- Email: [email protected]
A family with a tau P301L mutation presenting with parkinsonism
Parkinsonism & Related Disorders Parkinsonism and Related Disorders 9 (2002) 121±123
www.elsevier.com/locate/parkreldis
Case report
A family with a tau P301L mutation presenting with parkinsonism Ruth H. Walker a,b, Joseph Friedman c,d, Jill Wiener a, Ronald Hobler e, Katrina Gwinn-Hardy f, Amanda Adam f, Jennifer DeWolfe g, Rebecca Gibbs g, Matt Baker g, Matt Farrer g, Mike Hutton g, John Hardy g,* a
Department of Neurology, Bronx VA Medical Center, Bronx, NY 10468, USA b Mount Sinai School of Medicine NY 10029, USA c Department of Clinical Neuroscience, Brown University Medical School, Providence, RI, USA d Division of Neurology, Memorial Hospital of Rhode Island, 111 Brewster Street, Pawtucket, RI 02860, USA e Department of Psychology, VA Hudson Valley Healthcare System, Castle Point, NY 12511, USA f Laboratory of Neurogenetics, NINDS, Bethesda, MD 20892, USA g Laboratories of Neurogenetics, Department of Neuroscience, Mayo Clinic Jacksonville, FL 32224, USA Received 24 September 2001; revised 26 November 2001; accepted 10 December 2001
Abstract We report a sib-pair with a tau P301L mutation. Unlike most previous cases with this mutation, parkinsonism, rather than dementing features were the predominant and presenting feature. We have also observed that the P301L mutation has occurred on the H1 tau haplotype background. The haplotype background may in¯uence the disease phenotype since in many previous Caucasian families with the P301L mutation, the haplotype background has been H2. q 2002 Elsevier Science Ltd. All rights reserved. Keywords: Genetics; Parkinsonism; Progressive supranuclear palsy; Dementia; Tau
Mutations in the tau gene cause frontal temporal dementia with parkinsonism linked to chromosome 17 (FTDP-17) [1,2]. As the name of this disorder suggests, individuals with this disease can have dementia and/or parkinsonian features: indeed the clinical presentations of this disease are extremely variable [3]. Undoubtedly, the speci®c mutation in each family greatly in¯uences the clinical presentation, although the reason for this remains unclear. For example, the N279K mutation presents with pronounced parkinsonism [4], whereas, the R406W mutation presents with dementia [5]. Classically, the most common mutation, P301L has a phenotype in which dementia is the predominant feature [6,7]. During our assessment of the respective in¯uence of tau mutations familial dementia and parkinsonism, we have identi®ed a family with a predominantly parkinsonian phenotype which has a P301L mutation: here we discuss the clinical and molecular ®ndings in this family.
* Corresponding author. Tel.: 11-904-9537-356; fax: 11-904-9537-370. E-mail address: [email protected] (J. Hardy).
1. Family and methods The proband and his sister of Northern European extraction, were noted to have developed progressive parkinsonism in the sixth decade. Another sister remained unaffected. In the brother, tau exons 7 and 9±13 were ampli®ed by polymerase chain reaction (PCR) with primers we have previously described [2] and sequenced using the same primers and Big Dye chemistry (Perkin Elmer). The genotypes of the tau polymorphisms found in exons 7, 9 and 11 were determined by analysis of the sequence data. The tau haplotype was con®rmed by PCR ampli®cation over the insertion/deletion polymorphism in intron 9. It is possible to determine on which haplotype the P301L mutation occurs by PCR/RFLP haplotyping. Forward primer GGAAGACGTTCTCACTGATCTG and reverse primer GTACGACTCACACCACTTCC generate 2 haplotype speci®c products, 1187 bp (H1) and 949 bp (H2), that span both the mutation site and the insertion/deletion polymorphism. As the wild type allele contains a unique SmaI site, digestion of these products with Sma I reveals the presence of the mutation.
1353-8020/02/$ - see front matter q 2002 Elsevier Science Ltd. All rights reserved. PII: S 1353-802 0(02)00003-2
122
R.H. Walker et al. / Parkinsonism and Related Disorders 9 (2002) 121±123
1.1. Case 1 The proband presented at age 57 years with a 6 month history of dysarthric, slowed speech, and pre-syncope. His past medical and social histories was not signi®cant. His mother died of chronic obstructive pulmonary disease at age 55 and his father of a cerebral hemorrhage at age 62 years. Two maternal great aunts were reported to have suffered from dementing illnesses. On initial examination he was found to have mild bradyphrenia and impairment of verbal processing, generalized bradykinesia, masked facies, positive glabellar re¯ex, mild dysarthria (slurred and scanning speech), and mild postural and intention tremor. Autonomic testing revealed mildly abnormal cardiovascular re¯exes with initial hypotension and spontaneous recovery with prolonged passive head up tilt. At age 59 years, the patient complained of memory problems, with loss of shortterm memory. He had worsening dysarthria and occasional aspiration, and frequent falls. He was noted on examination to be disinhibited. Neuropsychological evaluation revealed psychomotor slowing, severe de®cits in verbal ¯uency, mildly impaired speech and memory recall, with intact global cognitive, visuospatial and behavioral functions, suggesting predominantly subcortical involvement with possible frontal and temporal involvement. He had dif®culty with saccade initiation, especially on upgaze. There was generalized moderate to severe bradykinesia, and speech was extremely dysarthric. Rapid alternating movements were more impaired on the right than the left. There was a bilateral, ®ne, irregular postural and activation tremor. His posture was moderately stooped, with severe impairment of postural re¯exes. Deep tendon re¯exes were symmetric and brisk with equivocal Babinski signs. Within the next 6 months, the patient became aggressive, and was admitted for behavioral problems including episodes of rage and destructiveness. He had undergone a trial of carbidopa/ levodopa 25/100 three times a day, with limited responsiveness, and it was discontinued after an episode of confusion. An MRI scan performed two years after symptom onset revealed moderate generalized cerebral atrophy. His diagnosis was that of multi-system atrophy versus progressive supranuclear palsy. 1.2. Case 2 The proband's affected sister was well until the age of 57 years when she complained of memory dysfunction. In retrospect, the patient felt that her memory had been worsening for the previous seven years, or even earlier, following a hysterectomy. However, her Folstein MiniMental status examination was 29/30 at the time or presentation. She had marked parkinsonism on examination. A trial of carbidopa/levodopa was undertaken, and mild responsiveness, especially for the shuf¯ing gait, absent arm swing, and rigidity were noted. The muscles in her face trembled when she smiled, but otherwise, had no
tremor. On physical examination ®ve years later, the patient was noted to be alert, attentive, and anxious. She was oriented, able to register three objects but recalled only two, was able to name the President's wife but not his name. She had marked dysnomia, being unable to name knuckles, collar, or lapel. She had dif®culty in drawing a clock. She was noted to have moderate masked facies, no resting or action tremor, with mild slowness of rapid alternating movements on the right but not the left. There was increased tone in the right arm. Deep tendon re¯exes were normal as were balance and gait. The diagnoses of Diffuse Lewy body disease and `PSP-dementia' were the working clinical diagnoses. 2. Results and discussion Sequencing the tau gene revealed a C to T change at codon 301 in exon 10 causing a proline to leucine change at codon 301 (P301L). In addition, both sibs were H1 homozygotes [8]. The P301L mutation has been found in many previous families with FTDP-17 [2,5,7,9±12] and is thus undoubtedly pathogenic. However, it is usually associated with a dementia phenotype (ibid) and is not usually associated with a parkinsonism phenotype similar to that we report here. The exception is the report by Bird and colleagues [7] who reported detailed characterization of three families with a P301L mutation, two with a largely dementia phenotype and one with a phenotype similar to that described here and a Japanese family with a P301S mutation with a similar phenotype has also been reported [13]. In our and other's sequencing of the tau gene [8,14] we have noted that there are two distinct human tau haplotype families, H1 and H2, which occur at allele frequencies of ,70 and 30% in most Caucasian populations [8]. In the previous cases when the P301L mutation has been reported in Caucasians and in which phase information is known [2,5,6,9,10,12], the P301L mutation has occurred on the H2 haplotype: however, in this family, both sibs are H1 homozygotes. Thus, an intriguing possibility is that the mutation haplotype background can in¯uence the phenotype with the H1 haplotype favoring a parkinsonian phenotype and an H2 haplotype favoring a dementia phenotype. In this respect it is interesting that H1 homozygosity predisposes to progressive supranuclear palsy [8] and H2 homozygosity may occur more frequently in pathologically con®rmed Pick's disease [15]. Although we favor this explanation for our observations, it clearly is not the whole story, since in Asian populations, the H1 haplotype has a greater than 95% allele frequency (unpublished data) and yet both P301L mutations from this racial group had dementia as a presenting feature [10,12] although the report of the P301S mutation from this population had a phenotype similar to that reported here [13]. We suggest a full description of the genotype/phenotype correlations concerning the tau gene mutations should include analysis of the tau haplotype background on which
R.H. Walker et al. / Parkinsonism and Related Disorders 9 (2002) 121±123
123
Table 1 Clinical features
Age of symptom onset (years) Presenting symptom Eye movement abnormalities Resting tremor Activation/postural tremor Rigidity Postural instability Asymmetry Bradykinesis Gait dif®culties Dysinhibition Memory abnormality Dysautonomia Dopamine responsiveness
201-1
201-3
55±57 Dysarthria, bradykinesia Present Absent Present Present Present Present Present Present Present, late in course Present, later in course Present, mild Present, mild
50±57 Memory dif®culties Absent Absent Absent Present Present Present Present Present Absent Present, early in course Absent Present, mild
the mutation has occurred, as is the case for prion mutation cases [16,17]. Finally, it has to be of concern that a recent genome screen for `Parkinson's disease' identi®ed tau as a locus [18,19]: given the clinical features of tau mutations can include parkinsonism [20], one has to be concerned that this genome screen was contaminated by families similar to this one, which will presumably be caused by tau, rather that synuclein pathology (Table 1). Acknowledgements We thank the family for their enthusiasm for this work. This work was supported by an NIH/NIA Program Project Grant (MH, JH) and the Mayo Foundation. References [1] Poorkaj P, Bird TD, Wijsman E, Nemens E, Garruto RM, Anderson L, et al. Tau is a candidate gene for chromosome 17 frontotemporal dementia. Ann Neurol 1998;43:815±25. [2] Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, et al. Association of missense and 5 0 -splice-site mutations in tau with the inherited dementia FTDP-17. Nature 1998;393:702±5. [3] Foster NL, Wilhelmsen K, Sima AA, Jones MZ, D'Amato CJ, Gilman S. Frontotemporal dementia and parkinsonism linked to chromosome 17: a consensus conference. Ann Neurol 1997;41:706±15. [4] Clark LN, Poorkaj P, Wszolek Z, Geschwind DH, Nasreddins ZS, Miller B, et al. Pathogenic implications of mutations in the tau gene in pallido-ponto-nigral degeneration and related neurodegenerative disorders linked to chromosome 17. Proc Natl Acad Sci USA 1998;95:13103±7. [5] Houlden H, Baker M, Adamson J, Grover A, Waring S, Dickson D, et al. Frequency of tau mutations in three series of non-Alzheimer's degenerative dementia. Ann Neurol 1999;46:243±8. [6] Dumanchin C, Camuzat A, Campion D, Verpillat P, Hannequin D, Dubois B, et al. Segregation of a missense mutation in the microtubule-associated protein tau gene with familial frontotemporal dementia and parkinsonism. Hum Mol Genet 1998;7:1825±9. [7] Bird TD, Nochlin D, Poorkak P, Cherrier M, Kaye J, Payami H, et al. A clinical pathological comparison of three families with frontotemporal dementia and identical mutations in the tau gene (P301L). Brain 1999:741±56.
[8] Baker M, Litvan I, Houlden H, Adamson J, Dickson D, Perez-Tur J, et al. Association of an extended haplotype in the tau gene with progressive supranuclear palsy. Hum Mol Genet 1999;8:711±5. [9] van Swieten JC, Stevens M, Rosso SM, Rizzu P, Joasse M, de Koning I, et al. Phenotypic variation in hereditary frontotemporal dementia with tau mutations. Ann Neurol 1999;46:617±26. [10] Tanaka R, Kobayashi T, Motoi Y, Anno M, Mizuno Y, Mori H. A case of frontotemporal dementia with tau P301L mutation in the Far East. J Neurol 2000;247:705±7. [11] Nasreddine ZS, Loginov M, Clark LN, Lamarche J, Miller BL, Lamontagne A, et al. From genotype to phenotype: a clinical pathological, and biochemical investigation of frontotemporal dementia and parkinsonism (FTDP-17) caused by the P301L tau mutation. Ann Neurol 1999;45:704±15. [12] Kodama K, Okada S, Iseki E, Kowalska A, Tabira T, Hosoi N, et al. Familial frontotemporal dementia with a P301L tau mutation in Japan. J Neurol Sci 2000;176:57±64. [13] Yasuda M, Yokoyama K, Nakayasu T, Nishimura Y, Matsui M, Yokoyama T, et al. A Japanese patient with frontotemporal dementia and parkinsonism by a tau P301S mutation. Neurology 2000;55: 1224±7. [14] Lilius L, Froelich Fabre S, Basun H, Forsell C, Axelman K, Mattila K, et al. Tau gene polymorphisms and apolipoprotein E epsilon4 may interact to increase risk for Alzheimer's disease. Neurosci Lett 1999;277:29±32. [15] Russ C, Lovestone S, Baker M, Pickering-Brown SM, Andersen PM, Furlong R, et al. The extended haplotype of the microtubule associated protein tau gene is not associated with Pick's disease. Neurosci Lett 2001;299:156±8. [16] Medori R, Tritschler HJ, LeBlanc A, Villare F, Manetto V, Chen HY, et al. Fatal familial insomnia, a prion disease with a mutation at codon 178 of the prion protein gene. N Engl J Med 1992;326:444±9. [17] Goldfarb LG, Petersen RB, Tabaton M, Brown P, LeBlanc AC, Montagna P, et al. Fatal familial insomnia and familial Creutzfeldt± Jakob disease: disease phenotype determined by a DNA polymorphism. Science 1992;258:806±8. [18] Scott WK, Nance M, Hubble J, Koller WC, Lyons K, Pahwa R, et al. Complete genome screen for Parkinson's disease: evidence for multiple genes. JAMA 2001;286: 2239±44. [19] Martin ER, Scott WK, Nance MA, et al. Association of single nucleotide polymorphisms in the tau gene with last onset Parkinson's disease. JAMA 2001; 286: p. 2245±9. [20] Wsolek ZK, Kardon RH, Wolders EC, Pfeiffer RF. Frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17): a longitudinal videotape demonstration. Movement Disorders 2001;16: 756±60.
www.elsevier.com/locate/parkreldis
Case report
A family with a tau P301L mutation presenting with parkinsonism Ruth H. Walker a,b, Joseph Friedman c,d, Jill Wiener a, Ronald Hobler e, Katrina Gwinn-Hardy f, Amanda Adam f, Jennifer DeWolfe g, Rebecca Gibbs g, Matt Baker g, Matt Farrer g, Mike Hutton g, John Hardy g,* a
Department of Neurology, Bronx VA Medical Center, Bronx, NY 10468, USA b Mount Sinai School of Medicine NY 10029, USA c Department of Clinical Neuroscience, Brown University Medical School, Providence, RI, USA d Division of Neurology, Memorial Hospital of Rhode Island, 111 Brewster Street, Pawtucket, RI 02860, USA e Department of Psychology, VA Hudson Valley Healthcare System, Castle Point, NY 12511, USA f Laboratory of Neurogenetics, NINDS, Bethesda, MD 20892, USA g Laboratories of Neurogenetics, Department of Neuroscience, Mayo Clinic Jacksonville, FL 32224, USA Received 24 September 2001; revised 26 November 2001; accepted 10 December 2001
Abstract We report a sib-pair with a tau P301L mutation. Unlike most previous cases with this mutation, parkinsonism, rather than dementing features were the predominant and presenting feature. We have also observed that the P301L mutation has occurred on the H1 tau haplotype background. The haplotype background may in¯uence the disease phenotype since in many previous Caucasian families with the P301L mutation, the haplotype background has been H2. q 2002 Elsevier Science Ltd. All rights reserved. Keywords: Genetics; Parkinsonism; Progressive supranuclear palsy; Dementia; Tau
Mutations in the tau gene cause frontal temporal dementia with parkinsonism linked to chromosome 17 (FTDP-17) [1,2]. As the name of this disorder suggests, individuals with this disease can have dementia and/or parkinsonian features: indeed the clinical presentations of this disease are extremely variable [3]. Undoubtedly, the speci®c mutation in each family greatly in¯uences the clinical presentation, although the reason for this remains unclear. For example, the N279K mutation presents with pronounced parkinsonism [4], whereas, the R406W mutation presents with dementia [5]. Classically, the most common mutation, P301L has a phenotype in which dementia is the predominant feature [6,7]. During our assessment of the respective in¯uence of tau mutations familial dementia and parkinsonism, we have identi®ed a family with a predominantly parkinsonian phenotype which has a P301L mutation: here we discuss the clinical and molecular ®ndings in this family.
* Corresponding author. Tel.: 11-904-9537-356; fax: 11-904-9537-370. E-mail address: [email protected] (J. Hardy).
1. Family and methods The proband and his sister of Northern European extraction, were noted to have developed progressive parkinsonism in the sixth decade. Another sister remained unaffected. In the brother, tau exons 7 and 9±13 were ampli®ed by polymerase chain reaction (PCR) with primers we have previously described [2] and sequenced using the same primers and Big Dye chemistry (Perkin Elmer). The genotypes of the tau polymorphisms found in exons 7, 9 and 11 were determined by analysis of the sequence data. The tau haplotype was con®rmed by PCR ampli®cation over the insertion/deletion polymorphism in intron 9. It is possible to determine on which haplotype the P301L mutation occurs by PCR/RFLP haplotyping. Forward primer GGAAGACGTTCTCACTGATCTG and reverse primer GTACGACTCACACCACTTCC generate 2 haplotype speci®c products, 1187 bp (H1) and 949 bp (H2), that span both the mutation site and the insertion/deletion polymorphism. As the wild type allele contains a unique SmaI site, digestion of these products with Sma I reveals the presence of the mutation.
1353-8020/02/$ - see front matter q 2002 Elsevier Science Ltd. All rights reserved. PII: S 1353-802 0(02)00003-2
122
R.H. Walker et al. / Parkinsonism and Related Disorders 9 (2002) 121±123
1.1. Case 1 The proband presented at age 57 years with a 6 month history of dysarthric, slowed speech, and pre-syncope. His past medical and social histories was not signi®cant. His mother died of chronic obstructive pulmonary disease at age 55 and his father of a cerebral hemorrhage at age 62 years. Two maternal great aunts were reported to have suffered from dementing illnesses. On initial examination he was found to have mild bradyphrenia and impairment of verbal processing, generalized bradykinesia, masked facies, positive glabellar re¯ex, mild dysarthria (slurred and scanning speech), and mild postural and intention tremor. Autonomic testing revealed mildly abnormal cardiovascular re¯exes with initial hypotension and spontaneous recovery with prolonged passive head up tilt. At age 59 years, the patient complained of memory problems, with loss of shortterm memory. He had worsening dysarthria and occasional aspiration, and frequent falls. He was noted on examination to be disinhibited. Neuropsychological evaluation revealed psychomotor slowing, severe de®cits in verbal ¯uency, mildly impaired speech and memory recall, with intact global cognitive, visuospatial and behavioral functions, suggesting predominantly subcortical involvement with possible frontal and temporal involvement. He had dif®culty with saccade initiation, especially on upgaze. There was generalized moderate to severe bradykinesia, and speech was extremely dysarthric. Rapid alternating movements were more impaired on the right than the left. There was a bilateral, ®ne, irregular postural and activation tremor. His posture was moderately stooped, with severe impairment of postural re¯exes. Deep tendon re¯exes were symmetric and brisk with equivocal Babinski signs. Within the next 6 months, the patient became aggressive, and was admitted for behavioral problems including episodes of rage and destructiveness. He had undergone a trial of carbidopa/ levodopa 25/100 three times a day, with limited responsiveness, and it was discontinued after an episode of confusion. An MRI scan performed two years after symptom onset revealed moderate generalized cerebral atrophy. His diagnosis was that of multi-system atrophy versus progressive supranuclear palsy. 1.2. Case 2 The proband's affected sister was well until the age of 57 years when she complained of memory dysfunction. In retrospect, the patient felt that her memory had been worsening for the previous seven years, or even earlier, following a hysterectomy. However, her Folstein MiniMental status examination was 29/30 at the time or presentation. She had marked parkinsonism on examination. A trial of carbidopa/levodopa was undertaken, and mild responsiveness, especially for the shuf¯ing gait, absent arm swing, and rigidity were noted. The muscles in her face trembled when she smiled, but otherwise, had no
tremor. On physical examination ®ve years later, the patient was noted to be alert, attentive, and anxious. She was oriented, able to register three objects but recalled only two, was able to name the President's wife but not his name. She had marked dysnomia, being unable to name knuckles, collar, or lapel. She had dif®culty in drawing a clock. She was noted to have moderate masked facies, no resting or action tremor, with mild slowness of rapid alternating movements on the right but not the left. There was increased tone in the right arm. Deep tendon re¯exes were normal as were balance and gait. The diagnoses of Diffuse Lewy body disease and `PSP-dementia' were the working clinical diagnoses. 2. Results and discussion Sequencing the tau gene revealed a C to T change at codon 301 in exon 10 causing a proline to leucine change at codon 301 (P301L). In addition, both sibs were H1 homozygotes [8]. The P301L mutation has been found in many previous families with FTDP-17 [2,5,7,9±12] and is thus undoubtedly pathogenic. However, it is usually associated with a dementia phenotype (ibid) and is not usually associated with a parkinsonism phenotype similar to that we report here. The exception is the report by Bird and colleagues [7] who reported detailed characterization of three families with a P301L mutation, two with a largely dementia phenotype and one with a phenotype similar to that described here and a Japanese family with a P301S mutation with a similar phenotype has also been reported [13]. In our and other's sequencing of the tau gene [8,14] we have noted that there are two distinct human tau haplotype families, H1 and H2, which occur at allele frequencies of ,70 and 30% in most Caucasian populations [8]. In the previous cases when the P301L mutation has been reported in Caucasians and in which phase information is known [2,5,6,9,10,12], the P301L mutation has occurred on the H2 haplotype: however, in this family, both sibs are H1 homozygotes. Thus, an intriguing possibility is that the mutation haplotype background can in¯uence the phenotype with the H1 haplotype favoring a parkinsonian phenotype and an H2 haplotype favoring a dementia phenotype. In this respect it is interesting that H1 homozygosity predisposes to progressive supranuclear palsy [8] and H2 homozygosity may occur more frequently in pathologically con®rmed Pick's disease [15]. Although we favor this explanation for our observations, it clearly is not the whole story, since in Asian populations, the H1 haplotype has a greater than 95% allele frequency (unpublished data) and yet both P301L mutations from this racial group had dementia as a presenting feature [10,12] although the report of the P301S mutation from this population had a phenotype similar to that reported here [13]. We suggest a full description of the genotype/phenotype correlations concerning the tau gene mutations should include analysis of the tau haplotype background on which
R.H. Walker et al. / Parkinsonism and Related Disorders 9 (2002) 121±123
123
Table 1 Clinical features
Age of symptom onset (years) Presenting symptom Eye movement abnormalities Resting tremor Activation/postural tremor Rigidity Postural instability Asymmetry Bradykinesis Gait dif®culties Dysinhibition Memory abnormality Dysautonomia Dopamine responsiveness
201-1
201-3
55±57 Dysarthria, bradykinesia Present Absent Present Present Present Present Present Present Present, late in course Present, later in course Present, mild Present, mild
50±57 Memory dif®culties Absent Absent Absent Present Present Present Present Present Absent Present, early in course Absent Present, mild
the mutation has occurred, as is the case for prion mutation cases [16,17]. Finally, it has to be of concern that a recent genome screen for `Parkinson's disease' identi®ed tau as a locus [18,19]: given the clinical features of tau mutations can include parkinsonism [20], one has to be concerned that this genome screen was contaminated by families similar to this one, which will presumably be caused by tau, rather that synuclein pathology (Table 1). Acknowledgements We thank the family for their enthusiasm for this work. This work was supported by an NIH/NIA Program Project Grant (MH, JH) and the Mayo Foundation. References [1] Poorkaj P, Bird TD, Wijsman E, Nemens E, Garruto RM, Anderson L, et al. Tau is a candidate gene for chromosome 17 frontotemporal dementia. Ann Neurol 1998;43:815±25. [2] Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, et al. Association of missense and 5 0 -splice-site mutations in tau with the inherited dementia FTDP-17. Nature 1998;393:702±5. [3] Foster NL, Wilhelmsen K, Sima AA, Jones MZ, D'Amato CJ, Gilman S. Frontotemporal dementia and parkinsonism linked to chromosome 17: a consensus conference. Ann Neurol 1997;41:706±15. [4] Clark LN, Poorkaj P, Wszolek Z, Geschwind DH, Nasreddins ZS, Miller B, et al. Pathogenic implications of mutations in the tau gene in pallido-ponto-nigral degeneration and related neurodegenerative disorders linked to chromosome 17. Proc Natl Acad Sci USA 1998;95:13103±7. [5] Houlden H, Baker M, Adamson J, Grover A, Waring S, Dickson D, et al. Frequency of tau mutations in three series of non-Alzheimer's degenerative dementia. Ann Neurol 1999;46:243±8. [6] Dumanchin C, Camuzat A, Campion D, Verpillat P, Hannequin D, Dubois B, et al. Segregation of a missense mutation in the microtubule-associated protein tau gene with familial frontotemporal dementia and parkinsonism. Hum Mol Genet 1998;7:1825±9. [7] Bird TD, Nochlin D, Poorkak P, Cherrier M, Kaye J, Payami H, et al. A clinical pathological comparison of three families with frontotemporal dementia and identical mutations in the tau gene (P301L). Brain 1999:741±56.
[8] Baker M, Litvan I, Houlden H, Adamson J, Dickson D, Perez-Tur J, et al. Association of an extended haplotype in the tau gene with progressive supranuclear palsy. Hum Mol Genet 1999;8:711±5. [9] van Swieten JC, Stevens M, Rosso SM, Rizzu P, Joasse M, de Koning I, et al. Phenotypic variation in hereditary frontotemporal dementia with tau mutations. Ann Neurol 1999;46:617±26. [10] Tanaka R, Kobayashi T, Motoi Y, Anno M, Mizuno Y, Mori H. A case of frontotemporal dementia with tau P301L mutation in the Far East. J Neurol 2000;247:705±7. [11] Nasreddine ZS, Loginov M, Clark LN, Lamarche J, Miller BL, Lamontagne A, et al. From genotype to phenotype: a clinical pathological, and biochemical investigation of frontotemporal dementia and parkinsonism (FTDP-17) caused by the P301L tau mutation. Ann Neurol 1999;45:704±15. [12] Kodama K, Okada S, Iseki E, Kowalska A, Tabira T, Hosoi N, et al. Familial frontotemporal dementia with a P301L tau mutation in Japan. J Neurol Sci 2000;176:57±64. [13] Yasuda M, Yokoyama K, Nakayasu T, Nishimura Y, Matsui M, Yokoyama T, et al. A Japanese patient with frontotemporal dementia and parkinsonism by a tau P301S mutation. Neurology 2000;55: 1224±7. [14] Lilius L, Froelich Fabre S, Basun H, Forsell C, Axelman K, Mattila K, et al. Tau gene polymorphisms and apolipoprotein E epsilon4 may interact to increase risk for Alzheimer's disease. Neurosci Lett 1999;277:29±32. [15] Russ C, Lovestone S, Baker M, Pickering-Brown SM, Andersen PM, Furlong R, et al. The extended haplotype of the microtubule associated protein tau gene is not associated with Pick's disease. Neurosci Lett 2001;299:156±8. [16] Medori R, Tritschler HJ, LeBlanc A, Villare F, Manetto V, Chen HY, et al. Fatal familial insomnia, a prion disease with a mutation at codon 178 of the prion protein gene. N Engl J Med 1992;326:444±9. [17] Goldfarb LG, Petersen RB, Tabaton M, Brown P, LeBlanc AC, Montagna P, et al. Fatal familial insomnia and familial Creutzfeldt± Jakob disease: disease phenotype determined by a DNA polymorphism. Science 1992;258:806±8. [18] Scott WK, Nance M, Hubble J, Koller WC, Lyons K, Pahwa R, et al. Complete genome screen for Parkinson's disease: evidence for multiple genes. JAMA 2001;286: 2239±44. [19] Martin ER, Scott WK, Nance MA, et al. Association of single nucleotide polymorphisms in the tau gene with last onset Parkinson's disease. JAMA 2001; 286: p. 2245±9. [20] Wsolek ZK, Kardon RH, Wolders EC, Pfeiffer RF. Frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17): a longitudinal videotape demonstration. Movement Disorders 2001;16: 756±60.