.52 ␮M thiazole orange for samples of intestinal content. All samples for flow cytometry were incubated on ice for a minimum of 20 min and quantified by flow cytometry using a FACSDiVa (Becton Dickinson Biosciences, Oxford, UK) within 4 h of preparation. 25 ␮l Flow-Count Fluorospheres (Beckman Coulter, High Wycombe, UK) were added to each sample and the stop was set such that the bacterial events associated with a total of 500 beads were counted. Unless otherwise stated, gates for analysis of positive stained cells were set using the corresponding negative control unstained cells, such that ≤5% of unstained objects fell within the positive gate. For intestinal samples, the mean number of background thiazole positive objects in germ-free, uncolonized pigs was subtracted from colonized pig counts. The mean bacterial count and 95% confidence intervals (±1.96 × standard error) were calculated for each intestinal site. 3. Results 3.1. Colonization with the modified ASF Fifteen gnotobiotic piglets (10 commercial hybrid and 5 Babraham) were colonized with a modified form of the ASF in three separate experiments, 5–17 days after birth (Table 1). In two of these experiments, one or more of the doses administered were contaminated with the bacterial species shown. L. animalis (ASF361) and Parabacteroides sp. (ASF519) colonized all 15 piglets, while the second Lactobacillus (ASF360) colonized 14/15 piglets (Table 3). Clostridium sp. (ASF356) colonized only 6/15 piglets, while E. plexicatum (ASF492) did not colonize any of the pigs at any intestinal site. Colonization was generally more consistent in the large intestine: Parabacteroides and the Lactobacillus sp. were always present in the large intestine, even when they were not recovered from small intestinal sites. The modified ASF was considered unsuitable for controlled colonization experiments due to the unreliable colonization by some strains. Using fewer strains would

reduce the probability of accidental microbial contamination of gnotobiotic experiments and potentially refine experimental practicalities and improve discrimination between strains post-mixing. A novel microbiota for use in gnotobiotic pigs was developed incorporating the most consistent strain from the ASF, Parabacteroides sp. and reported porcine intestinal isolates. 3.2. Selection of bacteria for the new microbiota One bacterial strain from each of the four most frequently identified phylogenetic groups identified in the ileum, caecum and colon in 12–18 week old pigs (Leser et al., 2002) was selected for inclusion in the new microbiota (Table 2). Parabacteroides sp., a facultative anaerobe which reliably colonized pigs in experiments 1–3, was selected as a representative member of the CFB. Of the phylogenetic groups belonging to the Firmicutes, L. amylovorus DSM 16698 (previously L. sobrius) was selected as a wellcharacterised pig isolate, whereas both R. intestinalis and C. glycolicum have been reported in pigs, but the isolates used here were obtained from DSM (both sourced from human intestinal samples) to allow reproducibility in other laboratories in future and were sourced from human faecal samples. 3.3. In vitro compatibility of strains The compatibility of the preliminary strains selected for the new microbiota (L. amylovorus DSM 16698T , C. glycolicum, R. intestinalis and Parabacteroides sp. (ASF519)), was assessed in vitro by culture of each strain with live or dead bacteria of the other strains. Growth of all strains occurred in the presence of live organisms of each of the other bacteria, although culture was reduced when streaks of C. glycolicum crossed streaks of R. intestinalis or Parabacteroides sp., and when streaks of R. intestinalis crossed streaks of C. glycolicum. When cultured in softtop agar, R. intestinalis showed reduced growth around chloroform-killed streak cultures from all strains, including the homologous strain, and Parabacteroides sp. showed reduced growth around chloroform-killed R. intestinalis streaks. No other interactions were observed. 3.4. Safety testing Since microbial colonization normally begins shortly after birth, experimental colonization should, ideally, occur over the same time course rather than from one week old. The new microbiota was administered orally to

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

221

Table 4 PCR results for components of the new microbiota in the proximal and distal jejunum, terminal ileum, caecum and colon of three gnotobiotic Babraham piglets, used for safety testing. Bacteria

Proximal jejunum

Distal jejunum

Terminal ileum

Caecum

Colon

Lactobacillus amylovorus Clostridium glycolicum Roseburia intestinalis Parabacteroides sp. (ASF519)

3/3 3/3 0/3 3/3

3/3 3/3 0/3 3/3

3/3 3/3 0/3 3/3

3/3 3/3 0/3 3/3

3/3 3/3 0/3 3/3

Table 5 PCR results for the presence of L. amylovorus DSM 16698T , C. glycolicum and Parabacteroides sp. and the mean total bacterial count (±95% C.I.) in the proximal and distal jejunum, terminal ileum, caecum and colon of the six gnotobiotic colonized Babraham piglets. Bacteria

Proximal jejunum

Distal jejunum

Terminal ileum

Caecum

Colon

Lactobacillus amylovorus Clostridium glycolicum Parabacteroides sp. Mean total bacterial count (±95% C.I.)

6/6 6/6 6/6 9.87 × 106 (4.50 × 106 )

6/6 6/6 6/6 2.53 × 107 (1.77 × 107 )

6/6 6/6 6/6 8.51 × 107 (5.78 × 107 )

6/6 6/6 6/6 5.99 × 108 (1.68 × 108 )

6/6 6/6 6/6 5.45 × 108 (1.93 × 108 )

C.I., confidence interval.

three germ-free Babraham piglets within 4 h of derivation by Caesarean prior to their first feed (experiment 4, Table 1). No overt signs of clinical illness were seen in the piglets at any stage post-administration of the new microbiota, demonstrating that this combination of bacterial species could safely be given immediately after derivation. PCR results (Table 4) showed that Parabacteroides sp., L. amylovorus DSM 16698T and C. glycolicum colonized all of the pigs at all intestinal sites sampled, but that R. intestinalis did not colonize any pig at any intestinal site sampled. No contaminating bacteria were cultured.

3.5. The new microbiota 6.1–10.1 × 106 bacteria/ml L. amylovorus DSM 16698T , 5.6–8.6 × 106 bacteria/ml C. glycolicum and 2.9–4.5 × 106 bacteria/ml Parabacteroides sp. were administered to six Babraham piglets, in experiments 5 and 6. Each strain in the new microbiota colonized each piglet at all intestinal sites sampled (Table 5). Growth of the more oxygen sensitive strains, C. glycolicum and Parabacteroides sp. was not sufficiently reliable for quantification and total bacterial counts were enumerated by flow cytometry. In colonized pigs, bacterial numbers were higher in large intestinal sites than small intestinal sites (Table 5 and Fig. 1), consistent with the results of conventional colonization (Moore et al., 1969).

3.6. Effects of colonization on the immune system Consistent with previous reports in which germ-free piglets were colonized with a different microbiota, colonization of gnotobiotic piglets with the new microbiota resulted in increased immunoglobulin levels in serum compared to germ-free piglets. The effects were most marked for IgA and IgM (Fig. 2). Levels of IgG1 were similar to those reported for conventionally colonized piglets which had been fed colostrum (Bailey et al., 2004).

Fig. 1. Mean number of bacteria/g of intestinal contents from the proximal and distal jejunum, terminal ileum, caecum and colon of six piglets colonized with the new microbiota. Error bars represent 95% C.I.

Fig. 2. Serum immunoglobulin concentrations in two germ-free and four colonized pigs from experiment 5. Error bars represent standard deviations. GF, germ-free.

4. Discussion Here, we report a reliable intestinal colonization microbiota for use in gnotobiotic pigs, the Bristol microbiota, consisting of Parabacteroides sp. (ASF519), L. amylovorus DSM 16698T and C. glycolicum. The new microbiota caused no clinical illness in piglets, even when administered prior

222

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

to typical postnatal gut closure times, was practical to culture and administer, and induced development of aspects of the immune system, demonstrated by increases specifically in serum immunoglobulins. Colonization has been demonstrated to be essential in the production of both non-specific and specific serum immunoglobulins in pigs (Butler et al., 2002; Cukrowska et al., 2001). Here, increases were most marked for IgA and IgM, consistent with their role in protection of mucosal surfaces. Interestingly, both the germ-free and colonized pigs here had similar levels of total antigen non-specific IgG1 at 27 days old to conventionally colonized piglets with access to colostrum, but had much lower levels of IgG2 suggesting a stronger maternal influence on IgG2 (Bailey et al., 2004). Previous reports of colonization of gnotobiotic pigs with intestinal bacteria include: monocolonization studies; a standardized 10-species microbiota, used to assess the antibody repertoire development in pigs (Butler et al., 2000); and undefined microbiota derived from human or pig faeces (Che et al., 2009; Pang et al., 2007). Although expansion of the immune system of gnotobiotic mice can be triggered by single microbial strains (Cebra, 1999; Klaasen et al., 1993; Mazmanian et al., 2005), the expansion has been reported to be greater when a more conventional, diverse microbiota has been used (Umesaki et al., 1999), presumably due to the presence of a greater diversity of bacterial molecules able to stimulate immune receptors. Both the simple microbiota used here and to the more complex microbiota used in pigs by Butler et al. (2000) contained members of the same three phylogenetic groups (the Clostridium and relatives, BLS subdivision and CFB groups) though none of the species were the same, and both resulted in expansion of the immune system. In addition, the microbiota used by Butler et al. (2000) also contained Enterococcus faecalis. However, the variation in colonization by each element of the microbiota between individual pigs was not reported by Butler et al. and is likely to contribute to variation in immune expansion seen between individual pigs. The ASF is a well-established murine colonization microbiota. However, the use of a modified form of the microbiota in pigs resulted in inconsistent colonization with some strains, even where two doses of the microbiota were given. The ideal attributes of a new intestinal microbiota used to study post-colonization immune development in gnotobiotic pigs were considered to be: practical to grow and administer without contamination; administrable immediately after derivation without causing disease; consistent, prolonged colonization of at least one intestinal region; measurable effects on the host immune system. The most complete analysis of the porcine intestinal microbiota (Leser et al., 2002) is of 4270 cloned 16S rRNA gene sequences from the ileum, caecum and colon of 24 young pigs (12–18 weeks old) fed on different diets. The resultant microbiota showed limited diversity at the division level, regardless of diet, and predominantly belonged to the Firmicutes. The second largest division represented was the CFB, which was almost exclusively found in large intestinal sites. The four most frequently identified phylogenetic groups from this study (3 Firmicutes and 1 CFB)

were used to select the new microbiota, reflecting the microbiota diversity in young pigs (Leser et al., 2002; Mulder et al., 2009), and also adults (Ley et al., 2008). Culture-based studies of neonatal piglet distal colon content demonstrated a shift from predominantly aerobic to anaerobic species early post-colonization, including a large reduction in Proteobacteria (Swords et al., 1993). By 2 days of age, 10 clones from the ileal lumen contents of each of two suckling piglets consisted of eight species of bacteria belonging to the Firmicutes and Proteobacteria (Konstantinov et al., 2006). Colonization by Proteobacteria, even if transient, may be important in early intestinal development, however, species which would persistently colonize were required, hence, members of the Proteobacteria were not included in the microbiota developed. By 23 days of age, three Lactobacilli, including L. amylovorus DSM 16698T , which was used in the microbiota, and a Clostridium sp. were identified, demonstrating early colonization by members of two of the selected phylogenetic groups. Members of neither the CFB nor a Eubacterium species were detected in this study. Further studies would be needed to confirm the presence of these groups in conventionally colonized young piglets, particularly in large intestinal sites. The reliable colonization by Parabacteroides sp. (ASF519) in both microbiotas, suggested that members of the CFB have the potential to colonize conventional piglets. R. intestinalis, a member of the Eubacterium, failed to colonize all intestinal sites sampled by 21 days postcolonization. As intestinal samples were not collected prior to 21 days, it is not known whether this strain colonized piglets for a short time period prior to sampling. R. intestinalis was observed to be the most oxygen sensitive of the selected strains (personal observation) and may not have survived the administration procedure or early intestinal environment. Equally, R. intestinalis showed reduced growth around chloroform-killed streak cultures from all strains, including the homologous strain, so may have been killed by the inevitable presence of dead bacteria in the dose of intestinal colonization microbiota. Other host, environmental and microbial factors may also have contributed to its absence. Colonization with the novel microbiota had the advantage that the low number of species present, combined with the relative ease of culture of these bacteria, minimized the risk of piglet contamination via the microbiota. Predictable colonization by all constituent species occurred in all intestinal sites sampled by 21 days. Ideally, the stability of the intestinal microbiota and resultant immunoglobulin response would be studied over a longer time course; this was restricted by ethical considerations and regulations. Typically, the neonatal intestinal tract would be exposed to live bacteria within minutes of vaginal delivery, (Brook et al., 1979), with further exposure to bacteria in breast milk (Collado et al., 2009). Initially, piglets were confirmed as culture negative prior to administration of the microbiota, however as the immune system of a germ-free piglet may be different at several days old to immediately post-Caesarean the schedule was altered to administer the microbiota soon after Caesarean delivery, either just before or after the first meal. As a result, the intestinal tract would be exposed to bacteria at a time more similar to the

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

conventional situation. Contaminating bacteria were still likely to be detected as the experiment proceeded if present. Host immune development is likely to reflect exposure to a range of microbial associated molecular patterns (MAMPs), expressed by different bacterial species. Hence, bacteria selected from across a wide phylogenetic distribution would be more likely to express a wide range of MAMPs. While the microbiota used here consisted of only three bacterial species, these were selected from across the diversity of typical intestinal phylogenetic groups specifically so that they were highly likely to express a range of typical MAMPs. As C. glycolicum and R. intestinalis are both members of the Order Clostridiales, the loss of R. intestinalis from the microbiota was likely to have a less significant impact on MAMP exposure than the loss of other species. 5. Conclusion In conclusion, we describe the development of a novel intestinal colonization microbiota (the Bristol microbiota) for use in gnotobiotic pigs, which was safe to use prior to gut closure and induced systemic increase in serum immunoglobulins IgA and IgM. This microbiota can be used to study the consequences of early microbial colonization on development of the intestinal mucosa and immune system, on later colonization by a complex microbiota, and on subsequent susceptibility to disease. Conflict of interest No authors have any financial or personal relationships with people or organizations which could inappropriately influence their work. Acknowledgements The authors would like to acknowledge the Veterinary Training and Research Initiative VT0104, the gnotobiotic unit animal care staff at IAH, Compton, and Odette Perez, Pawel Janczyk and Robert Pieper for their assistance and advice. References Backhed, F., Ley, R.E., Sonnenburg, J.L., Peterson, D.A., Gordon, J.I., 2005. Host-bacterial mutualism in the human intestine. Science 307, 1915–1920. Bailey, M., Haverson, K., Miller, B., Jones, P., Sola, I., Enjuanes, L., Stokes, C.R., 2004. Effects of infection with transmissible gastroenteritis virus on concomitant immune responses to dietary and injected antigens. Clin. Diagn. Lab. Immunol. 11, 337–343. Barrow, P.A., Page, K., Lovell, M.A., 2001. The virulence for gnotobiotic pigs of live attenuated vaccine strains of Salmonella enterica serovars Typhimurium and Enteritidis. Vaccine 19, 3432–3436. Bjorksten, B., Sepp, E., Julge, K., Voor, T., Mikelsaar, M., 2001. Allergy development and the intestinal microflora during the first year of life. J. Allergy Clin. Immunol. 108, 516–520. Brook, I., Barrett, C.T., Brinkman, C.R., Martin, W.J., Finegold, S.M., 1979. Aerobic and anaerobic bacterial-flora of the maternal cervix and newborn gastric fluid and conjunctiva – prospective-study. Pediatrics 63, 451–455. Butler, J.E., Sinkora, M., 2007. The isolator piglet: a model for studying the development of adaptive immunity. Immunol. Res. 39, 33–51. Butler, J.E., Sun, J., Weber, P., Navarro, P., Francis, D., 2000. Antibody repertoire development in fetal and newborn piglets. III. Colonization of the

223

gastrointestinal tract selectively diversifies the preimmune repertoire in mucosal lymphoid tissues. Immunology 100, 119–130. Butler, J.E., Weber, P., Sinkora, M., Baker, D., Schoenherr, A., Mayer, B., Francis, D., 2002. Antibody repertoire development in fetal and neonatal piglets. VIII. Colonization is required for newborn piglets to make serum antibodies to T-dependent and type 2 T-independent antigens. J. Immunol. 169, 6822–6830. Cebra, J.J., 1999. Influences of microbiota on intestinal immune system development. Am. J. Clin. Nutr. 69, 1046S–1051S. Che, C., Pang, X., Hua, X., Zhang, B., Shen, J., Zhu, J., Wei, H., Sun, L., Chen, P., Cui, L., Zhao, L., Yang, Q., 2009. Effects of human fecal flora on intestinal morphology and mucosal immunity in human flora-associated piglet. Scand. J. Immunol. 69, 223–233. Collado, M.C., Delgado, S., Maldonado, A., Rodriguez, J., 2009. Assessment of the bacterial diversity of breast milk of healthy women by quantitative real-time PCR. Lett. Appl. Microbiol. 48, 523–528. Cukrowska, B., Kozakova, H., Rehakova, Z., Sinkora, J., TlaskalovaHogenova, H., 2001. Specific antibody and immunoglobulin responses after intestinal colonization of germ-free piglets with non-pathogenic Escherichia coli O86. Immunobiology 204, 425–433. Duncan, S.H., Aminov, R.I., Scott, K.P., Louis, P., Stanton, T.B., Flint, H.J., 2006. Proposal of Roseburia faecis sp. nov., Roseburia hominis sp. nov. and Roseburia inulinivorans sp. nov. based on isolates from human faeces. Int. J. Syst. Evol. Microbiol. 56, 2437–2441. Eckburg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S.R., Nelson, K.E., Relman, D.A., 2005. Diversity of the human intestinal microbial flora. Science 308, 1635–1638. Haverson, K., Rehakova, Z., Sinkora, J., Sver, L., Bailey, M., 2007. Immune development in jejunal mucosa after colonization with selected commensal gut bacteria: a study in germ-free pigs. Vet. Immunol. Immunopathol. 119, 243–253. Janczyk, P., Pieper, R., Souffrant, W.B., Bimczok, D., Rothkotter, H.J., Smidt, H., 2007. Parenteral long-acting amoxicillin reduces intestinal bacterial community diversity in piglets even 5 weeks after the administration. ISME J. 1, 180–183. Klaasen, H., Vanderheijden, P.J., Stok, W., Poelma, F.G.J., Koopman, J.P., Vandenbrink, M.E., Bakker, M.H., Eling, W.M.C., Beynen, A.C., 1993. Apathogenic, intestinal, segmented, filamentous bacteria stimulate the mucosal immune-system of mice. Infect. Immun. 61, 303–306. Konstantinov, S.R., Awati, A.A., Williams, B.A., Miller, B.G., Jones, P., Stokes, C.R., Akkermans, A.D.L., Smidt, H., De Vos, W.M., 2006. Post-natal development of the porcine microbiota composition and activities. Environ. Microbiol. 8, 1191–1199. Konstantinov, S.R., Smidt, H., Akkermans, A.D.L., Casini, L., Trevisi, P., Mazzoni, M., De Filippi, S., Bosi, P., de Vos, W.M., 2008. Feeding of Lactobacillus sobrius reduces Escherichia coli F4 levels in the gut and promotes growth of infected piglets. FEMS Microbiol. Ecol. 66, 599–607. Konstantinov, S.R., Smidt, H., de Vos, W.M., 2005. Representational difference analysis and real-time PCR for strain-specific quantification of Lactobacillus sobrius sp nov. Appl. Environ. Microbiol. 71, 7578–7581. Kuitunen, M., Kukkonen, K., Juntunen-Backman, K., Korpela, R., Poussa, T., Tuure, T., Haahtela, T., Savilahti, E., 2009. Probiotics prevent IgEassociated allergy until age 5 years in cesarean-delivered children but not in the total cohort. J. Allergy Clin. Immunol. 123, 335–341. Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Stackebrandt, Goodfellow, E.M. (Eds.), Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons, Chichester, UK, pp. 115–117. Leser, T.D., Amenuvor, J.Z., Jensen, T.K., Lindecrona, R.H., Boye, M., Moller, K., 2002. Culture-independent analysis of gut bacteria: the pig gastrointestinal tract microbiota revisited. Appl. Environ. Microbiol. 68, 673–690. Ley, R.E., Hamady, M., Lozupone, C., Turnbaugh, P.J., Ramey, R.R., Bircher, J.S., Schlegel, M.L., Tucker, T.A., Schrenzel, M.D., Knight, R., Gordon, J.I., 2008. Evolution of mammals and their gut microbes. Science 320, 1647–1651. Marti, R., Dabert, P., Ziebal, C., Pourcher, A.M., 2010. Evaluation of Lactobacillus sobrius/L. amylovorus as a new microbial marker of pig manure. Appl. Environ. Microbiol. 76, 1456–1461. Mazmanian, S.K., Liu, C.H., Tzianabos, A.O., Kasper, D.L., 2005. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 122, 107–118. Moore, W.E.C., Cato, E.P., Holdeman, L.V., 1969. Anaerobic bacteria of gastrointestinal flora and their occurrence in clinical infections. J. Infect. Dis. 119, 641–649. Mulder, I.E., Schmidt, B., Stokes, C.R., Lewis, M., Bailey, M., Aminov, R.I., Prosser, J.I., Gill, B.P., Pluske, J.R., Mayer, C.D., Musk, C.C., Kelly, D., 2009. Environmentally-acquired bacteria influence microbial

224

G. Laycock et al. / Veterinary Immunology and Immunopathology 149 (2012) 216–224

diversity and natural innate immune responses at gut surfaces. BMC Biol., 7. Nguyen, T.V., Yuan, L., Azevedo, M.S.P., Jeong, K.-I., Gonzalez, A.-M., Saif, L.J., 2007. Transfer of maternal cytokines to suckling piglets: in vivo and in vitro models with implications for immunomodulation of neonatal immunity. Vet. Immunol. Immunopathol. 117, 236–248. Orcutt, R.P., Judge, G.F.J.R.J., 1987. Development of an “Altered Schaedler Flora” for NCI gnotobiotic rodents. Microecol. Ther. 17, 59. Orrhage, K., Nord, C.E., 1999. Factors controlling the bacterial colonization of the intestine in breastfed infants. Acta Paediatr. 88, 47–57. Owen, B.D., Bell, J.M., Williams, C.M., Oakes, R.G., 1961. Effects of porcine immune globulin administration on the survival and serum protein composition of colostrum-deprived pigs reared in a non-isolated environment. Canadian J. Anim. Sci. 41, 236–252. Pang, X.Y., Hua, X.G., Yang, Q., Ding, D.H., Che, C.Y., Cui, L., Jia, W., Bucheli, P., Zhao, L.P., 2007. Inter-species transplantation of gut microbiota from human to pigs. ISME J. 1, 156–162. Penders, J., Thijs, C., Vink, C., Stelma, F.F., Snijders, B., Kummeling, I., van den Brandt, P.A., Stobberingh, E.E., 2006. Factors influencing the composition of the intestinal microbiota in early infancy. Pediatrics 118, 511–521. Prioult, G., Fliss, I., Pecquet, S., 2003. Effect of probiotic bacteria on induction and maintenance of oral tolerance to beta-lactoglobulin in gnotobiotic mice. Clin. Diagn. Lab. Immunol. 10, 787–792. Rothkotter, H.J., Ulbrich, H., Pabst, R., 1991. The postnatal-development of gut lamina propria lymphocytes – number, proliferation, and T-cell and B-cell subsets in conventional and germ-free pigs. Pediatr. Res. 29, 237–242. Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365–386. Sarma-Rupavtarm, R.B., Ge, Z.M., Schauer, D.B., Fox, J.G., Polz, M.F., 2004. Spatial distribution and stability of the eight microbial species of the altered Schaedler flora in the mouse gastrointestinal tract. Appl. Environ. Microbiol. 70, 2791–2800. Schaedler, R.W., Dubos, R., Costello, R., 1965. Association of germfree mice with bacteria isolated from normal mice. J. Exp. Med. 122, 77. Schwiertz, A., Gruhl, B., Lobnitz, M., Michel, P., Radke, M., Blaut, M., 2003. Development of the intestinal bacterial composition in hospitalized preterm infants in comparison with breast-fed, full-term infants. Pediatr. Res. 54, 393–399.

Signer, E.N., Jeffreys, A.J., Licence, S., Miller, R., Byrd, P., Binns, R., 1999. DNA profiling reveals remarkably low genetic variability in a herd of SLA homozygous pigs. Res. Vet. Sci. 67, 207–211. Swords, W.E., Wu, C.C., Champlin, F.R., Buddington, R.K., 1993. Postnatal changes in selected bacterial groups of the pig colonic microflora. Biol. Neonate 63, 191–200. Umesaki, Y., Setoyama, H., Matsumoto, S., Imaoka, A., Itoh, K., 1999. Differential roles of segmented filamentous bacteria and clostridia in development of the intestinal immune system. Infect. Immun. 67, 3504–3511. Verhulst, S.L., Vael, C., Beunckens, C., Nelen, V., Goossens, H., Desager, K., 2008. A longitudinal analysis on the association between antibiotic use, intestinal microflora, and wheezing during the first year of life. J. Asthma 45, 828–832. Wannemuehler, M.J., Kiyono, H., Babb, J.L., Michalek, S.M., McGhee, J.R., 1982. Lipopolysaccharide (LPS) regulation of the immune-response – LPS converts germ-free mice to sensitivity to oral tolerance induction. J. Immunol. 129, 959–965. Wen, K., Azevedo, M.S.P., Gonzalez, A., Zhang, W., Saif, L.J., Li, G.H., Yousef, A., Yuan, L.J., 2009. Toll-like receptor and innate cytokine responses induced by lactobacilli colonization and human rotavirus infection in gnotobiotic pigs. Vet. Immunol. Immunopathol. 127, 304–315. Wernersson, R., Schierup, M.H., Jorgensen, F.G., Gorodkin, J., Panitz, F., Staerfeldt, H.H., Christensen, O.F., Mailund, T., Hornshoj, H., Klein, A., Wang, J., Liu, B., Hu, S.N., Dong, W., Li, W., Wong, G.K.S., Yu, J., Bendixen, C., Fredholm, M., Brunak, S., Yang, H.M., Bolund, L., 2005. Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing. BMC Genomics 6. Wu, S.G., Rhee, K.J., Albesiano, E., Rabizadeh, S., Wu, X.Q., Yen, H.R., Huso, D.L., Brancati, F.L., Wick, E., McAllister, F., Housseau, F., Pardoll, D.M., Sears, C.L., 2009. A human colonic commensal promotes colon tumorigenesis via activation of T helper type 17 T cell responses. Nat. Med. 15, 1016–1064. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.