- Email: [email protected]
A DNA-based demonstration of a three-host life-cycle for the Bivesiculidae (Platyhelminthes: Digenea)
International Journal for Parasitology 17 "0887# 0680Ð0684
Research note
A DNA!based demonstration of a three!host life!cycle for the Bivesiculidae "Platyhelminthes] Digenea# Thomas H[ Cribba\ \ Glenn R[ Andersona\ Robert D[ Adlard b\ Rodney A[ Brayc a
Department of Parasitology\ The University of Queensland\ Brisbane\ Queensland 3961\ Australia b Queensland Museum\ South Brisbane\ Queensland 3090\ Australia c Department of Zoology\ The Natural History Museum\ Cromwell Road\ London SW6 4BD\ U[K[ Received 17 February 0887^ received in revised form 8 June 0887^ accepted 00 June 0887
Abstract Immature bivesiculid trematodes collected from the intestine of Thalassoma lunare "Labridae# are shown to be morphologically consistent with adults of Bivesicula claviformis from Epinephelus fasciatus "Serranidae#[ In addition\ the immature bivesiculids have the same sequence for the second internal transcribed spacer of the ribosomal DNA[ Comparison with three other species of Bivesiculidae showed di}erences of between 12) and 29)[ These results show that bivesiculids may have three!host life!cycles in addition to the two!host life!cycles that have been demonstrated previously[ The three!host life!cycle enables bivesiculids to infect large carnivorous _shes[ Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ All rights reserved[ Keywords] Bivesiculidae^ Life!cycle^ Ribosomal DNA[
The Bivesiculidae is a small family of digeneans restricted to the intestines of _shes[ Several features\ such as the lack of oral and ventral suckers and the simple two!host life!cycle\ have led to suggestions that this family is one of the most plesiomorphic within the Digenea "e[g[ ð0\ 1Ł#\ although Brooks et al[ ð2Ł inferred a relatively derived position for it[ Assumptions about the life!cycle have been based on studies of unassociated cercariae ð3Ł and com! pleted life!cycles for Bivesicula caribbensis Cable and Nahhas\ 0851 ð4Ł and Paucivitellosus fragilis
Corresponding author[ Fax] "96# 2254 0477^ e!mail] T[CribbÝmailbox[uq[edu[au[
Coil\ Reid and Kuntz\ 0854 ð5\ 6Ł "in ð6Ł as Pau! civitellosus hanumanthai\ but subsequently syn! onymised with P[ fragilis#[ These studies all concluded that the bivesiculid life!cycle has only two hosts and that the cercariae emerge from the snail and are eaten directly by the de_nitive host without encysting[ In view of these convincing stud! ies\ it is puzzling that some species of Bivesiculidae are found in larger carnivorous _shes "e[g[\ Hol! ocentridae\ Muraenidae and Serranidae#[ Here we report data that show that species in these _shes may have a three!host life!cycle[ Fish were collected at three sites in Queensland\ Australia] Heron Island "12>16?S\ 040>44?E#\ Lizard Island "03>39?S\ 043>17?E# and Stradbroke Island
9919!6408:87:,08[99 Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ All rights reserved[ PII] S S 9 9 1 9 ! 6 4 0 8 " 8 7 # 9 9 0 1 6 ! 0
0681
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684 Table 0 Samples from which DNA was extracted[ Numbers in the right hand column indicate the number of individual ~ukes in each sample Species
Host
Locality
No[
Bivesicula claviformis
Epinephelus fasciatus
Bivesicula unexpecta
Acanthochromis polyacanthus
Bivesicula sp[ Paucivitellosus fragilis Metacercaria
Hyporhamphus australis Crenimugil crenilabis Thalassoma lunare
Heron Is[ Lizard Is[ Heron Is[ Lizard Is[ Stradbroke Is[ Heron Is[ Lizard Is[
0 2 1 2\ 2 0 1 1
"16>29?S\ 042>13?E#[ Flukes were removed from hosts\ washed in saline\ and either killed by pip! etting into boiling saline followed by preservation in 4) formalin for morphological study or stored directly in absolute ethanol for subsequent extrac! tion of DNA[ Specimens for morphological study were stained with Mayer|s haematoxylin\ dehy! drated in alcohol\ cleared in methyl salicylate\ and mounted in Canada balsam[ Specimens were drawn with the aid of a drawing tube[ Measurements are quoted as a range with the mean in parentheses and are in micrometres[ Samples for molecular analysis were removed from the ethanol and frozen at −19>C in TrisÐ ethylenediaminetetra!acetate "TE# bu}er[ Sub! sequent puri_cation and precipitation of DNA fol! lowed Sambrook et al[ ð7Ł[ DNA sequences were obtained from adult ~ukes of four species of bives! iculid and from immature bivesiculids from Thal! assoma lunare "Table 0#[ The second internal transcribed spacer "ITS1# of the rRNA gene was ampli_ed by PCR using nested sets of primers[ Initially\ a fragment consisting of the ITS0\ 4[7S and ITS1 regions was ampli_ed using primers that anneal to the small subunit "07S region# near the ITS0 "RA1] 4?!GTCCCTGCCCTTTGTACACA! 2?# and the large subunit "17S region# near the ITS1 "JB8] 4?!GCTGCATTCACAAACACCCCGAC! TC!2?#[ The ampli_ed fragment was then used as the template for a second ampli_cation using pri! mers that anneal to the 4[7S region about 49 bases from the ITS1 "GA0] 4?!AGAACATCGACA! TCTTGAAC!2?# and on the large subunit "17S region# near the ITS1 "ITS1[1] 4?!CCTGGTTAG!
TTTCTTTTCCTCCGC!2?#[ An MJ Research ther! mal minicycler was used with 29 cycles of 84>C for 39 s\ 44>C for 29 s and 61>C for 0 min[ Ampli_ed DNA was then puri_ed using QIAquick PCR puri! _cation columns "QIAGEN#[ Labelled DNA for sequencing was produced using a four dyeÐdye ter! minator system "Perkin Elmer ABI Prism dye ter! minator cycle sequencing ready reaction kit#[ For each reaction\ one of the two PCR primers used to produce the template DNA was used[ The cycling programme consisted of 29 cycles of 85>C for 09 s\ 49>C for 4 s and 59>C for 3 min[ Labelled DNA was precipitated in cold ethanol and sodium acetate\ washed with ethanol and dried[ Sequences were resolved using an Applied Biosystems 262A auto! mated sequencer[ Final sequences were compiled for each species using at least two primary sequences\ one initiated from each end of the frag! ment[ The _nal sequences were aligned using the computer program CLUSTAL V ð8Ł[ Six of 29 moon wrasse\ T[ lunare "Labridae#\ from Lizard Island were found to have immature bivesiculids present in the intestine "Figure 0A#[ The morphology of these specimens was broadly consistent with that of adult Bivesicula claviformis Yamaguti\ 0823 "Figure 0B# which had been reported previously from serranids from the Great Barrier Reef ð09Ł[ In the immature specimens the reproductive system was almost completely unde! veloped\ and they had few measurable features] body 367Ð502 "420#×114Ð200 "162#\ pharynx 34Ð 53 "41#×48Ð60 "56# "n 7#[ The morphology of the specimens was\ however\ not su.ciently specialised to make a speci_c identi_cation possible[
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684
0682
Fig[ 0[ "A# Metacercaria of Bivesicula claviformis from intestine of Thalassoma lunare from Lizard Island[ Scale bar 099 mm[ "B# Adult of B[ claviformis from intestine of Epinephelus fasciatus from Lizard Island[ Scale bar 199 mm[
The ITS1 of the four species of Bivesiculidae was 149Ð179 nucleotides long[ The alignment of the sequences\ after alignment gaps "inferred inser! tions:deletions# were added\ was 173 bases long "Figure 1#[ Of the 173 sites\ 31) "n 010# varied among the species[ Sequences from the four species di}ered at 05) "n 30# to 25) "n 090# of sites "Table 1#[ The sequence of the immature bives! iculids from T[ lunare was identical to that of B[ claviformis from Epinephelus fasciatus[ We conclude that the immature bivesiculids from the intestine of T[ lunare are those of B[ claviformis which has been found as adults on the Great Barrier Reef only in serranids[ The association is supported
by both morphological and molecular evidence and is also consistent with the ecology of the two hosts in that epinepheline serranids incorporate small lab! rids in their diet[ It is worth noting in this con! nection that there are no records of adult bivesiculids from labrid _shes[ We interpret the specimens from T[ lunare as representing true met! acercariae\ because the worms do not appear to mature in this host and we predict that they are an obligate stage in the life!cycle[ These results explain the presence of B[ claviformis in serranid _shes and probably account for the presence of bivesiculids in large carnivorous _shes in general[ It is unusual to have metacercariae in the lumen of the intestine of
0683
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684
Fig[ 1[ Aligned nucleotide sequences of the second internal transcribed spacer "ITS1# of four species of bivesiculid[ The ~anking 29 nucleotides of the 2? end of the 4[7S gene and 29 nucleotides of the 4? end of the large subunit "17S region# are also shown[ Dots indicate nucleotides identical to those in the top sequence[ Dashes indicate alignment gaps "inferred insertions:deletions#[
the second intermediate host[ The only parallel we are aware of is the Didymozoidae\ although it appears to be more usual for didymozoid met! acercariae to occur in the body cavity or tissues rather than the lumen of the gut "e[g[ ð00Ł#[ The present study also demonstrates the potential for molecular studies to augment classical
approaches to the elucidation of parasite life!cycles[ This study appears to be only the second to use a molecular approach to determine the life!cycle of a digenean^ Anderson ð01Ł associated adults and metacercariae of Indodidymozoon pearsoni "Digenea] Didymozoidae# using the same approach[ The level of variation identi_ed in the
0684
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684 Table 1 Comparison of the second internal transcribed spacer of four species of bivesiculida
Bivesicula claviformis Bivesicula sp[ Bivesicula unexpecta Paucivitellosis fra`ilis
Bivesicula claviformis
Bivesicula sp[
Bivesicula unexpecta
Paucivitellosis fra`ilis
14 12 29
60 22 25
53 84 05
72 090 30
a
Figures above the diagonal are numbers of di}erences\ _gures below the diagonal are percentages[ Alignment gaps "inferred inser! tions:deletions# are included in these _gures[
present study "Table 1# suggests that the ITS1 may be highly informative for studies of this kind[ Acknowledgements*We thank Trudy Wright for technical assistance and the sta} of the Heron and Lizard Island research stations for providing the facilities to make this study possible[ The work was supported by a grant from the University of Queensland[
References ð0Ł Cable RM[ Phylogeny and taxonomy of trematodes with reference to marine species[ In] Vernberg WB\ editor[ Sym! biosis in the sea[ Columbia] University of South Carolina Press\ 0863^062Ð82[ ð1Ł Pearson JC[ On the position of the digenean family Heron! imidae] an inquiry into a cladistic classi_cation of the Digenea[ Syst Parasitol 0881^10]70Ð055[ ð2Ł Brooks DR\ O|Grady RT\ Glen DR[ Phylogenetic analysis of the Digenea "Platyhelminthes] Cercomeria# with com! ments on their adaptive radiation[ Can J Zool 0874^52]300Ð 332[ ð3Ł Le Zotte LA[ Studies on marine digenetic trematode of
ð4Ł
ð5Ł
ð6Ł
ð7Ł
ð8Ł
ð09Ł
ð00Ł
ð01Ł
Puerto Rico] the family Bivesiculidae\ its biology and a.nities[ J Parasitol 0843^39]037Ð051[ Cable RM\ Nahhas FM[ Bivesicula caribbensis sp[ n[ "Tre! matoda] Digenea# and its life history[ J Parasitol 0851^37]425Ð427[ Pearson JC[ Observations on the morphology and life!cycle of Paucivitellosus fragilis Coil\ Reid and Kuntz\ 0854 "Tre! matoda] Bivesiculidae#[ Parasitology 0857^47]658Ð677[ Mani GG[ Morphology and life cycle of Paucivitellosus hanumanthai n[ sp[ "Trematoda] Bivesiculidae#[ Trans Am Microsc Soc 0878^097]10Ð15[ Sambrook J\ Fritsch EF\ Maniatis T[ Molecular cloning[ Cold Spring Harbor\ NY] Cold Spring Harbor Laboratory Press\ 0878[ Higgins DG\ Bleasby AJ\ Fuchs R[ CLUSTAL V] Improved software for multiple sequence alignment[ Com! put Appl Biol Sci 0881^7]078Ð080[ Cribb TH\ Bray RA\ Barker SC[ Bivesiculidae and Haplo! splanchnidae "Digenea# from _shes of the southern Great Barrier Reef\ Australia[ Syst Parasitol 0883^17]70Ð86[ Ko ie M\ Lester RJG[ Larval didymozoids "Trematoda# in _shes from Moreton Bay\ Australia[ Proc Helminthol Soc Wash 0874^41]085Ð192[ Anderson\ GR[ Identi_cations and maturation of the met! acercaria of Indodidymozoon pearsoni "Digenea] Didy! mozoidae#[ J Helminthol\ in press[
Research note
A DNA!based demonstration of a three!host life!cycle for the Bivesiculidae "Platyhelminthes] Digenea# Thomas H[ Cribba\ \ Glenn R[ Andersona\ Robert D[ Adlard b\ Rodney A[ Brayc a
Department of Parasitology\ The University of Queensland\ Brisbane\ Queensland 3961\ Australia b Queensland Museum\ South Brisbane\ Queensland 3090\ Australia c Department of Zoology\ The Natural History Museum\ Cromwell Road\ London SW6 4BD\ U[K[ Received 17 February 0887^ received in revised form 8 June 0887^ accepted 00 June 0887
Abstract Immature bivesiculid trematodes collected from the intestine of Thalassoma lunare "Labridae# are shown to be morphologically consistent with adults of Bivesicula claviformis from Epinephelus fasciatus "Serranidae#[ In addition\ the immature bivesiculids have the same sequence for the second internal transcribed spacer of the ribosomal DNA[ Comparison with three other species of Bivesiculidae showed di}erences of between 12) and 29)[ These results show that bivesiculids may have three!host life!cycles in addition to the two!host life!cycles that have been demonstrated previously[ The three!host life!cycle enables bivesiculids to infect large carnivorous _shes[ Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ All rights reserved[ Keywords] Bivesiculidae^ Life!cycle^ Ribosomal DNA[
The Bivesiculidae is a small family of digeneans restricted to the intestines of _shes[ Several features\ such as the lack of oral and ventral suckers and the simple two!host life!cycle\ have led to suggestions that this family is one of the most plesiomorphic within the Digenea "e[g[ ð0\ 1Ł#\ although Brooks et al[ ð2Ł inferred a relatively derived position for it[ Assumptions about the life!cycle have been based on studies of unassociated cercariae ð3Ł and com! pleted life!cycles for Bivesicula caribbensis Cable and Nahhas\ 0851 ð4Ł and Paucivitellosus fragilis
Corresponding author[ Fax] "96# 2254 0477^ e!mail] T[CribbÝmailbox[uq[edu[au[
Coil\ Reid and Kuntz\ 0854 ð5\ 6Ł "in ð6Ł as Pau! civitellosus hanumanthai\ but subsequently syn! onymised with P[ fragilis#[ These studies all concluded that the bivesiculid life!cycle has only two hosts and that the cercariae emerge from the snail and are eaten directly by the de_nitive host without encysting[ In view of these convincing stud! ies\ it is puzzling that some species of Bivesiculidae are found in larger carnivorous _shes "e[g[\ Hol! ocentridae\ Muraenidae and Serranidae#[ Here we report data that show that species in these _shes may have a three!host life!cycle[ Fish were collected at three sites in Queensland\ Australia] Heron Island "12>16?S\ 040>44?E#\ Lizard Island "03>39?S\ 043>17?E# and Stradbroke Island
9919!6408:87:,08[99 Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ All rights reserved[ PII] S S 9 9 1 9 ! 6 4 0 8 " 8 7 # 9 9 0 1 6 ! 0
0681
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684 Table 0 Samples from which DNA was extracted[ Numbers in the right hand column indicate the number of individual ~ukes in each sample Species
Host
Locality
No[
Bivesicula claviformis
Epinephelus fasciatus
Bivesicula unexpecta
Acanthochromis polyacanthus
Bivesicula sp[ Paucivitellosus fragilis Metacercaria
Hyporhamphus australis Crenimugil crenilabis Thalassoma lunare
Heron Is[ Lizard Is[ Heron Is[ Lizard Is[ Stradbroke Is[ Heron Is[ Lizard Is[
0 2 1 2\ 2 0 1 1
"16>29?S\ 042>13?E#[ Flukes were removed from hosts\ washed in saline\ and either killed by pip! etting into boiling saline followed by preservation in 4) formalin for morphological study or stored directly in absolute ethanol for subsequent extrac! tion of DNA[ Specimens for morphological study were stained with Mayer|s haematoxylin\ dehy! drated in alcohol\ cleared in methyl salicylate\ and mounted in Canada balsam[ Specimens were drawn with the aid of a drawing tube[ Measurements are quoted as a range with the mean in parentheses and are in micrometres[ Samples for molecular analysis were removed from the ethanol and frozen at −19>C in TrisÐ ethylenediaminetetra!acetate "TE# bu}er[ Sub! sequent puri_cation and precipitation of DNA fol! lowed Sambrook et al[ ð7Ł[ DNA sequences were obtained from adult ~ukes of four species of bives! iculid and from immature bivesiculids from Thal! assoma lunare "Table 0#[ The second internal transcribed spacer "ITS1# of the rRNA gene was ampli_ed by PCR using nested sets of primers[ Initially\ a fragment consisting of the ITS0\ 4[7S and ITS1 regions was ampli_ed using primers that anneal to the small subunit "07S region# near the ITS0 "RA1] 4?!GTCCCTGCCCTTTGTACACA! 2?# and the large subunit "17S region# near the ITS1 "JB8] 4?!GCTGCATTCACAAACACCCCGAC! TC!2?#[ The ampli_ed fragment was then used as the template for a second ampli_cation using pri! mers that anneal to the 4[7S region about 49 bases from the ITS1 "GA0] 4?!AGAACATCGACA! TCTTGAAC!2?# and on the large subunit "17S region# near the ITS1 "ITS1[1] 4?!CCTGGTTAG!
TTTCTTTTCCTCCGC!2?#[ An MJ Research ther! mal minicycler was used with 29 cycles of 84>C for 39 s\ 44>C for 29 s and 61>C for 0 min[ Ampli_ed DNA was then puri_ed using QIAquick PCR puri! _cation columns "QIAGEN#[ Labelled DNA for sequencing was produced using a four dyeÐdye ter! minator system "Perkin Elmer ABI Prism dye ter! minator cycle sequencing ready reaction kit#[ For each reaction\ one of the two PCR primers used to produce the template DNA was used[ The cycling programme consisted of 29 cycles of 85>C for 09 s\ 49>C for 4 s and 59>C for 3 min[ Labelled DNA was precipitated in cold ethanol and sodium acetate\ washed with ethanol and dried[ Sequences were resolved using an Applied Biosystems 262A auto! mated sequencer[ Final sequences were compiled for each species using at least two primary sequences\ one initiated from each end of the frag! ment[ The _nal sequences were aligned using the computer program CLUSTAL V ð8Ł[ Six of 29 moon wrasse\ T[ lunare "Labridae#\ from Lizard Island were found to have immature bivesiculids present in the intestine "Figure 0A#[ The morphology of these specimens was broadly consistent with that of adult Bivesicula claviformis Yamaguti\ 0823 "Figure 0B# which had been reported previously from serranids from the Great Barrier Reef ð09Ł[ In the immature specimens the reproductive system was almost completely unde! veloped\ and they had few measurable features] body 367Ð502 "420#×114Ð200 "162#\ pharynx 34Ð 53 "41#×48Ð60 "56# "n 7#[ The morphology of the specimens was\ however\ not su.ciently specialised to make a speci_c identi_cation possible[
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684
0682
Fig[ 0[ "A# Metacercaria of Bivesicula claviformis from intestine of Thalassoma lunare from Lizard Island[ Scale bar 099 mm[ "B# Adult of B[ claviformis from intestine of Epinephelus fasciatus from Lizard Island[ Scale bar 199 mm[
The ITS1 of the four species of Bivesiculidae was 149Ð179 nucleotides long[ The alignment of the sequences\ after alignment gaps "inferred inser! tions:deletions# were added\ was 173 bases long "Figure 1#[ Of the 173 sites\ 31) "n 010# varied among the species[ Sequences from the four species di}ered at 05) "n 30# to 25) "n 090# of sites "Table 1#[ The sequence of the immature bives! iculids from T[ lunare was identical to that of B[ claviformis from Epinephelus fasciatus[ We conclude that the immature bivesiculids from the intestine of T[ lunare are those of B[ claviformis which has been found as adults on the Great Barrier Reef only in serranids[ The association is supported
by both morphological and molecular evidence and is also consistent with the ecology of the two hosts in that epinepheline serranids incorporate small lab! rids in their diet[ It is worth noting in this con! nection that there are no records of adult bivesiculids from labrid _shes[ We interpret the specimens from T[ lunare as representing true met! acercariae\ because the worms do not appear to mature in this host and we predict that they are an obligate stage in the life!cycle[ These results explain the presence of B[ claviformis in serranid _shes and probably account for the presence of bivesiculids in large carnivorous _shes in general[ It is unusual to have metacercariae in the lumen of the intestine of
0683
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684
Fig[ 1[ Aligned nucleotide sequences of the second internal transcribed spacer "ITS1# of four species of bivesiculid[ The ~anking 29 nucleotides of the 2? end of the 4[7S gene and 29 nucleotides of the 4? end of the large subunit "17S region# are also shown[ Dots indicate nucleotides identical to those in the top sequence[ Dashes indicate alignment gaps "inferred insertions:deletions#[
the second intermediate host[ The only parallel we are aware of is the Didymozoidae\ although it appears to be more usual for didymozoid met! acercariae to occur in the body cavity or tissues rather than the lumen of the gut "e[g[ ð00Ł#[ The present study also demonstrates the potential for molecular studies to augment classical
approaches to the elucidation of parasite life!cycles[ This study appears to be only the second to use a molecular approach to determine the life!cycle of a digenean^ Anderson ð01Ł associated adults and metacercariae of Indodidymozoon pearsoni "Digenea] Didymozoidae# using the same approach[ The level of variation identi_ed in the
0684
T[H[ Cribb et al[:International Journal for Parasitolo`y 17 "0887# 0680Ð0684 Table 1 Comparison of the second internal transcribed spacer of four species of bivesiculida
Bivesicula claviformis Bivesicula sp[ Bivesicula unexpecta Paucivitellosis fra`ilis
Bivesicula claviformis
Bivesicula sp[
Bivesicula unexpecta
Paucivitellosis fra`ilis
14 12 29
60 22 25
53 84 05
72 090 30
a
Figures above the diagonal are numbers of di}erences\ _gures below the diagonal are percentages[ Alignment gaps "inferred inser! tions:deletions# are included in these _gures[
present study "Table 1# suggests that the ITS1 may be highly informative for studies of this kind[ Acknowledgements*We thank Trudy Wright for technical assistance and the sta} of the Heron and Lizard Island research stations for providing the facilities to make this study possible[ The work was supported by a grant from the University of Queensland[
References ð0Ł Cable RM[ Phylogeny and taxonomy of trematodes with reference to marine species[ In] Vernberg WB\ editor[ Sym! biosis in the sea[ Columbia] University of South Carolina Press\ 0863^062Ð82[ ð1Ł Pearson JC[ On the position of the digenean family Heron! imidae] an inquiry into a cladistic classi_cation of the Digenea[ Syst Parasitol 0881^10]70Ð055[ ð2Ł Brooks DR\ O|Grady RT\ Glen DR[ Phylogenetic analysis of the Digenea "Platyhelminthes] Cercomeria# with com! ments on their adaptive radiation[ Can J Zool 0874^52]300Ð 332[ ð3Ł Le Zotte LA[ Studies on marine digenetic trematode of
ð4Ł
ð5Ł
ð6Ł
ð7Ł
ð8Ł
ð09Ł
ð00Ł
ð01Ł
Puerto Rico] the family Bivesiculidae\ its biology and a.nities[ J Parasitol 0843^39]037Ð051[ Cable RM\ Nahhas FM[ Bivesicula caribbensis sp[ n[ "Tre! matoda] Digenea# and its life history[ J Parasitol 0851^37]425Ð427[ Pearson JC[ Observations on the morphology and life!cycle of Paucivitellosus fragilis Coil\ Reid and Kuntz\ 0854 "Tre! matoda] Bivesiculidae#[ Parasitology 0857^47]658Ð677[ Mani GG[ Morphology and life cycle of Paucivitellosus hanumanthai n[ sp[ "Trematoda] Bivesiculidae#[ Trans Am Microsc Soc 0878^097]10Ð15[ Sambrook J\ Fritsch EF\ Maniatis T[ Molecular cloning[ Cold Spring Harbor\ NY] Cold Spring Harbor Laboratory Press\ 0878[ Higgins DG\ Bleasby AJ\ Fuchs R[ CLUSTAL V] Improved software for multiple sequence alignment[ Com! put Appl Biol Sci 0881^7]078Ð080[ Cribb TH\ Bray RA\ Barker SC[ Bivesiculidae and Haplo! splanchnidae "Digenea# from _shes of the southern Great Barrier Reef\ Australia[ Syst Parasitol 0883^17]70Ð86[ Ko ie M\ Lester RJG[ Larval didymozoids "Trematoda# in _shes from Moreton Bay\ Australia[ Proc Helminthol Soc Wash 0874^41]085Ð192[ Anderson\ GR[ Identi_cations and maturation of the met! acercaria of Indodidymozoon pearsoni "Digenea] Didy! mozoidae#[ J Helminthol\ in press[