A dog growth hormone cDNA codes for a mature protein identical to pig growth hormone

Gene, 143 (1994)277-280 0 1994 Elsevier Science B.V. All rights reserved.

GENE

277

0378-l 119/94/$07.00

07894

A dog growth hormone cDNA codes for a mature protein identical to pig growth hormone (Canisfamiliaris;

pituitary gland; polymerase chain reaction; nucleotide sequence; bacterial expression)

Jorge A. Ascacio-Martinez

and Hugo A. Barrera-Saldafia

Departamento de Bioquimica, Facultad de Medicina, Universidad Autdnoma de Nuevo Ledn., Monterrey, N.L., 64000, MJxico Received by F. Bolivar:

10 August

1993; Revised/Accepted:

17 December/20

December

1993; Received at publishers:

14 February

1994

SUMMARY

Although methods for purification of dog (Canisfamiliaris) growth hormone (cfGH) were described in the late Sixties, the cloning of its cDNA has not been achieved until now. In order to clone the cfCH cDNA, we capitalized on the high degree of nucleotide sequence conservation among mammalian GH genes to design a pair of consensus oligodeoxyribonucleotide primers. With these, and starting with dog pituitary gland total RNA, we specifically amplified the cfGH cDNA using the reverse transcription-polymerase chain reaction. Its coding sequence (651 bp), as well as its 3’ untranslated region (101 bp), resemble those of a typical mammalian GH cDNA. Interestingly, its encoded mature protein is identical to pig growth hormone (pGH).

INTRODUCTION

Mammalian growth hormones (GHs) are single 22-kDa polypeptides typically of 190 aa that present structural and functional similiarities (Catt et al., 1967; Sherwood, 1967; Niall et al., 1971; 1973). Complete nt sequences have been determined for GH genes or their cDNAs from the following mammalian species: man (DeNoto et al., 1981; Seeburg, 1982), rat (Barta et al., 1981; Page et al., 1981), cattle (Woychik et al., 1982; Seeburg et al., 1983), pig Correspondence

to: Dr.

H.A.

Barrera-Saldafia,

Departamento

de

Bioquimica, Facultad de Medicina de la Universidad Autonoma de Nuevo Leon, A.P. 3&-4125, Monterrey, N.L., 64000, Mexico. Tel. and Fax (52-8) 333-7747;

e-mail:[email protected]

Abbreviations: aa, amino acid(s); bp, base pair(s); BGal, S-galactosidase; bGH, bovine GH; cDNA, DNA complementary to mRNA; cfGH, Canis familiaris GH; dGTP, deoxyguanosine triphosphate; dITP, deoxiinosine triphosphate; E., Escherichia; GH, growth hormone; GH, gene or cDNA encoding GH; hGH, human GH; IPTG, isopropyl-B-Dthiogalactopyranoside; kb, kilobase or 1000 bp; MBP, maltosebinding protein; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PCR, polymerase chain reaction; pGH, pig GH; re-cfGH, recombinant cfGH; SDS, sodium dodecyl sulfate. SSDI 0378-1119(94)00105-2

(Seeburg et al., 1983), sheep (Warwick et al., 1989), goat (Yamano et al., 1988) and mink (Shoji et al., 1990). Deletions of the GH gene causes autosomal recessive dwarfism in man (McKusick, 1978), mice (Nicholas, 1978; Either and Beamer, 1976), German Shepherd and in other breeds of dogs (Nicholas, 1978; Andresen et al., 1974; Andresen and Willeberg, 1976a,b). Therapy for pituitary dwarfism relies on the administration of GH (Feldman and Nelson, 1987). Within 4 to 6 weeks after initiating therapy, adult dogs show regrowth of hair and thickening of the skin. Unfortunately, dog (Canisfamiliaris) GH (cfGH) preparations are difficult to obtain and therefore expensive. Perfect immunological cross-reactivity with pig GH (pGH) has been reported for cfGH (Cocola et al., 1976) and indeed bovine GH (bGH) and pGH have been used experimentally to treat canine pituitary dwarfism (Feldman and Nelson, 1987; Eigenmann, 1981). Phenylalanine comprises the C- and N-terminal residues of cfGH, as is the case for porcine, bovine, ovine and human hormones. The aa composition and other chemical and immunological properties of cfGH were found to be very similar to those of pGH (Scott et al., 1978).

278 +l MetAlaAlaGlvProA~rSerValLeu~Leu~~euCvsLeuEX;pTr~ProGlnGluValGl~PheProAlaMetProLeuSerSer 8 atggctgcaggcccccggacctcTGTGCTCCTGGCCTTCGCCTTGCTCTGCCTGCCCTGGCCTCAGGAGGTGCGCGCCTTCCCGGCCA~CCC~TCCAGClo2 Pig C T C A T A(Thr) A Mink TT T A(Asn)CA(Met) TG(Val) c A(Ser) LeuPheAlaAsnAlaValLeuArgAlaGlnHisLeuHisGlnLeuAlaAlaAspThr~rLysGluPheGluArgAla~rIleProGluGlyGlnArgTyr 42 CTGTTTGCCAACGCCGTC;CTCCGGGCCCAGCACC~CACC~C~GC~CCGACACCTAC~GAG~AGC~GCGTACATCCCCGA~GACAGA~TACZO~ A G G Pig c c Mink C C(Asp) SerIleGlnAsnAlaGlnAlaAlaPheCysPheSerGluThrIleProAlaProThrGlyLysAspGluAlaGlnGlnArgSerAspValGluLeuLeuArg76 TCCATCCAGAACGCGCAGCCCGCC~C~CTTCTCGGAGACCATCCCGGCCCCCACGGGC~GGACGA~CCCAGCAGCGATCCGACG~GAGCTGCTCCGC306 Pig C T A G G G AtMet) Mink T C A PheSerLeuLeuLeuIleGlnSerTrpLeuGlyProValGlnPheLeuSerArgValPheThrAsnSerLeuValP~eGlyThrSerAspArgVal~rGlullO TTCTCCCTGCTGCTCATCCAGTCG~CTC~GCCCG~CAG~TCTCAGCA~GTCT~ACC~CAGCC~GTG~CGGCACCTCAGACCGAGTCTACGAG408 G Pig c T c G G c G Mink LysLeuLysAspLeuGluGluGlyIleGlnAlaLeuMetArgGluLeuGluAspGlySerProArgAlaGlyGlnIleLeuLysGlnThr~rAspLysPhel44 AAGCTCAAGGACCTGGAGGAGCATCCAAGCCC~A~C~GAGCT~~GA~GCAGTCCCCGGGCCGGGCAGATCC~~GCAGACCTA~GAC~GTTTSlO Pig G G A A G C C AA G G A Mink C C C(Pr0) AspThrAsnLeuArgSerAspAspAlaLeuLeuLysAsnTrLeuArgValMet178 GACACGAACCTGCGCAGTGACGATGCGCTGCTTAACAACTACGGGC~CTCTCC~C~C~G~GACC~CAT~GGCCGAGACGTACCTGCG~TCATG612 A T Pig T C T A G C A T Mink c C C T G C LysCysArgArgPheValGluSerSerCysAlaPhe*** AAGTGTCGCCGCnrG~~GCAGCTGTGCC~CTAG~C~GGCATCTC~TCACCCCCTCCCCAGAGCCTCC~C~CCC~GGAGTGCCGCTCCAGG714 Pig GTCCACTGTGCTTTCC~GTT~G~GCATCAT~ Fig. 1. Sequence of cfGH cDNA and encodedprotein. The deduced aa sequence of the cfGH coding region is listed above the nt sequence. The putative signal peptide sequence is underlined. The stop codon is marked with three asterisks. The aa residues that are different in mink GH with respect to cfGH and the only aa residue that distinguishes pre-GH from pre-cfGH (position -6 of the signal peptide), are shown inparentheses at theimmediate right of the nt changeresponsible forthese differences. The putative polyadenylation signal is doublyunderlined. GenBank accesion No. forcfGH cDNA is 223067. Methods: Pituitary glands recovered from dog cadavers provided to us by the physiology laboratory of our medical school were collected and stored in liquid nitrogen until required. RNA extraction from this tissue was made by the single-step acid guanidinium thio~yanate-phenol-chloroform method (Chomczynski and Sacchi, 1987). Single-strands cDNA was synthesized from total RNA (7 pg) using the AMV reverse transcriptase system (Gibeo-BRL, Gaithersburg, MD, USA) with random primers (hexamers) or, in order to favor the cloning of the 3’ end untranslated region, with an oligo(dT) primer. GH cDNAs from mink (Shoji et al., 1990), pig (Seeburg et al., 1983), cattle (Woychik et al., 1982; Seeburg et al., 1983) and sheep (Warwick et al., 1989) sequences downstream and upstream from and start (ATG) and stop (TAG) codons were compared, found to be conserved, and used to desing a pair of consensus PCR primers with unique restriction sites (5’ primer: S-CTAGGAATTCCATGGCTGCAGGCCCCCGGACCTC and 3’ primer: 5’-GGAAGCTTCTAGAAGGCACAGCTGGCCTCCCCGAA) at their 5’ ends. A second 3’ end primer [poly(dT) primer: S-TGCATGCAAGCTTTTTTTTTTTTTTTTT] was also synthesized and used to obtain the sequence of the 3’ end untranslated region. A SO-$ PCR mix was assembled in a tube combining 38.7 ~1 of distilled water, 5 pi of the amplification buffer (100 mM TrisHCl pH 8.3/15 mM MgClJ500 mM KCl/l mg per ml gelatin), 2 ~1 of purified (by phenol-chlorophorm extraction and ethanol precipitations total cDNA (one-tenth of the amount generated in the cDNA synthesis reaction), 1.3 pl of dNTP mix (8 mM), 1 ~1 of the 5’ consensus primer (2.5 PM), 1 pl of the 3’ consensus primer (2.5 PM) and 1 pl of Tuq polymerase (at 5 units/$). A second amplification reaction was also carried out in which the 3’ consensus primer was replaced for the generic poly(dT) primer and the randomly primed cDNA for an oligo(dT)-primed cDNA. The reaction mixes were subjected to 30 amplification cycles, each cycle consisted of three steps: denaturation at 94°C for 1.5 min; annealing at 55°C for 1.5 min; extention at 72°C for 2 min. Amplification products were cut at their artificial unique restriction sites introduced via the PCR primers (EcoRI at the 5’ and Hind111 at the 3’), subcloned into both M13mpl8 and M13mp19 sequencing vectors, and the putative cfGH cDNA was sequenced by the dideoxy chain-termination method (Sanger et al., 1977) using the Sequenase kit (US Biochemical, Cleveland, OH, USA). Codon translation was facilitated by the Pustell molecular biology software (Pustell and Kafatos, 1982). For the nt sequence comparison of GH cDNAs we retrieved by electronic mail (BITNET) from EMBL databank version 72 the pig and mink GH cDNA sequences, using the IntelliGenetics program ‘Findseq’. via the ICGEB network facilities (Trieste, Italy).

Although methods for the isolation and purification of cfGH have been described (Wilhelmi, 1968; Hashimoto et al., 1969), the isolation of the cfGH gene has not been achieved yet, limiting our understanding of this pathology, the development of gene replacement therapy and exploiting recombinant-derived cfGH (rcfGH) to treat age-related diseases, bone fractures, burns and many other disorders in dogs, as has been carrried out in humans. The aim of the present study was cloning, sequencing

characterization and bacterial expression of the cfGH cDNA whose encoded mature protein is identical to pGH.

EXPERIMENTAL AND DISCUSSION

(a) cfGH cDNA cloning and sequencing In order to clone cfc;r-i cDNA, total RNA was isolated

by the single-step method (Chomczynski and Sacchi, 1987) from dog pituitary glands. This RNA was used to

279 synthesize

cDNA

cfGH cDNA

with the use of reverse

was specifically

the 5’ end primer quence obtained lian

one derived

from the consensus

several related mammato Fig. 1). As the 3’ end

we used also a specific consensus

in a second cloning unique

experiment

artificial

The amplified

lease the terminal and sequenced (Sanger

primer

DNA product

I

2

3

primer.

subsequent

kDa M

5

I

97

2

3

4

66

In

manipu-

was digested

by the dideoxy

to remethod

Fig. 2. Synthesis

of MBP-cfGH

Proteins

were resolved

gel electrophoresis and then the gel brilliant blue (A) or blotted onto a

nitrocellulose membrane and immunoprobed (B) using rabbit antibovine GH serum, biotinylated second antibody and a streptavidin-

of cfGH cDNA and its encoded

biotin-peroxidase

complex

lysed TBl/pMALc-cfGH

quence similiarity with the only cDNA known for a GH from carnivora species, i.e., that of the mink (see Fig. 1). Suprisingly, even though cfGH cDNA differs from the pGH cDNA at 38-nt positions, 37 are neutral (34 at the third codon position and three at the first codon position) and only one (also first codon position) differentiates (a

mids from white colonies and by gel electrophoresis

change of Pro in cfGH for Thr in pGH) the aa sequence of the precursors of these two GHs. However, since this the mature

fusion protein.

by 0.1% SDS-15% polyacrylamide was either stained with Coomassie

protein Both the cfGH cDNA coding sequence (651 bp) and its 3’ untranslated region (101 bp) resemble the sequence of a typical mammalian GH cDNA (Fig. 1). The coding sequence is comprised of 217 codons, 190 of which correspond to the mature hormone, 26 to the signal peptide and the last to a stop. When compared to other mammalian GHs, the aa sequence of the prehormone encoded by cfCH cDNA displays 95.8% (seven differences) se-

is the sixth aa of the signal peptide, identical to pGH (see Fig. 1).

4

sites were added to

et al., 1977).

(b) Characteristics

tDaM

which,

cohesive ends, cloned into Ml3 vectors on both strands

B

A

region, was replaced

by a poly(dT)

restriction

the 5’ ends of the primers to facilitate lations.

se-

(see legend

in order to define the 3’ untranslated addition,

transcriptase.

by PCR using as

after comparing

GH cDNAs

primer

amplified

as the detection cells grown

system. Total proteins

overnight

from

with (see lanes A2 and

B2) or without (see lanes Al and Bl) IPTG induction (5-15 h) are shown. Lanes A3 and B4 show purified inclusion bodies containing MBP-cfGH. The positive expression control presses mature HGH (22 kDa) when induced

is TBl/pBHX that exby IPTG (see lanes A4

and B3). Lane A5 is the negative control (TBl/pMALc without the CFGH cDNA) also induced by IPTG. MW markers (M) are shown on both panels DNA ligation (New England were introduced

and their sizes are indicated we inserted Biochemical,

in kDa. Methods: Using

the cfDG cDNA into the pMALc vector Beverly, MA, USA). The ligation products

into TBl (New England

Biochemical)

E. coli and plas-

were characterized with restriction enzymes (Sambrook et al., 1989). Transformed cells

were grown at 37°C for 2 h (A6oo nm=0.4 umts) m 2 x YT medmm (Sambrook et al., 1989) containing 100 ug/ml ampicillin followed by a further 5-15 h induction period were prepared for electrophoresis

with 0.1 mM IPTG. Total cell lysates by centrifuging 1 ml of bacteria, ad-

justing absorbance to 0.01 units/ml, resuspending and boiling for 4 min in sample buffer containing

in sample lysis buffer 2% SDS (Sambrook

et al.. 1989).

cfGH is treated

with factor Xa, it released

the GH moiety

(data

not shown). (c) cfcH cDNA subcloning and expression To test the functionality of our cDNA clone, we subcloned its cDNA insert into the pMALc expression vector giving rise to pMALc-cfGH. This tat-promoter-based expression vector with no insert produces a fusion protein between MBP (product of the malE gene) and PGal (from the LacZ gene). pMALc-cfGH was introduced into the TBl strain of E. coli and a resulting bacterial clone was grown and exposed to IPTG inducction. Total bacterial proteins were analyzed by both polyacrylamide gel electrophoresis and Western blotting (Sambrook et al., 1989). A band of the expected size (approx. 66 kDa) for the fusion protein composed of MBP and cfGH was easily observed in the induced clone (Fig. 2A) and was recognized by the anti-bGH antiserum used for the Western blot (Fig. 2B). The hybrid protein was recovered from inclusion bodies and although it was difficult to cut when

(d) Conclusions (I) This is the first report of the sequence of a GH from a member of the Canidae family and of two identical GHs from species belonging to different orders. (2) Our observation that dog and pig have identical GHs and that mink being in the same suborder as dog has a GH that does not share this complete identity, supports questioning current evolutionary trees (Novacek, 1992). In fact, some authors have grouped carnivores with ungulate orders within the cohort Ferungulata (Li et al., .1990). (3) Since cfGH turned out to be identical to pGH and the three-dimensional structure of the latter has been recently solved (Abdel-Meguid et al., 1987), we can extrapolate the tertiary structure of pGH to cfGH. (4) By having isolated, cloned and characterized the

280

cfGH cDNA we now not only understand why pGH is effective in treating canine pituitary dwarfism, but also provide a biological regulator capable of being exploited simultaneously in at least two important animal species, one for domestic and the other for farming purposes.

Hashimoto, C., Irie, M., Matsuzaki, F., Tsushima, T. and Shizume, K.: Purification and properties of canine growth hormone. Biochim. Biophys. Acta 175 (1969) 231-234. Li, W.H., Gouy, M., Sharp, P.M., O’hUigin, Molecular Artiodactyla,

C. and

Yang,

Y.W.:

phylogeny of Rodentia, Lagomorpha, Primates, and Carnivora and molecular clocks. Proc. Natl. Acad.

Sci. USA 87 (1990) 670336707. McKusick, V.A.: Mendelian Inheritance in Man. The Johns University Press, Baltimore, MD, 1978. ACKNOWLEDGEMENTS

Miller, W.L. and Eberhardt,

We thank F.J. Arredondo and M. Castro for helping with DNA oligo synthesis and design, D. Baty for the GH expression plasmid as positive control, A. Martinez and C. Moreno for computer analysis, J.L. Vazquez and N. Fernandez for helping with pituitary gland recovery, G.F. Saunders and B.W. O’Malley for discussions, R.M. Chandler-Burns for critical reading of our manuscript and A.I. Ramirez for helping with preparing it. J.A.A.-M. thanks the Mexican Council of Science and Technology for a scholarship. We also express our gratitud to ITESM campus Monterrey and IBM de Mexico S.A. for computer and communication facilities.

hormone

N.L.: Structure

gene family. Endocr.

Niall, H.D., Hogan, F.C.: Sequences

and evolution

M.L., Sauer, R., Rosenblum, I.Y. and Greenwood, of pituitary and placental lactogenic and growth

hormones: evolution from a primordial peptide by gene reduplication Proc. Natl. Acad. Sci. USA 68 (1971) 866-869. Niall, H.D., Hogan,

M.L., Tregear,

G.W., Segre, G.V., Hwang,

Nicholas, F.: Pituitary dwarfism in German Shepherd dogs: a genetic analysis of some australian data. J. Small Anim. Pratt. 19 (1978) 167-174. Novacek,

M.J.: Mammalian

phylogeny:

(1992) 121-125. Page, G.S., Smith, S. and Goodman, growth

hormone

shaking

the tree. Nature

H.M.: DNA sequence

gene: location

J. and Kafatos,

DNA

engineered variant of porcine growth Sci. USA 84 (1987) 6434-6437. Andresen, E., Willeberg, in German Shepherd

hormone.

Proc. Natl. Acad.

P. and Rasmussen, P.G.: Pituitary dogs: genetic investigations. Nord.

dwarfism Vet. Med.

26 (1974) 6922701. Andresen, E. and Willeberg, P.: Pituitary dwarfism in German Shepherd dogs: evidence of simple, autosomal recessive inheritance. Nord. Vet. Med. 28 (1976a) 487-495. Andresen, E. and Willeberg, P.: Pituitary dogs: evidence of simple, autosomal

dwarfism

in Carnelian

bear

recessive inheritance.

Heriditas

83 (1976b) 232-234. Barta, A., Richards, R.I., Baxter, J.D. and Shine, J.: Primary

structure

and evolution

of rat growth

hormone

sequence

51-59. Sambrook,

of the 5’ terminus

F.C.: A convenient

analysis

J., Fritsch,

Sanger, F., Nicklen, S. and Coulson, terminating 5463-5467. Scott,

D.W.,

inhibitors. Kirk,

hormone

and

placental lactogen: structural similarity. Science 157 (1967) 321. Chomczynski, P. and Sacchi, N.: Single-step method of RNA isolation

Proc.

R.W.,

package

Hampshire,

J.

of

Acids Res. 10 (1982)

T.: Molecular

Acad.

of the rat

transposon-like

Cloning.

Laboratory

A.R.: DNA sequencing Natl.

356

of the growth

and adaptable

Nucleic

E.F. and Maniatis,

Sci. USA and

A

Press,

with chain74 (1977)

Altszuler,

N.:

Chnicopathological findings in a German Shepherd with pituitary dwarfism. J. Am. Anim. Hosp. Ass. 14 (1978) 183-191. Seeburg, P.H.: The human growth hormone gene family: nucleotide sequences show recent divergence and predict a new polypeptide DNA 1 (1982) 239-249.

Seeburg, P.H., Sias, S., Adelman, J., De Boer, H.A., Hayflick, J., Jhurani, P., Goeddel, D.V. and Heyneker, H.L.: Efficient bacterial expression of bovine and porcine

growth

programs.

Laboratory Manual, 2nd Ed. Cold Spring Harbor Cold Spring Harbor, NY, 1989.

hormone.

gene. Proc. Natl. Acad. Sci.

USA 78(1981)486774871. Catt, K.J., Moffat, 8. and Niall, H.D.: Human

P. and

Friesen, H.: The chemistry of growth hormone and the lactogenic hormones. Recent Prog. Horm. Res. 29 (1973) 387-404.

Pustell,

Abdel-Meguid, S.S., Shieh, H.S., Smith, W.W., Dayringer, H.E., Violand, B.N. and Bentle, L.A.: Three-dimensional structure of a genetically

of the growth

Rev. 4 (1983) 97-130.

hormone mRNA and identification of an internal element. Nucleic Acids Res. 9 (1981) 2087-2104. REFERENCES

Hopkins

growth

hormones.

DNA 2 (1983) 37-45.

Sherwood, L.M.: Similarities in the chemical structure of human placental lactogen and pituitary growth hormone. Proc. Nat]. Acad. Sci. USA 58(1967)2307-2314.

by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162 (1987) 156-159. Cocola, F., Udeschini, G., Secchi, C., Panerai, A.E., Neri, P. and Muller,

Shoji, K., Ohara, E., Watahiki, M. and Yoneda, Y.: Cloning and nucleotide sequence of a cDNA encoding the mink growth hormone. Nucleic Acids Res. 18 (1990) 6424.

E.E.: A rapid radioimmunoassay method of growth hormone in dog plasma. Proc. Sot. Exp. Biol. Med. 151 (1976) 140-145. Denoto, F.M., Moore, D.D. and Goodman, H.M.: Human growth hormone DNA sequence and mRNA structure: possible alternative

Warwick,

splicing. Nucleic Acids Res. 9 (1981) 3719-3730. Either, E.M. and Beamer, W.G.: Inherited ateliotic dwarfism in mice. Characteristics of the mutation, little, on chromosome 6. J. Hered. 67 (1976) 87791. Eigenmann, J.E.: Diagnosis and treatment of dwarfism in a German Shepherd dog. J. Am. Anim. Hosp. Ass. 17 (1981) 798-804. Feldman, E.C. and Nelson, R.W.: Canine and Feline Endocrinology and Reproduction, Growth Hormone. Saunders, Philadelphia, PA, 1987, pp. 29-54.

J.M., Wallis,

O.C. and Wallis,

M.: Cloning,

sequence

expression in Escherichia coli of cDNA for ovine pregrowth mone. Biochim. Biophys. Acta 1008 (1989) 247-250. Wilhelmi, A.E.: Canine 1999207.

growth

hormone.

and hor-

Yale J. Biol. Med. 41 (1968)

Woychik, R.P., Camper, S.A., Lyons, R.H., Horowitz, S., Goodwin, E.C. and Rottman, F.M.: Cloning and nucleotide sequencing of the bovine growth hormone gene. Nucleic Acids Res. 10 (1982) 7197-7210. Yamano, Y., Oyabayashi, K., Okuno, M., Yato, M., Kioka, N., Manabe, E., Hashi, H., Sakai, H., Komano, T., Utsumi, K. and Iritani, A.: Cloning and sequencing of cDNA that encodes goat growth hormone. FEBS Lett. 228 (1988) 301-304.