- Email: [email protected]
A duplex PCR assay for the simultaneous detection and differentiation of Muscovy duck parvovirus and goose parvovirus
Molecular and Cellular Probes 47 (2019) 101439
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
A duplex PCR assay for the simultaneous detection and differentiation of Muscovy duck parvovirus and goose parvovirus
T
Chunhe Wan∗, Longfei Cheng, Cuiteng Chen, Rongchang Liu, Shaohua Shi, Guanghua Fu, Hongmei Chen, Qiuling Fu, Yu Huang∗∗ Fujian Provincial Key Laboratory for Avian Diseases Control and Prevention, Fujian Animal Diseases Control Technology Development Center, Institute of Animal Husbandry and Veterinary Medicine of Fujian Academy of Agricultural Sciences, Fuzhou, 350013, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Muscovy duck parvovirus Goose parvovirus Detection Differentiation Duplex PCR method
Both Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) can cause high mortality and morbidity in Muscovy ducklings. MDPVs and GPVs share high nucleotide identity, which can cause errors during differential diagnosis. In this study, the NS genes of both MDPVs and GPVs were chosen for the design of specific primers after genetic comparison. Only three primers (GF1, MF1 and MGR1) were designed for the duplex PCR assay: GF1 is specific for GPV only; MF1 is specific for MDPV only; and MGR1 is highly conserved for both MDPV and GPV. After a series of optimization experiments, the duplex PCR assay amplified a 161-bp fragment specifically for GPV, a 1197-bp fragment specifically for MDPV, and two fragments (161-bp and 1197-bp) for both GPV and MDPV. The lowest detection limit was 103 copies/μl. No amplification was obtained using nucleic acids from other pathogens (including DAdV-A, DuCV, DEV, GHPV, R.A., E. coli., P.M. and S.S.) occurring in Muscovy ducks. Application of the duplex PCR assay in field samples showed that even one-day-old Muscovy ducklings were both MDPV-positive and GPV-positive. In conclusion, a duplex PCR assay for the simultaneous detection and differentiation of MDPV and GPV was established using only three highly specific primers. Our finding suggested that country-wide vaccination with MDPV and GPV vaccines in waterfowls are necessary.
1. Introduction Goose parvovirus (GPV) infection, also known as Derzsy's disease in Europe [1], was first described by Professor Fang in the early 1960s in China [2]. Muscovy duck parvovirus (MDPV) infection was first reported by Professor Lin in the early 1990s in our laboratory in southeast China [3]. Normally, GPV can cause fatal diseases to goslings and Muscovy ducklings less than one month old. However, unlike GPV, MDPV causes a fatal disease in Muscovy ducklings [4,5]. GPVs and MDPVs have linear, single-stranded DNA genomes that are approximately 5000 nucleotides in length. The GPV and MDPV genomes can be divided into two major open reading frames (ORFs): the left ORF encodes a non-structural (NS) protein, which is required in viral regulatory functions, and the right ORF encodes three capsid proteins (VP1, VP2, and VP3), which are critical determinants for viral tropism, antigenicity and the biological properties of GPVs and MDPVs. Moreover, the entire sequences of VP2 and VP3 share the same C-terminus, which are derived from VP1 by different alternative splicing of mRNA [6–10]. ∗
Reportedly, genomic comparison between GPVs and MDPVs revealed that they share 79.6%–85.0% nucleotide similarity at the genome level [6,7,11]. In addition, immunological cross-reactivity was observed between GPVs and MDPVs [12–15]. Therefore, the risk of erroneous results is increased for the detection and differentiation of GPVs and MDPVs, especially in Muscovy ducklings. A previous study demonstrated that the NS genes of MDPVs shared a separate MDPV cluster, whereas the NS genes of GPVs shared a significantly different and separate GPV cluster after phylogenetic analysis. The nucleotide sequence identity was more than (or equal to) 98.1% within the MDPV cluster and more than (or equal to) 93.3% within the GPV cluster. In addition, the nucleotide homology of NS genes between the MDPV cluster and GPV cluster ranged from 80.8% to 83.4% [16,17]. Therefore, NS genes are suitable candidate regions for designing PCR primers for the detection and differentiation of GPVs and MDPVs.
Corresponding author. Xi-feng Road No.100, Jiantian village, Jin'an district, Fuzhou city, 350013, China. Corresponding author. Xi-feng Road No.100, Jiantian village, Jin'an district, Fuzhou city, 350013, China. E-mail addresses: [email protected] (C. Wan), [email protected] (Y. Huang).
∗∗
https://doi.org/10.1016/j.mcp.2019.101439 Received 4 July 2019; Received in revised form 8 August 2019; Accepted 20 August 2019 Available online 21 August 2019 0890-8508/ © 2019 Elsevier Ltd. All rights reserved.
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
Table 1 Sequence variation in multiple sequence alignments. Primers GF1
Type
Sequences (5’→3′)
Synthesized GPVA1
MDPV
MF1
MGR1 (Reverse)
AGCCTAAGAGAAGCARGAACA AGCCTAAGAGAAGCAGGAACA AGCCTAAGAGAAGCAAGAACA AGCCTAAAAGAAGCAGGAACA AGAGAAAGAAAACCCGTGGGG AGAGAAAGAAAACCCGTCGGG AGAGAAAGAAAACTCGTGGGG AATGCTGTAGTGCAGGAGGA D1 AATGCTGTAGTGCAGGAGGA GCCGCCCCTTTACCTGATCC GCTGCCCCTTTACCTGATCC GCAGCCCCTTTACCTGATCC GCTGCCCCTTTACCCGATCC ACAATCATACCACCCATGTT D1 AACATGGGTGGTATGATTGT AACATGGGTGGTATGATTGT AACATGGGTGGTATGGTTGT AACATGGGTGGTATGATTGT AACATGGGTGGTATGACTGT
A2
Synthesized MDPV B1 GPV B2
Synthesized (Reverse) MDPV GPV
Frequency D1
C1
C1
59.46% (22/37) 37.84% (14/37) 2.70% (1/37) 66.67% (10/15) 26.67% (4/15) 6.67% (1/15) 100%% (15/15) 18.92% (7/37) 43.24% (16/37) 2.70% (1/37) 35.14% (13/37)
93.33% (14/15) 6.67% (1/15) 81.08% (30/37) 18.92% (7/37)
A1
The variation is indicated in bold and underlined. The variation in the 3′-terminal is indicated with in a box. B1 The synthesized primers are 100% matched with MDPVs. B2 The variation in the 3′-terminal in indicated in a box. C1 The synthesized primers are highly conserved at the 3′-terminus of both GPVs and MDPVs. D1 The synthesized primers marked as italics type. A2
2. Methods
30 s, and 72 °C for 45 s. The PCR products were electrophoresed in a 1.0% agarose gel.
2.1. Primer selection and design 2.4. Specificity analysis
On the basis of the sequence alignments of GPV (37 isolates) and MDPV (15 isolates) [16,17]. NS genes retrieved from GenBank (http:// www.ncbi.nlm.nih.gov), three primers (MF1, GF1, and MGR1, see Table 1) located within the NS regions of GPV and MDPV were selected with Primer Analysis Software Oligo 7. MF1 was selected specifically for MDPV only, GF1 was selected specifically for GPV only, and MGR1 was selected for both MDPV and GPV. All primers (GF1, MF1, and MGR1) were synthesized by a commercial company (Sangon, Shanghai, China).
GPV, MDPV, DAdV-A, DuCV, DEV, GHPV, R.A., E. coli., P.M. and S.S. were used to determine the specificity of the duplex PCR. The PCR products were electrophoresed in a 1.0% agarose gel. Genomic DNA extracted from healthy Muscovy duck samples (liver) and nuclease-free water were used as negative controls in the PCR assay.
2.5. Sensitivity analysis 2.2. Preparation of viral DNAs and bacterial DNAs The limit of detection (LOD) of the duplex PCR assay was evaluated using serial ten-fold dilutions of previously cloned pT–NS–GPV and pT–NS–MDPV [11]. The plasmid DNA (pT–NS–GPV and pT–NS–MDPV) was quantified at 260-nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). A total of 1 μl of plasmid DNA from 106 to 101 copies/μl of each plasmid DNA was used to determine the sensitivity of the duplex PCR.
Viral DNAs [e.g., GPV, MDPV, Duck adenovirus A (DAdV-A), Duck circovirus (DuCV), duck enteritis virus (DEV), and duck origin-goose haemorrhagic polyomavirus (GHPV) [18]] were extracted with the EasyPure Genomic DNA Kit (TransGen Biotech, Beijing, China). Bacterial genomic DNAs [e.g., Riemerella anatipestifer (R.A.), Escherichia coli (E. coli.), Pasteurella multocida (P.M.) and Salmonella spp. (S.S.)] were extracted with the EasyPure Bacteria Genomic DNA Kit (TransGen Biotech). DNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific, MA, USA) and then stored at −80 °C until use.
2.6. Clinical samples application Sixteen individual Muscovy ducklings (less than three weeks old) and nine individual goslings (less than four weeks old) samples (livers) were collected from the Poultry Disease Treatment Center, Department of the Institute of Animal Husbandry and Veterinary Medicine of Fujian Academy of Agricultural Sciences. Each tissue was quantitatively weighed (0.1 g) to extract DNA using the EasyPure Genomic DNA Kit according to the manufacturer's instructions. Positive fragments were harvested, purified, T-A cloned and sequenced at Sangon (Shanghai, China). Meanwhile, PCR-RFLP [19] and multiple PCR methods [16], which were developed by our laboratory, were used simultaneously for detection.
2.3. Duplex PCR protocol optimization The duplex PCR assay was optimized and validated with a TaKaRa PCR Thermal Cycler Dice™ Gradient (OTSU, SHIGA, Japan). Different concentrations of the primers (GF1, MF1, and MGR1) were prepared in the reaction tubes to optimize the assay. The concentrations of the reaction mixture were applied as follows: 25 μl DreamTaq Green PCR Master Mix (2 × ) (Thermo Fisher Scientific), 0.8 μl GF1 (10 μmol/l), 0.4 μl MF1 (10 μmol/l), 1.5 μl MGR1 (10 μmol/l), 1 μl DNA template, and then nuclease-free water was used to adjust the total reaction volume (total reaction volume of 50 μl). The following thermo profile was set: 1 cycle of 95 °C for 3 min and 30 cycles of 95 °C for 30 s, 55 °C for 2
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
3. Results 3.1. Primers analysis For the GPV-specific forward primer GF1, the sequence of 59.46% (22/37) of the GPV genomes is “AGCCTAAGAGAAGCAGGAACA” and 37.84% (14/37) of the GPV genomes is “AGCCTAAGAGAA GCAAGAACA”; thus, we used R (R = A/G) and synthesized “AGCCTAAGAGAAGCARGAACA”, which covered the highest number (36/37) of GPVs. In addition, at these positions, the MDPV sequences are significantly different from the GPV sequences at the 3′-terminus. For the MDPV-specific forward primer MF1, the sequence of 100% (15/15) of the MDPV genomes is “AATGCTGTAGTGCAGGAGGA”. In addition, at these positions, the GPV sequences are significantly different from the MDPV sequences at the 3′-terminus. These data demonstrated that primer GF1 is specific for GPV only, and primer MF1 is specific for MDPV only. For the reverse primer MGR1, both MDPVs and GPVs are conserved at the 3′-terminus of the designed regions, and the primers variations of GF1 and MF1 and MGR1 are listed in Table 1.
Fig. 2. The sensitivity of duplex PCR assay for the simultaneous detection and differentiation of GPV and MDPV. Lane M, DNA marker DL2000; The assay was performed using 106 copies (lane 1), 105 copies (lane 2), 104 copies (lane 3), 103 copies (lane 4), 102copies (lane 5), 101 copies (lane 6).
3.2. Duplex PCR assay Using these three primers, the duplex PCR amplified a 161-bp fragment specifically for GPV, a 1197-bp fragment specifically for MDPV, and two fragments (161-bp and 1197-bp) for both GPV and MDPV (Fig. 1). For specificity analysis, no amplification occurred using the nucleic acids from other duck pathogens (DAdV-A, DuCV, DEV, GHPV, R.A., E. coli., P.M. and S.S.) or the negative control under the same conditions (Fig. 1). Using 106 to 101 copies of the plasmid DNA of GPV and MDPV as templates, the detection reaction limit of the duplex PCR assay was assessed at 103 copies/μl (Fig. 2).
from ducklings) MDPV-positive samples at the 5′-terminus were “AGC CTAAGAGAAGCAGGAACA” (abbreviated as MFS1). With the primer GF1, 11 GPV-positive (5 from ducklings and 6 from goslings) samples at the 5′-terminus were “AGCCTAAGAGAAGCAGGAACA” (abbreviated as GFS1). With the primer MGR1, all MDPV-positive samples at the 3′terminus were “AACATGGGTGGTATGATTGT” (abbreviated as MRS1); 10/11 (90.91%) GPV-positive samples at the 3′-terminus were “AACA TGGGTGGTATGATTGT” (abbreviated as GRS1); 1/11 (9.09%) GPVpositive samples at the 3′-terminus was “AACATGGGTGGTATGACTGT” (abbreviated as GRS2).
3.3. Clinical samples application
4. Discussion
As summarized in Table 2, for Muscovy ducklings, the results demonstrated that 6/16 (37.5%) samples (aged from 1 to 20 days) tested positive for MDPV, 3/16 (18.75%) samples (aged from 9 to 15 days) tested positive for GPV, and 2/16 (12.5%) samples (aged 12 days and 17 days) tested positive for both GPV and MDPV. For goslings, 6/9 (66.67%) samples (aged from 1 to 25 days) tested positive for GPV; no MDPV-positive goslings were identified. All positive fragments in this study were harvested and purified (Gel Extraction Kit, OMEGA Bio-tek, Guangzhou, China), T-A cloned (pEASY-T1 Simple Cloning Kit, TransGen Biotech, Beijing, China), and then confirmed using the Sanger sequencing method in both directions (Sangon, Shanghai, China). With the primer MF1, the sequences of 8 (8
It is difficult to make a specific and differential diagnosis of MDPV infection and GPV infection because of high nucleotide identity and immunological cross-reactivity, especially in Muscovy ducklings. Several diagnostic methods have been employed for the detection or differentiation of MDPV and GPV, including PCR combined with restriction fragment length polymorphism (PCR-RFLP) [19,20], multiple PCR [16], loop-mediated isothermal amplification (LAMP) [21,22], aptamer-based label-free aptasensor [23], real-time fluorescent quantitative PCR [17,24–26], recombinase polymerase amplification combined with a vertical flow visualization strip [27], and colloidal goldbased immunochromatographic assay [28]. Polymerase chain reaction (PCR) is a powerful amplification technology that can generate an ample supply of a specific segment of DNA from only a small amount of starting material (i.e., DNA template or target sequence), which has become an indispensable tool in virus detection and differentiation. Designing appropriate primers is essential to the successful outcome of a PCR assay [29]. Due to the lack of complete genomic sequence comparison data of MDPV and GPV, especially MDPV sequences, errors may occur if designing a set of primers to an unsuitable region of genomic sequences. Our previous study showed that the NS genes of MDPVs and GPVs were suitable for virus classification and were also suitable for designing specific primers for developing differential diagnoses of MDPV infection and GPV infection, such as PCR-RFLP and multiple PCR. However, PCR-RFLP requires another EcoR I digestion reaction after PCR amplification, and multiple PCR requires two-tube PCRs (one for MDPV and the other for GPV). These methods showed excellent specificity, sensitivity and repeatability, but neither of them can provide simultaneous detection and differentiation for MDPV and GPV co-infection within one reaction in a tube.
Fig. 1. The specificity of duplex PCR assay for the simultaneous detection and differentiation of GPV and MDPV. Lane M, DNA marker DL2000; lane 1, GPV; lane 2,MDPV; lane 3, GPV and MDPV mixed DNA; lane 4, DAdV-A; lane 5, DuCV; lane 6, DEV; lane 7, GHPV; lane 8, R.A.; lane 9, E. coli.; lane 10, P.M.; lane 11, S.S.; lane 12, negative control (healthy liver); lane 13, negative control (Nuclease-free water). 3
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
Table 2 Comparison of the results of clinical samples from the duplex PCR assay in this study and the PCR-RFLP and multiple PCR methods. Host
Age (/d)
duplex PCR A
Md1 Md2 Md3 Md4 Md5 Md6 Md7 Md8 Md9 Md10 Md11 Md12 Md13 Md14 Md15 Md16 Gs1 Gs2 Gs3 Gs4 Gs5 Gs6 Gs7 Gs8 Gs9
1 3 4 7 9 9 9 11 11 11 12 14 15 15 17 20 1 2 4 7 15 15 19 21 25
PCR-RFLP
M
B
A
G
M
+ + – + – – – – – + + – – + + + – – – – – – – – –
+ – – – + – – + – – – – + – + – + + – + – – + + +
+ + – + – – – – – + + – – + + + – – – – – – – – –
Multiple PCR B
M
G
+ – – – + – – + – – – – + – + – + + – + – – + + +
+ + – + – – – – – + + – – + + + – – – – – – – – –
+ – – – + – – + – – – – + – + – + + – + – – + + +
G
A
Forward sequences
Reverse sequences
MFS1and GFS1 MFS1 / MFS1 GFS1 / / GFS1 / MFS1 MFS1 / GFS1 MFS1 MFS1and GFS1 MFS1 GFS1 GFS1 / GFS1 / / GFS1 GFS1 GFS1
MRS1 and GRS1 MRS1 / MRS1 GRS1 / / GRS1 / MRS1 MRS1 / GRS2 MRS1 MRS1 and GRS1 MRS1 GRS1 GRS1 / GRS1 / / GRS1 GRS1 GRS1
B
Md means Muscovy duckling origin samples, Gs means goose origin samples. MA indicates MDPV; + indicates positive; - indicates negative. GB indicates GPV; + indicates positive; - indicates negative. /indicates no sequence for the negative samples. MFS1 means “AGCCTAAGAGAAGCAGGAACA”. GFS1 means “AGCCTAAGAGAAGCAGGAACA”. MRS1 means “AACATGGGTGGTATGATTGT”. GRS1 means “AACATGGGTGGTATGATTGT”. GRS2 means “AACATGGGTGGTATGACTGT”.
waterfowl should be country-wide vaccination with MDPV and GPV vaccines in China.
Here, we compared a total of 52 NS gene sequences (including 15 MDPVs and 37 GPVs) from GenBank. Primers (GF1, MF1, and MGR1) were designed. NS gene positions 1643 to 1663 of GPVs were chosen to design the GPV-specific forward primer (GF1), which covered 97.30% (36/37) of GPVs with high frequency. NS gene positions 607 to 616 of MDPVs were chosen to design the MDPV-specific forward primer (MF1), which covered 100% (15/15) of MDPVs. In addition, the specific region chosen for GF1 is significantly different from MDPV, and the specific region chosen for MF1 is significantly different from GPV. Additionally, both conserved regions at NS gene positions 1784 to 1803 of MDPVs and GPVs were selected for reverse primer design. After application of the duplex PCR in field samples, we found a 100% coincidence rate when compared with PCR-RFLP and multiple PCR assays, which indicated that the method established in this study is a useful platform for detecting and differentiating MDPV and GPV. A previous study provided evidence that MDPV can be vertically transmitted from breeding Muscovy ducks to their ducklings [17] and GPV can be vertically transmitted from breeding geese to their goslings [30,31], but whether GPV shared the same phenomenon in Muscovy ducks with vertical transmission was unclear. In this study, based on field sample investigation, we found that MDPV and GPV co-infection occurred even in a one-day-old Muscovy duckling. We sequenced the positive fragments to verify the results; these data showed that not only MDPV but also GPV were present in one-day-old Muscovy ducklings. These data provided evidence that GPV may be vertically transmitted in both geese and Muscovy ducks. In conclusion, we report a one-tube duplex PCR assay for the simultaneous detection and differentiation of MDPV and GPV infection, using only three highly specific primers. Our findings suggested
Ethics approval and consent to participate The animal protocol used in this study was approved by the Research Ethics Committee of the College of Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agriculture Sciences (Permit Number FAAS-AHVM2017-18). All ducks were handled in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals approved by the State Council of China.
Competing interests The authors declare that they have no competing interests.
Funding This work was funded by the Natural Science Foundation of China (31602068), China Agriculture Research System (CARS-42), Fujian Academy of Agriculture Science Innovative Research Team Project (STIT2017-3-10) and Young Talent Program Project (YC2015-12), and the Fujian Public Welfare Project (2018R1023-5). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. 4
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
References
1861–1866. [17] C. Wan, C. Chen, L. Cheng, H. Chen, Q. Fu, S. Shi, G. Fu, R. Liu, Y. Huang, Specific detection of Muscovy duck parvovirus infection by TaqMan-based real-time PCR assay, BMC Vet. Res. 14 (2018) 267. [18] C. Wan, L. Cheng, G. Fu, C. Chen, R. Liu, S. Shi, H. Chen, Q. Fu, Y. Huang, Rapid detection of goose hemorrhagic polyomavirus using TaqMan quantitative real-time PCR, Mol. Cell. Probes 39 (2018) 61–64. [19] C. Wan, H. Chen, Q. Fu, S. Shi, G. Fu, L. Cheng, C. Chen, Y. Huang, K. Hu, Development of a restriction length polymorphism combined with direct PCR technique to differentiate goose and Muscovy duck parvoviruses, J. Vet. Med. Sci. 78 (2016) 855–858. [20] P. Sirivan, M. Obayashi, M. Nakamura, U. Tantaswasdi, K. Takehara, Detection of goose and Muscovy duck parvoviruses using polymerase chain reaction-restriction enzyme fragment length polymorphism analysis, Avian Dis. 42 (1998) 133–139. [21] J. Yang, R. Yang, A. Cheng, M. Wang, L. Fu, S. Yang, S. Zhang, L. Yang, Z. Xu, A simple and rapid method for detection of Goose Parvovirus in the field by loopmediated isothermal amplification, Virol. J. 7 (2010) 14. [22] J. Ji, Q. Xie, C. Chen, S. Bai, L. Zou, K. Zuo, Y. Cao, C. Xue, J. Ma, Y. Bi, Molecular detection of Muscovy duck parvovirus by loop-mediated isothermal amplification assay, Poult. Sci. 89 (2010) 477–483. [23] T. Lu, Q. Ma, W. Yan, Y. Wang, Y. Zhang, L. Zhao, H. Chen, Selection of an aptamer against Muscovy duck parvovirus for highly sensitive rapid visual detection by label-free aptasensor, Talanta 176 (2018) 214–220. [24] G. Woźniakowski, E. Samorek-Salamonowicz, W. Kozdruń, Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses, BMC Vet. Res. 8 (2012) 29. [25] J. Wang, J. Wang, Y. Cui, H. Nan, W. Yuan, Development of a taqman-based realtime PCR assay for the rapid and specific detection of novel duck- origin goose parvovirus, Mol. Cell. Probes 34 (2017) 56–58. [26] J. Dong, G. Bingga, M. Sun, L. Li, Z. Liu, C. Zhang, P. Guo, Y. Huang, J. Zhang, Application of high-resolution melting curve analysis for identification of Muscovy duck parvovirus and goose parvovirus, J. Virol. Methods 266 (2019) 121–125. [27] W. Liu, Y. Yang, S. Du, H. Yi, D. Xu, N. Cao, D. Jiang, Y. Huang, Y. Tian, Rapid and sensitive detection of goose parvovirus and duck-origin novel goose parvovirus by recombinase polymerase amplification combined with a vertical flow visualization strip, J. Virol. Methods 266 (2019) 34–40. [28] X. Yu, L. Wei, H. Chen, X. Niu, Y. Dou, J. Yang, Z. Wang, Y. Tang, Y. Diao, Development of colloidal gold-based immunochromatographic assay for rapid detection of goose parvovirus, Front. Microbiol. 9 (2018) 953. [29] T.C. Lorenz, Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies, J. Vis. Exp. 22 (2012) e3998. [30] J. Kisary, Immunological aspects of Derzsy's disease in goslings, Avian Pathol. 6 (1977) 327–334. [31] H. Chen, Y. Tang, Y. Dou, X. Zheng, Y. Diao, Evidence for vertical transmission of novel duck-origin goose parvovirus-related parvovirus, Transbound. Emerg. Dis. 63 (2016) 243–247.
[1] D. Derzsy, A viral disease of goslings. I. Epidemiological, clinical, pathological and aetiological studies, Acta Vet. Acad. Sci. Hung. 17 (1967) 443–448. [2] D. Fang, Introduction of goose plague, Chin. J. Vet. Med. 8 (1962) 19–20 (in Chinese). [3] S. Lin, X. Yu, B. Chen, B. Chen, Diagnosis of a novel viral infectious disease in Muscovy ducklings, Chin. J. Ani. Poult. Infect. Dis. 2 (1991) 27–28 (in Chinese). [4] P.C. Chang, J.H. Shien, M.S. Wang, H.K. Shieh, Phylogenetic analysis of parvoviruses isolated in Taiwan from ducks and geese, Avian Pathol. 29 (2000) 45–49. [5] H. Liu, H. Wang, X. Tian, S. Zhang, X. Zhou, K. Qi, L. Pan, Complete genome sequence of goose parvovirus Y strain isolated from Muscovy ducks in China, Virus Genes 48 (2014) 199–202. [6] Z. Zadori, J. Erdei, J. Nagy, J. Kisary, Characteristics of the genome of goose parvovirus, Avian Pathol. 23 (1994) 359–364. [7] Z. Zádori, R. Stefancsik, T. Rauch, J. Kisary, Analysis of the complete nucleotide sequences of goose and muscovy duck parvoviruses indicates common ancestral origin with adeno-associated virus 2, Virology 212 (1995) 562–573. [8] C. Wan, R. Liu, C. Chen, L. Cheng, S. Shi, G. Fu, H. Chen, Q. Fu, Y. Huang, Novel goose parvovirus in domestic Linwu sheldrakes with short beak and dwarfism syndrome, China. Transbound. Emerg. Dis. (2019), https://doi.org/10.1111/tbed. 13280 [Epub ahead of print]. [9] J.H. Shien, Y.S. Wang, C.H. Chen, H.K. Shieh, C.C. Hu, P.C. Chang, Identification of sequence changes in live attenuated goose parvovirus vaccine strains developed in Asia and Europe, Avian Pathol. 37 (2008) 499–505. [10] J. Wang, Y. Huang, M. Zhou, P.R. Hardwidge, G. Zhu, Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30, Virol. J. 13 (2016) 104. [11] C. Wan, H. Chen, Q. Fu, G. Fu, L. Cheng, S. Shi, Y. Huang, K. Hu, Genomic characterization of goose parvovirus and Muscovy duck parvovirus co-infection in Fujian, China, Kafkas Univ. Vet. Fak. Derg. 21 (2015) 923–928. [12] C.Y. Chu, M.J. Pan, J.T. Cheng, Genetic variation of the nucleocapsid genes of waterfowl parvovirus, J. Vet. Med. Sci. 63 (2001) 1165–1170. [13] C. Li, H. Liu, J. Li, D. Liu, R. Meng, Q. Zhang, W. Shaozhou, X. Bai, T. Zhang, M. Liu, Y. Zhang, A conserved epitope mapped with a monoclonal antibody against the VP3 protein of goose parvovirus by using peptide screening and phage display approaches, PLoS One 11 (2016) e0147361. [14] X. Yin, S. Zhang, Y. Gao, J. Li, S. Tan, H. Liu, X. Wu, Y. Chen, M. Liu, Y. Zhang, Characterization of monoclonal antibodies against waterfowl parvoviruses VP3 protein, Virol. J. 9 (2012) 288. [15] Y. Zhang, Y. Li, M. Liu, D. Zhang, D. Guo, C. Liu, H. Zhi, X. Wang, G. Li, N. Li, S. Liu, W. Xiang, G. Tong, Development and evaluation of a VP3-ELISA for the detection of goose and Muscovy duck parvovirus antibodies, J. Virol. Methods 163 (2010) 405–409. [16] C. Wan, S. Shi, C. Chen, H. Chen, L. Cheng, Q. Fu, G. Fu, R. Liu, Y. Huang, Development of a PCR assay for detection and differentiation of Muscovy duck and goose parvoviruses based on NS gene characterization, J. Vet. Med. Sci. 80 (2018)
5
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
A duplex PCR assay for the simultaneous detection and differentiation of Muscovy duck parvovirus and goose parvovirus
T
Chunhe Wan∗, Longfei Cheng, Cuiteng Chen, Rongchang Liu, Shaohua Shi, Guanghua Fu, Hongmei Chen, Qiuling Fu, Yu Huang∗∗ Fujian Provincial Key Laboratory for Avian Diseases Control and Prevention, Fujian Animal Diseases Control Technology Development Center, Institute of Animal Husbandry and Veterinary Medicine of Fujian Academy of Agricultural Sciences, Fuzhou, 350013, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Muscovy duck parvovirus Goose parvovirus Detection Differentiation Duplex PCR method
Both Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV) can cause high mortality and morbidity in Muscovy ducklings. MDPVs and GPVs share high nucleotide identity, which can cause errors during differential diagnosis. In this study, the NS genes of both MDPVs and GPVs were chosen for the design of specific primers after genetic comparison. Only three primers (GF1, MF1 and MGR1) were designed for the duplex PCR assay: GF1 is specific for GPV only; MF1 is specific for MDPV only; and MGR1 is highly conserved for both MDPV and GPV. After a series of optimization experiments, the duplex PCR assay amplified a 161-bp fragment specifically for GPV, a 1197-bp fragment specifically for MDPV, and two fragments (161-bp and 1197-bp) for both GPV and MDPV. The lowest detection limit was 103 copies/μl. No amplification was obtained using nucleic acids from other pathogens (including DAdV-A, DuCV, DEV, GHPV, R.A., E. coli., P.M. and S.S.) occurring in Muscovy ducks. Application of the duplex PCR assay in field samples showed that even one-day-old Muscovy ducklings were both MDPV-positive and GPV-positive. In conclusion, a duplex PCR assay for the simultaneous detection and differentiation of MDPV and GPV was established using only three highly specific primers. Our finding suggested that country-wide vaccination with MDPV and GPV vaccines in waterfowls are necessary.
1. Introduction Goose parvovirus (GPV) infection, also known as Derzsy's disease in Europe [1], was first described by Professor Fang in the early 1960s in China [2]. Muscovy duck parvovirus (MDPV) infection was first reported by Professor Lin in the early 1990s in our laboratory in southeast China [3]. Normally, GPV can cause fatal diseases to goslings and Muscovy ducklings less than one month old. However, unlike GPV, MDPV causes a fatal disease in Muscovy ducklings [4,5]. GPVs and MDPVs have linear, single-stranded DNA genomes that are approximately 5000 nucleotides in length. The GPV and MDPV genomes can be divided into two major open reading frames (ORFs): the left ORF encodes a non-structural (NS) protein, which is required in viral regulatory functions, and the right ORF encodes three capsid proteins (VP1, VP2, and VP3), which are critical determinants for viral tropism, antigenicity and the biological properties of GPVs and MDPVs. Moreover, the entire sequences of VP2 and VP3 share the same C-terminus, which are derived from VP1 by different alternative splicing of mRNA [6–10]. ∗
Reportedly, genomic comparison between GPVs and MDPVs revealed that they share 79.6%–85.0% nucleotide similarity at the genome level [6,7,11]. In addition, immunological cross-reactivity was observed between GPVs and MDPVs [12–15]. Therefore, the risk of erroneous results is increased for the detection and differentiation of GPVs and MDPVs, especially in Muscovy ducklings. A previous study demonstrated that the NS genes of MDPVs shared a separate MDPV cluster, whereas the NS genes of GPVs shared a significantly different and separate GPV cluster after phylogenetic analysis. The nucleotide sequence identity was more than (or equal to) 98.1% within the MDPV cluster and more than (or equal to) 93.3% within the GPV cluster. In addition, the nucleotide homology of NS genes between the MDPV cluster and GPV cluster ranged from 80.8% to 83.4% [16,17]. Therefore, NS genes are suitable candidate regions for designing PCR primers for the detection and differentiation of GPVs and MDPVs.
Corresponding author. Xi-feng Road No.100, Jiantian village, Jin'an district, Fuzhou city, 350013, China. Corresponding author. Xi-feng Road No.100, Jiantian village, Jin'an district, Fuzhou city, 350013, China. E-mail addresses: [email protected] (C. Wan), [email protected] (Y. Huang).
∗∗
https://doi.org/10.1016/j.mcp.2019.101439 Received 4 July 2019; Received in revised form 8 August 2019; Accepted 20 August 2019 Available online 21 August 2019 0890-8508/ © 2019 Elsevier Ltd. All rights reserved.
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
Table 1 Sequence variation in multiple sequence alignments. Primers GF1
Type
Sequences (5’→3′)
Synthesized GPVA1
MDPV
MF1
MGR1 (Reverse)
AGCCTAAGAGAAGCARGAACA AGCCTAAGAGAAGCAGGAACA AGCCTAAGAGAAGCAAGAACA AGCCTAAAAGAAGCAGGAACA AGAGAAAGAAAACCCGTGGGG AGAGAAAGAAAACCCGTCGGG AGAGAAAGAAAACTCGTGGGG AATGCTGTAGTGCAGGAGGA D1 AATGCTGTAGTGCAGGAGGA GCCGCCCCTTTACCTGATCC GCTGCCCCTTTACCTGATCC GCAGCCCCTTTACCTGATCC GCTGCCCCTTTACCCGATCC ACAATCATACCACCCATGTT D1 AACATGGGTGGTATGATTGT AACATGGGTGGTATGATTGT AACATGGGTGGTATGGTTGT AACATGGGTGGTATGATTGT AACATGGGTGGTATGACTGT
A2
Synthesized MDPV B1 GPV B2
Synthesized (Reverse) MDPV GPV
Frequency D1
C1
C1
59.46% (22/37) 37.84% (14/37) 2.70% (1/37) 66.67% (10/15) 26.67% (4/15) 6.67% (1/15) 100%% (15/15) 18.92% (7/37) 43.24% (16/37) 2.70% (1/37) 35.14% (13/37)
93.33% (14/15) 6.67% (1/15) 81.08% (30/37) 18.92% (7/37)
A1
The variation is indicated in bold and underlined. The variation in the 3′-terminal is indicated with in a box. B1 The synthesized primers are 100% matched with MDPVs. B2 The variation in the 3′-terminal in indicated in a box. C1 The synthesized primers are highly conserved at the 3′-terminus of both GPVs and MDPVs. D1 The synthesized primers marked as italics type. A2
2. Methods
30 s, and 72 °C for 45 s. The PCR products were electrophoresed in a 1.0% agarose gel.
2.1. Primer selection and design 2.4. Specificity analysis
On the basis of the sequence alignments of GPV (37 isolates) and MDPV (15 isolates) [16,17]. NS genes retrieved from GenBank (http:// www.ncbi.nlm.nih.gov), three primers (MF1, GF1, and MGR1, see Table 1) located within the NS regions of GPV and MDPV were selected with Primer Analysis Software Oligo 7. MF1 was selected specifically for MDPV only, GF1 was selected specifically for GPV only, and MGR1 was selected for both MDPV and GPV. All primers (GF1, MF1, and MGR1) were synthesized by a commercial company (Sangon, Shanghai, China).
GPV, MDPV, DAdV-A, DuCV, DEV, GHPV, R.A., E. coli., P.M. and S.S. were used to determine the specificity of the duplex PCR. The PCR products were electrophoresed in a 1.0% agarose gel. Genomic DNA extracted from healthy Muscovy duck samples (liver) and nuclease-free water were used as negative controls in the PCR assay.
2.5. Sensitivity analysis 2.2. Preparation of viral DNAs and bacterial DNAs The limit of detection (LOD) of the duplex PCR assay was evaluated using serial ten-fold dilutions of previously cloned pT–NS–GPV and pT–NS–MDPV [11]. The plasmid DNA (pT–NS–GPV and pT–NS–MDPV) was quantified at 260-nm using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). A total of 1 μl of plasmid DNA from 106 to 101 copies/μl of each plasmid DNA was used to determine the sensitivity of the duplex PCR.
Viral DNAs [e.g., GPV, MDPV, Duck adenovirus A (DAdV-A), Duck circovirus (DuCV), duck enteritis virus (DEV), and duck origin-goose haemorrhagic polyomavirus (GHPV) [18]] were extracted with the EasyPure Genomic DNA Kit (TransGen Biotech, Beijing, China). Bacterial genomic DNAs [e.g., Riemerella anatipestifer (R.A.), Escherichia coli (E. coli.), Pasteurella multocida (P.M.) and Salmonella spp. (S.S.)] were extracted with the EasyPure Bacteria Genomic DNA Kit (TransGen Biotech). DNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific, MA, USA) and then stored at −80 °C until use.
2.6. Clinical samples application Sixteen individual Muscovy ducklings (less than three weeks old) and nine individual goslings (less than four weeks old) samples (livers) were collected from the Poultry Disease Treatment Center, Department of the Institute of Animal Husbandry and Veterinary Medicine of Fujian Academy of Agricultural Sciences. Each tissue was quantitatively weighed (0.1 g) to extract DNA using the EasyPure Genomic DNA Kit according to the manufacturer's instructions. Positive fragments were harvested, purified, T-A cloned and sequenced at Sangon (Shanghai, China). Meanwhile, PCR-RFLP [19] and multiple PCR methods [16], which were developed by our laboratory, were used simultaneously for detection.
2.3. Duplex PCR protocol optimization The duplex PCR assay was optimized and validated with a TaKaRa PCR Thermal Cycler Dice™ Gradient (OTSU, SHIGA, Japan). Different concentrations of the primers (GF1, MF1, and MGR1) were prepared in the reaction tubes to optimize the assay. The concentrations of the reaction mixture were applied as follows: 25 μl DreamTaq Green PCR Master Mix (2 × ) (Thermo Fisher Scientific), 0.8 μl GF1 (10 μmol/l), 0.4 μl MF1 (10 μmol/l), 1.5 μl MGR1 (10 μmol/l), 1 μl DNA template, and then nuclease-free water was used to adjust the total reaction volume (total reaction volume of 50 μl). The following thermo profile was set: 1 cycle of 95 °C for 3 min and 30 cycles of 95 °C for 30 s, 55 °C for 2
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
3. Results 3.1. Primers analysis For the GPV-specific forward primer GF1, the sequence of 59.46% (22/37) of the GPV genomes is “AGCCTAAGAGAAGCAGGAACA” and 37.84% (14/37) of the GPV genomes is “AGCCTAAGAGAA GCAAGAACA”; thus, we used R (R = A/G) and synthesized “AGCCTAAGAGAAGCARGAACA”, which covered the highest number (36/37) of GPVs. In addition, at these positions, the MDPV sequences are significantly different from the GPV sequences at the 3′-terminus. For the MDPV-specific forward primer MF1, the sequence of 100% (15/15) of the MDPV genomes is “AATGCTGTAGTGCAGGAGGA”. In addition, at these positions, the GPV sequences are significantly different from the MDPV sequences at the 3′-terminus. These data demonstrated that primer GF1 is specific for GPV only, and primer MF1 is specific for MDPV only. For the reverse primer MGR1, both MDPVs and GPVs are conserved at the 3′-terminus of the designed regions, and the primers variations of GF1 and MF1 and MGR1 are listed in Table 1.
Fig. 2. The sensitivity of duplex PCR assay for the simultaneous detection and differentiation of GPV and MDPV. Lane M, DNA marker DL2000; The assay was performed using 106 copies (lane 1), 105 copies (lane 2), 104 copies (lane 3), 103 copies (lane 4), 102copies (lane 5), 101 copies (lane 6).
3.2. Duplex PCR assay Using these three primers, the duplex PCR amplified a 161-bp fragment specifically for GPV, a 1197-bp fragment specifically for MDPV, and two fragments (161-bp and 1197-bp) for both GPV and MDPV (Fig. 1). For specificity analysis, no amplification occurred using the nucleic acids from other duck pathogens (DAdV-A, DuCV, DEV, GHPV, R.A., E. coli., P.M. and S.S.) or the negative control under the same conditions (Fig. 1). Using 106 to 101 copies of the plasmid DNA of GPV and MDPV as templates, the detection reaction limit of the duplex PCR assay was assessed at 103 copies/μl (Fig. 2).
from ducklings) MDPV-positive samples at the 5′-terminus were “AGC CTAAGAGAAGCAGGAACA” (abbreviated as MFS1). With the primer GF1, 11 GPV-positive (5 from ducklings and 6 from goslings) samples at the 5′-terminus were “AGCCTAAGAGAAGCAGGAACA” (abbreviated as GFS1). With the primer MGR1, all MDPV-positive samples at the 3′terminus were “AACATGGGTGGTATGATTGT” (abbreviated as MRS1); 10/11 (90.91%) GPV-positive samples at the 3′-terminus were “AACA TGGGTGGTATGATTGT” (abbreviated as GRS1); 1/11 (9.09%) GPVpositive samples at the 3′-terminus was “AACATGGGTGGTATGACTGT” (abbreviated as GRS2).
3.3. Clinical samples application
4. Discussion
As summarized in Table 2, for Muscovy ducklings, the results demonstrated that 6/16 (37.5%) samples (aged from 1 to 20 days) tested positive for MDPV, 3/16 (18.75%) samples (aged from 9 to 15 days) tested positive for GPV, and 2/16 (12.5%) samples (aged 12 days and 17 days) tested positive for both GPV and MDPV. For goslings, 6/9 (66.67%) samples (aged from 1 to 25 days) tested positive for GPV; no MDPV-positive goslings were identified. All positive fragments in this study were harvested and purified (Gel Extraction Kit, OMEGA Bio-tek, Guangzhou, China), T-A cloned (pEASY-T1 Simple Cloning Kit, TransGen Biotech, Beijing, China), and then confirmed using the Sanger sequencing method in both directions (Sangon, Shanghai, China). With the primer MF1, the sequences of 8 (8
It is difficult to make a specific and differential diagnosis of MDPV infection and GPV infection because of high nucleotide identity and immunological cross-reactivity, especially in Muscovy ducklings. Several diagnostic methods have been employed for the detection or differentiation of MDPV and GPV, including PCR combined with restriction fragment length polymorphism (PCR-RFLP) [19,20], multiple PCR [16], loop-mediated isothermal amplification (LAMP) [21,22], aptamer-based label-free aptasensor [23], real-time fluorescent quantitative PCR [17,24–26], recombinase polymerase amplification combined with a vertical flow visualization strip [27], and colloidal goldbased immunochromatographic assay [28]. Polymerase chain reaction (PCR) is a powerful amplification technology that can generate an ample supply of a specific segment of DNA from only a small amount of starting material (i.e., DNA template or target sequence), which has become an indispensable tool in virus detection and differentiation. Designing appropriate primers is essential to the successful outcome of a PCR assay [29]. Due to the lack of complete genomic sequence comparison data of MDPV and GPV, especially MDPV sequences, errors may occur if designing a set of primers to an unsuitable region of genomic sequences. Our previous study showed that the NS genes of MDPVs and GPVs were suitable for virus classification and were also suitable for designing specific primers for developing differential diagnoses of MDPV infection and GPV infection, such as PCR-RFLP and multiple PCR. However, PCR-RFLP requires another EcoR I digestion reaction after PCR amplification, and multiple PCR requires two-tube PCRs (one for MDPV and the other for GPV). These methods showed excellent specificity, sensitivity and repeatability, but neither of them can provide simultaneous detection and differentiation for MDPV and GPV co-infection within one reaction in a tube.
Fig. 1. The specificity of duplex PCR assay for the simultaneous detection and differentiation of GPV and MDPV. Lane M, DNA marker DL2000; lane 1, GPV; lane 2,MDPV; lane 3, GPV and MDPV mixed DNA; lane 4, DAdV-A; lane 5, DuCV; lane 6, DEV; lane 7, GHPV; lane 8, R.A.; lane 9, E. coli.; lane 10, P.M.; lane 11, S.S.; lane 12, negative control (healthy liver); lane 13, negative control (Nuclease-free water). 3
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
Table 2 Comparison of the results of clinical samples from the duplex PCR assay in this study and the PCR-RFLP and multiple PCR methods. Host
Age (/d)
duplex PCR A
Md1 Md2 Md3 Md4 Md5 Md6 Md7 Md8 Md9 Md10 Md11 Md12 Md13 Md14 Md15 Md16 Gs1 Gs2 Gs3 Gs4 Gs5 Gs6 Gs7 Gs8 Gs9
1 3 4 7 9 9 9 11 11 11 12 14 15 15 17 20 1 2 4 7 15 15 19 21 25
PCR-RFLP
M
B
A
G
M
+ + – + – – – – – + + – – + + + – – – – – – – – –
+ – – – + – – + – – – – + – + – + + – + – – + + +
+ + – + – – – – – + + – – + + + – – – – – – – – –
Multiple PCR B
M
G
+ – – – + – – + – – – – + – + – + + – + – – + + +
+ + – + – – – – – + + – – + + + – – – – – – – – –
+ – – – + – – + – – – – + – + – + + – + – – + + +
G
A
Forward sequences
Reverse sequences
MFS1and GFS1 MFS1 / MFS1 GFS1 / / GFS1 / MFS1 MFS1 / GFS1 MFS1 MFS1and GFS1 MFS1 GFS1 GFS1 / GFS1 / / GFS1 GFS1 GFS1
MRS1 and GRS1 MRS1 / MRS1 GRS1 / / GRS1 / MRS1 MRS1 / GRS2 MRS1 MRS1 and GRS1 MRS1 GRS1 GRS1 / GRS1 / / GRS1 GRS1 GRS1
B
Md means Muscovy duckling origin samples, Gs means goose origin samples. MA indicates MDPV; + indicates positive; - indicates negative. GB indicates GPV; + indicates positive; - indicates negative. /indicates no sequence for the negative samples. MFS1 means “AGCCTAAGAGAAGCAGGAACA”. GFS1 means “AGCCTAAGAGAAGCAGGAACA”. MRS1 means “AACATGGGTGGTATGATTGT”. GRS1 means “AACATGGGTGGTATGATTGT”. GRS2 means “AACATGGGTGGTATGACTGT”.
waterfowl should be country-wide vaccination with MDPV and GPV vaccines in China.
Here, we compared a total of 52 NS gene sequences (including 15 MDPVs and 37 GPVs) from GenBank. Primers (GF1, MF1, and MGR1) were designed. NS gene positions 1643 to 1663 of GPVs were chosen to design the GPV-specific forward primer (GF1), which covered 97.30% (36/37) of GPVs with high frequency. NS gene positions 607 to 616 of MDPVs were chosen to design the MDPV-specific forward primer (MF1), which covered 100% (15/15) of MDPVs. In addition, the specific region chosen for GF1 is significantly different from MDPV, and the specific region chosen for MF1 is significantly different from GPV. Additionally, both conserved regions at NS gene positions 1784 to 1803 of MDPVs and GPVs were selected for reverse primer design. After application of the duplex PCR in field samples, we found a 100% coincidence rate when compared with PCR-RFLP and multiple PCR assays, which indicated that the method established in this study is a useful platform for detecting and differentiating MDPV and GPV. A previous study provided evidence that MDPV can be vertically transmitted from breeding Muscovy ducks to their ducklings [17] and GPV can be vertically transmitted from breeding geese to their goslings [30,31], but whether GPV shared the same phenomenon in Muscovy ducks with vertical transmission was unclear. In this study, based on field sample investigation, we found that MDPV and GPV co-infection occurred even in a one-day-old Muscovy duckling. We sequenced the positive fragments to verify the results; these data showed that not only MDPV but also GPV were present in one-day-old Muscovy ducklings. These data provided evidence that GPV may be vertically transmitted in both geese and Muscovy ducks. In conclusion, we report a one-tube duplex PCR assay for the simultaneous detection and differentiation of MDPV and GPV infection, using only three highly specific primers. Our findings suggested
Ethics approval and consent to participate The animal protocol used in this study was approved by the Research Ethics Committee of the College of Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agriculture Sciences (Permit Number FAAS-AHVM2017-18). All ducks were handled in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals approved by the State Council of China.
Competing interests The authors declare that they have no competing interests.
Funding This work was funded by the Natural Science Foundation of China (31602068), China Agriculture Research System (CARS-42), Fujian Academy of Agriculture Science Innovative Research Team Project (STIT2017-3-10) and Young Talent Program Project (YC2015-12), and the Fujian Public Welfare Project (2018R1023-5). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. 4
Molecular and Cellular Probes 47 (2019) 101439
C. Wan, et al.
References
1861–1866. [17] C. Wan, C. Chen, L. Cheng, H. Chen, Q. Fu, S. Shi, G. Fu, R. Liu, Y. Huang, Specific detection of Muscovy duck parvovirus infection by TaqMan-based real-time PCR assay, BMC Vet. Res. 14 (2018) 267. [18] C. Wan, L. Cheng, G. Fu, C. Chen, R. Liu, S. Shi, H. Chen, Q. Fu, Y. Huang, Rapid detection of goose hemorrhagic polyomavirus using TaqMan quantitative real-time PCR, Mol. Cell. Probes 39 (2018) 61–64. [19] C. Wan, H. Chen, Q. Fu, S. Shi, G. Fu, L. Cheng, C. Chen, Y. Huang, K. Hu, Development of a restriction length polymorphism combined with direct PCR technique to differentiate goose and Muscovy duck parvoviruses, J. Vet. Med. Sci. 78 (2016) 855–858. [20] P. Sirivan, M. Obayashi, M. Nakamura, U. Tantaswasdi, K. Takehara, Detection of goose and Muscovy duck parvoviruses using polymerase chain reaction-restriction enzyme fragment length polymorphism analysis, Avian Dis. 42 (1998) 133–139. [21] J. Yang, R. Yang, A. Cheng, M. Wang, L. Fu, S. Yang, S. Zhang, L. Yang, Z. Xu, A simple and rapid method for detection of Goose Parvovirus in the field by loopmediated isothermal amplification, Virol. J. 7 (2010) 14. [22] J. Ji, Q. Xie, C. Chen, S. Bai, L. Zou, K. Zuo, Y. Cao, C. Xue, J. Ma, Y. Bi, Molecular detection of Muscovy duck parvovirus by loop-mediated isothermal amplification assay, Poult. Sci. 89 (2010) 477–483. [23] T. Lu, Q. Ma, W. Yan, Y. Wang, Y. Zhang, L. Zhao, H. Chen, Selection of an aptamer against Muscovy duck parvovirus for highly sensitive rapid visual detection by label-free aptasensor, Talanta 176 (2018) 214–220. [24] G. Woźniakowski, E. Samorek-Salamonowicz, W. Kozdruń, Quantitative analysis of waterfowl parvoviruses in geese and Muscovy ducks by real-time polymerase chain reaction: correlation between age, clinical symptoms and DNA copy number of waterfowl parvoviruses, BMC Vet. Res. 8 (2012) 29. [25] J. Wang, J. Wang, Y. Cui, H. Nan, W. Yuan, Development of a taqman-based realtime PCR assay for the rapid and specific detection of novel duck- origin goose parvovirus, Mol. Cell. Probes 34 (2017) 56–58. [26] J. Dong, G. Bingga, M. Sun, L. Li, Z. Liu, C. Zhang, P. Guo, Y. Huang, J. Zhang, Application of high-resolution melting curve analysis for identification of Muscovy duck parvovirus and goose parvovirus, J. Virol. Methods 266 (2019) 121–125. [27] W. Liu, Y. Yang, S. Du, H. Yi, D. Xu, N. Cao, D. Jiang, Y. Huang, Y. Tian, Rapid and sensitive detection of goose parvovirus and duck-origin novel goose parvovirus by recombinase polymerase amplification combined with a vertical flow visualization strip, J. Virol. Methods 266 (2019) 34–40. [28] X. Yu, L. Wei, H. Chen, X. Niu, Y. Dou, J. Yang, Z. Wang, Y. Tang, Y. Diao, Development of colloidal gold-based immunochromatographic assay for rapid detection of goose parvovirus, Front. Microbiol. 9 (2018) 953. [29] T.C. Lorenz, Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies, J. Vis. Exp. 22 (2012) e3998. [30] J. Kisary, Immunological aspects of Derzsy's disease in goslings, Avian Pathol. 6 (1977) 327–334. [31] H. Chen, Y. Tang, Y. Dou, X. Zheng, Y. Diao, Evidence for vertical transmission of novel duck-origin goose parvovirus-related parvovirus, Transbound. Emerg. Dis. 63 (2016) 243–247.
[1] D. Derzsy, A viral disease of goslings. I. Epidemiological, clinical, pathological and aetiological studies, Acta Vet. Acad. Sci. Hung. 17 (1967) 443–448. [2] D. Fang, Introduction of goose plague, Chin. J. Vet. Med. 8 (1962) 19–20 (in Chinese). [3] S. Lin, X. Yu, B. Chen, B. Chen, Diagnosis of a novel viral infectious disease in Muscovy ducklings, Chin. J. Ani. Poult. Infect. Dis. 2 (1991) 27–28 (in Chinese). [4] P.C. Chang, J.H. Shien, M.S. Wang, H.K. Shieh, Phylogenetic analysis of parvoviruses isolated in Taiwan from ducks and geese, Avian Pathol. 29 (2000) 45–49. [5] H. Liu, H. Wang, X. Tian, S. Zhang, X. Zhou, K. Qi, L. Pan, Complete genome sequence of goose parvovirus Y strain isolated from Muscovy ducks in China, Virus Genes 48 (2014) 199–202. [6] Z. Zadori, J. Erdei, J. Nagy, J. Kisary, Characteristics of the genome of goose parvovirus, Avian Pathol. 23 (1994) 359–364. [7] Z. Zádori, R. Stefancsik, T. Rauch, J. Kisary, Analysis of the complete nucleotide sequences of goose and muscovy duck parvoviruses indicates common ancestral origin with adeno-associated virus 2, Virology 212 (1995) 562–573. [8] C. Wan, R. Liu, C. Chen, L. Cheng, S. Shi, G. Fu, H. Chen, Q. Fu, Y. Huang, Novel goose parvovirus in domestic Linwu sheldrakes with short beak and dwarfism syndrome, China. Transbound. Emerg. Dis. (2019), https://doi.org/10.1111/tbed. 13280 [Epub ahead of print]. [9] J.H. Shien, Y.S. Wang, C.H. Chen, H.K. Shieh, C.C. Hu, P.C. Chang, Identification of sequence changes in live attenuated goose parvovirus vaccine strains developed in Asia and Europe, Avian Pathol. 37 (2008) 499–505. [10] J. Wang, Y. Huang, M. Zhou, P.R. Hardwidge, G. Zhu, Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30, Virol. J. 13 (2016) 104. [11] C. Wan, H. Chen, Q. Fu, G. Fu, L. Cheng, S. Shi, Y. Huang, K. Hu, Genomic characterization of goose parvovirus and Muscovy duck parvovirus co-infection in Fujian, China, Kafkas Univ. Vet. Fak. Derg. 21 (2015) 923–928. [12] C.Y. Chu, M.J. Pan, J.T. Cheng, Genetic variation of the nucleocapsid genes of waterfowl parvovirus, J. Vet. Med. Sci. 63 (2001) 1165–1170. [13] C. Li, H. Liu, J. Li, D. Liu, R. Meng, Q. Zhang, W. Shaozhou, X. Bai, T. Zhang, M. Liu, Y. Zhang, A conserved epitope mapped with a monoclonal antibody against the VP3 protein of goose parvovirus by using peptide screening and phage display approaches, PLoS One 11 (2016) e0147361. [14] X. Yin, S. Zhang, Y. Gao, J. Li, S. Tan, H. Liu, X. Wu, Y. Chen, M. Liu, Y. Zhang, Characterization of monoclonal antibodies against waterfowl parvoviruses VP3 protein, Virol. J. 9 (2012) 288. [15] Y. Zhang, Y. Li, M. Liu, D. Zhang, D. Guo, C. Liu, H. Zhi, X. Wang, G. Li, N. Li, S. Liu, W. Xiang, G. Tong, Development and evaluation of a VP3-ELISA for the detection of goose and Muscovy duck parvovirus antibodies, J. Virol. Methods 163 (2010) 405–409. [16] C. Wan, S. Shi, C. Chen, H. Chen, L. Cheng, Q. Fu, G. Fu, R. Liu, Y. Huang, Development of a PCR assay for detection and differentiation of Muscovy duck and goose parvoviruses based on NS gene characterization, J. Vet. Med. Sci. 80 (2018)
5