A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

YFSIM2977_proof ■ 15 May 2014 ■ 1/9

Fish & Shellfish Immunology xxx (2014) 1e9

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus Q3

Jie-Jie Sun, Jiang-Feng Lan, Xiu-Zhen Shi, Ming-Chong Yang, Hui-Ting Yang, Xiao-Fan Zhao, Jin-Xing Wang* MOE Key Laboratory of Plant Cell Engineering and Germplasm Innovation, Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Sciences, Shandong University, Jinan, Shandong 250100, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 January 2014 Received in revised form 25 April 2014 Accepted 3 May 2014 Available online xxx

Fibrinogen-related proteins (FREPs) in invertebrates have important functions in innate immunity. In this study, the cDNA of FREP was identified from the kuruma shrimp Marsupenaeus japonicus (MjFREP2). The full-length cDNA of MjFREP2 is 1138 bp with an open reading frame of 954 bp that encodes a 317-amino acid protein comprising a signal peptide and a fibrinogen-like domain. MjFREP2 could be detected in hemocytes, heart, hepatopancreas, gills, stomach, and intestines. MjFREP2 could also be upregulated in hemocytes after Vibrio anguillarum and Staphylococcus aureus challenge. Agglutination and binding assay results revealed that the recombinant MjFREP2 bound to bacteria and polysaccharides. Immunocytochemical analysis results showed that MjFREP2 proteins were mainly distributed in the cytoplasm of hemocytes from unchallenged shrimp and transported to the membrane or secreted out of the cell after V. anguillarum or S. aureus challenge. The secreted MjFREP2 bound to the bacteria presented in shrimp hemolymph. The overexpression of MjFREP2 could enhance bacterial clearance by inducing the phagocytosis of hemocytes. This ability was impaired by knockdown of MjFREP2 with RNA interference. The cumulative mortality of MjFREP2-silenced shrimp was significantly higher than that of the control shrimp. These results suggested that MjFREP2 has an important function in the antibacterial immunity of M. japonicus. Ó 2014 Published by Elsevier Ltd.

Keywords: Fibrinogen-related protein Innate immunity Phagocytosis Pattern recognition receptor

1. Introduction Invertebrates exhibit no antibody-driven adaptive immunity and rely on innate immunity to prevent pathogen invasion. Innate immunity is activated by pathogen sensors called pattern recognition receptors (PRRs). More than 10 kinds of PRRs are found in invertebrates [1,2]. Among these PRRs, lectins are important in the recognition of microbe-associated molecular patterns (MAMPs) located on microbial surfaces; these lectins are also involved in the initiation of defense responses [2]. Fibrinogen-related proteins (FREPs), also known as fibrinogen-like domain immunolectins, FBN, have a fibrinogen-related domain (FReD) consisting of about 200 amino acid residues in the domain with high sequence similarity to the C terminus of the fibrinogen b and g chains. FREPs are composed of different kinds of proteins, such as ficolins, tenascins, tachylectins, angiopoietins, ixoderins, fibroleukin, and some other extracellular proteins [3e6]. These proteins perform various

Q1

* Corresponding author. Tel./fax: þ86 531 88364620. E-mail addresses: [email protected], [email protected] (J.-X. Wang).

functions, including agglutination and bacterial defense, developmental processes, and allorecognition [7,8]. Ficolins, one kind of the best studied FREPs, are the oligomeric lectins that usually consist of an N-terminal collagen-like domain and a C-terminal FReD. Ficolins are also widely distributed among vertebrates and invertebrates. Furthermore, ficolins are mainly involved in innate immunity, particularly in pathogen recognition. Three different ficolins, designated as L-, M
, and H-, are found in human [7]. Ficolins from mammals can initiate complement activation via the lectin pathway [5,9e11] and function as recognition molecules against pathogens and activate the associated serine proteases of the MBLassociated serine protease (MASP)/C1r/C1s family; the activated MASPs and C1s trigger complement activation [12,13]. There are several FREPs identified in various species of invertebrates and almost all of them are implicated in innate immune responses. For example, 59 putative members of the FREPs were discovered in the mosquito Anopheles gambiae, and 37 members in Anopheles aegypti. The FREP family plays a central role in mosquito immune system [14]. In crustaceans, several FREPs were also discovered in several species. Tachylectins from the horseshoe crab Tachypleus tridentatus are well characterized in terms of structure

http://dx.doi.org/10.1016/j.fsi.2014.05.005 1050-4648/Ó 2014 Published by Elsevier Ltd.

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM2977_proof ■ 15 May 2014 ■ 2/9

2

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

and function. Tachylectins consist of a short N-terminal Cyscontaining segment and a C-terminal FReD [15]. Tachylectins 5A and 5B bind to acetyl groups, such as N-acetylglucosamine (GlcNAc), forming dimers or tetramers that may agglutinate human erythrocytes or different bacteria [15,16]. Four aromatic amino acids in FReD (namely, Tyr210, Tyr236, Tyr248, and His220 in TL5A) are involved in mediating contact between proteins and carbohydrates, specifically via acetyl groups [16,17]. Unlike ficolins found in vertebrates, ficolin-like proteins in invertebrates contain different primary structures that exhibit variations in the number of FReDs, lack of collagen-like domain, and presence of additional domains [18]. Ficolin-like proteins were found in the freshwater crayfish Pacifastacus leniusculus with repeated Gln-rich region in the N-terminal and function as PRRs against invading Gramnegative bacteria [19]. Two ficolin-like protein was discovered in giant freshwater prawn Macrobrachium rosenbergii with the coiled coil region in N-terminal. These ficolin-like proteins can enhance the bacteria clearance in the prawn [20]. In the present study, a new FREP was identified from kumura shrimp Marsupenaeus japonicus, and designated as MjFREP2. Comparing with our previous studied MjFREP1 [21] and other reported members of crustacean FREP family, MjFREP2 shows difference in the N-terminal region. BLAST search showed that the protein with highest score is the predicted protein from sea anemone Nematostella vectensis (accession no. XM_001636285.1, 42% identity). MjFREP2 has no putative conserved domain at the Nterminal. The identity of the FReD in the C-terminal between MjFREP1 and 2 are only 29.6%. These differences prompted us to investigate the function of MjFREP2 in shrimp innate immunty. 2. Material and methods 2.1. Immune challenge and tissue collection M. japonicus weighing approximately 9 ge12 g was purchased from a seafood market in Jinan, Shandong Province, China. The shrimp were temporarily kept in laboratory aquarium tanks containing aerated seawater. For the immune challenge, either Vibrio anguillarum or Staphylococcus aureus [obtained from Shandong University Organism Culture Collection (SDMCC)], (2  107 CFU) was injected into the abdominal segment of each shrimp. The hemolymph was collected from the ventral sinus at different time points (6, 12, 24, and 48 h) after bacterial cells were injected using a syringe pre-loaded with ice-cold anticoagulant buffer (0.45 M NaCl, 10 mM KCl, 10 mM EDTA, and 10 mM HEPES, pH 7.45) [22]. The hemolymph was immediately centrifuged at 800  g for 10 min at 4  C to isolate the hemocytes. The hemolymph and hemocytes from the unchallenged shrimp were collected using the same method and other tissues, including the heart, hepatopancreas, gills, stomach, and intestines, from at least three unchallenged were dissected to extract RNA or proteins for detecting tissue distribution. 2.2. RNA Extraction and cDNA synthesis Total RNA was extracted from different tissues (hemocytes, heart, hepatopancreas, gills, stomach, and intestine) of control and V. anguillarum- or S. aureus-challenged shrimp by using Trizol reagent (Cwbio, Beijing, China) according to the manufacturer’s protocol. The first-strand cDNA was synthesized in a 25 ml reaction mixture containing 5 mg of RNA, 1 ml of M-MLV reverse transcriptase (Bioteke, Beijing, China), and 1 mM dNTP by using SMART F and oligo anchor R (Table 1) at 42  C for 1 h. The reaction was terminated at 72  C for 5 min. The cDNA was stored in a freezer at
80  C until use.

Table 1 Oligonucleotide primers used in the study. Primer name

Sequence (50 e30 )

cDNA synthesis SMART F TACGGCTGCGAGAAGACGACAGAAGGG oligo anchor R GACCACGCGTATCGATGTCGACT16V cDNA cloning MjFREP2-F1 AAGTGAGATAATTCTCGGTCAGTTG MjFREP2-R1 TTGCTCCAATGGCACTCTTCGTCTC RT-PCR b-actin-RT-F CAGCCTTCCTTCCTGGGTATGG b-actin-RT-R GAGGGAGCGAGGGCAGTGATT MjFREP2-RT-F AACATCAGCGGCATCTACAA MjFREP2-RT-R TGAATAACCGTCCATCCTCC Recombinant expression MjFREP2mF TACTCAGGATCCAGCAAAATGAGATTCAA MjFREP2 mR TACTCAGTCGACCGGCATCTATGTCTTGGG RNAi MjFREP2-Fi GCGTAATACGACTCACTATAGCAGAGACCTGTACGGCGCG MjFREP2-Ri GCGTAATACGACTCACTATAGCAACGCTCCTCGCTCAGCTG GFP-Fi GCGTAATACGACTCACTATAGGTGGTCCCAATTCTCGTGGAAC GFP-Ri GCGTAATACGACTCACTATAGGCTTGAAGTTGACCTTGATGCC

2.3. Cloning the full-length cDNA of MjFREP2 The specific primers MjFREP2-F1 and R1 (Table 1) were designed to analyze the nucleotide sequences of a fragment obtained from the transcriptome sequence of the hemocytes of M. japonicus. Polymerase chain reaction (PCR) was performed using the cDNA from hemocytes as a template: 1 cycle of 94  C for 3 min; 35 cycles of 94  C for 30 s, 53  C for 45 s, and 72  C for 70 s; and 1 cycle of 72  C for 10 min. PCR products were run on the agarose gel and purified using a gel purification kit (Sangon, Shanghai, China). The purified PCR products were inserted into a pMD-18T vector and then transformed into competent DH5a cells. The positive clones were sequenced by Sangon Company (Shanghai, China). The sequence obtained from transcriptome data is the full-length cDNA of FREP analyzed by online translation and BLAST analysis. 2.4. Sequence BLAST and similarity analysis The similarity of MjFREP2 to other FREPs was analyzed using the online BLAST program (http://blast.ncbi.nlm.nih.gov/). The amino acid sequence was translated, and the deduced protein was predicted using ExPASy tools (http://ww w.expasy.org). The signal peptide and domain were predicted using the simple modular architecture research tool (http://www.smart.embl-heidelber g.de/). MEGA 6.0 [23] was used to construct the phylogenetic tree of MjFREP2 with other RREPs. 2.5. Recombinant expression and purification of MjFREP2 and antiserum preparation The primer pair MjFREP2 mF and MjFREP2 mR (Table 1) containing BamH I and Sal I sites were used to amplify the fragment encoding the mature MjFREP2 protein. This fragment was inserted into the pGEX4T-1 plasmid and then transformed into Escherichia coli BL21 (DE3) cells for overexpression. The recombinant MjFREP2 was purified using glutathoine Sepharose 4B chromatography (Novagen) according to the manufacturer’s instructions. Antiserum was cultured in rabbits as described in a previous study [24]. 2.6. Semi-quantitative reverse transcription PCR (RT-PCR) and quantitative real-time PCR (qRTPCR) Total RNA was isolated from different tissues of normal and bacterium-challenged shrimp (at least three samples) at 12, 24, and

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM2977_proof ■ 15 May 2014 ■ 3/9

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

48 h. RNA (5 mg) obtained from the same tissues of three shrimp was used to reverse transcribe the first-strand of cDNA and diluted tenfold in nuclease-free water. The resulting cDNA was then used as the template for RT-PCR. The primer pair MjFREP2-RT-F and MjFREP2-RT-R (Table 1) was used in RT-PCR; PCR was performed under the following conditions: 94  C for 3 min; 94  C for 30 s; 55  C for 20 s; 72  C for 20 s (32 cycles); and 72  C for 10 min. The bactin gene was used as the control sample with the primers b-actinRT-F and b-actin-RT-R (Table 1). For qRT-PCR analysis, cDNA templates were diluted 100-fold in nuclease-free water. qRT-PCR was performed according to the manufacturer’s instructions. In brief, SYBR Premix Ex Taq (TaKaRa, Dalian, China) was used in a real-time thermal cycler (Bio-Rad, USA) with a total volume of 10 ml containing 5 ml of 2  Premix Ex Taq, 1 ml of the 1:100 diluted cDNA, and 2 ml (1 mM) each of the forward primer and the reverse primer. qRT-PCR was performed under the following conditions: 95  C for 3 min; 40 cycles of 95  C for 15 s; 59  C for 50 s; and melting from 72  C to 95  C. Three parallel experiments were conducted to increase the credibility of this study. The 2
DDCt method was used to calculate the relative expression. The obtained data were subjected to statistical analysis and unpaired sample t-test. 2.7. Western blot analysis Different tissues (hemocytes, heart, hepatopancreas, gills, stomach, intestines, and hematoplasma) from the control group and bacterium-challenged groups were collected, homogenized in buffer (50 mM TriseHCl, pH 7.5, 150 mM NaCl, 3 mM EDTA, and 1 mM PMSF), and centrifuged at 10,000  g for 10 min at 4  C to collect the supernatant. SDS-PAGE (12.5%) was performed (100 mg protein in each lane) according to a previously described method [25]. The tissue proteins were then transferred onto a nitrocellulose membrane. Afterward, the membrane was blocked with 3% non-fat milk in TBS (10 mM TriseHCl, pH 7.5, and 150 mM NaCl) for 1 h and incubated with the polyclonal antibody of MjFREP2 (1/100) overnight. After the membrane was washed with TBST (100 mM NaCl, pH 7.5, 10 mM TriseHCl, and 0.02% Tween) thrice, goat anti-rabbit IgG conjugated with horseradish peroxidase (HRP; 1:10,000 in TBS) was used as secondary antibody. Antibody binding was visualized using 4-chloro-1-naphthol (4-CN) and H2O2. 2.8. Bacterial agglutination assay Agglutination assay was performed using S. aureus and V. anguillarum. Bacteria were collected at the logarithmic phase and then suspended with TBS to obtain a final cell density of 2  108 CFU/ml. Bacteria were incubated with MjFREP2 protein at different concentrations (12.5 mg/mle200 mg/ml) in the presence or absence of 10 mM CaCl2. The mixture was subsequently incubated at room temperature (37  C) for 1 h. Agglutination was then observed under a microscope. GST was used as the negative control. 2.9. Binding of recombinant protein to microorganisms Gram-positive bacteria (Bacillus thuringiensis, B. subtilis, and S. aureus) and Gram-negative bacteria (Bacillus megaterium, E. coli, Klebsiella pneumoniae, and V. anguillarum) were used to evaluate the binding activity of the recombinant MjFREP2. These bacteria were cultured in LuriaeBertani (LB) medium (1% tryptone, 0.5% yeast extract, and 1% NaCl), collected by centrifugation at 1000  g for 5 min, washed twice with TBS, and resuspended in TBS to an OD600 of 1.0. Purified rMjFREP2 proteins (100 mg) were added to 500 ml of TBS with microorganisms and shaken for 20 min at 25  C. The pellets were washed four times with TBS and then eluted with

3

10% SDS for 1 min. The eluted proteins were subjected to 12.5% SDSPAGE and transferred onto nitrocellulose membrane for western blot analysis using anti-MjFREP2 as the primary antibody. 2.10. Enzyme-linked immunosorbent assay (ELISA) To detect the direct binding activity of rMjFREP2 to sugars, we performed ELISA according to a previously described method [26]. Lipopolysaccharides (LPS; E. coli Serotype 055:B5), lipoteichoic acid (LTA), and peptidoglycan (PGN, Staphylococcus staphylolyticus; Sigma) were chosen for the analysis. Each polysaccharide was dissolved in water at 80 mg/ml concentration and sonicated for 3  15 s, 50 ml (4 mg) of polysaccharide was added to each well of the plate and incubated at 37  C overnight, followed by heating at 60  C for 30 min. The micro-plates were blocked by BSA (1 mg/ml, 200 ml) at 37  C for 2 h and then washed four times with TBS (200 ml). The purified rMjFREP2 (0 mg/mle2 mg/ml in TBS containing 0.1 mg/ml BSA) were placed in the wells. The plate was incubated for 3 h at room temperature and then washed four times with TBS. The MjFREP2 antiserum (1/200 diluted in 0.1 mg/ml BSA) was added to the micro-plate (100 ml/well) and incubated for 1 h at 37  C, the wells were then washed four times with TBS. Alkaline phosphataseconjugated goat anti-rabbit IgG (1/3000) was added to each well and incubated for 1 h at 37  C. The plates were washed four times as described above, color was developed by adding 100 ml p-nitrophenyl phosphate (1 mg/ml in 10 mM diethanolamine and 0.5 mM MgCl2). GST was used as control. The absorbance was read at 405 nm. The binding assays were performed in triplicate. 2.11. Immunocytochemical assays The hemolymph collected from three shrimp from each group was placed in a 1 ml mixture of anticoagulant (pH 7.4) and fixed by adding 4% paraformaldehyde. The hemocytes were isolated by centrifugation (700 g for 10 min at 4  C), washed with PBS (140 mM NaCl, 10 mM sodium phosphate, pH 7.4), incubated in 0.2% Triton X100 at 37  C (5 min), and washed with PBS again. After blocking with 3% BSA (30 min, 37  C), hemocytes were incubated overnight with anti-MjFREP2 (1:100 in blocking buffer) at 4  C. Hemocytes were then washed with PBS, incubated with 3% BSA for 10 min, incubated once more with the second antibody goat anti-rabbitAlexa Fluor 488 (1:1000 diluted in 3% BSA), and kept in the dark for 1 h at 37  C. After washing with PBS, hemocytes were stained with 4ʹ-6-diamidino-2-phenylindole dihydrochloride (DAPI, AnaSpec Inc., San Jose, CA) for 10 min at room temperature, and then washed once again. Hemocytes were observed under fluorescence microscope (Olympus BX51). Similar immunocytochemical method was used to detect if secreted MjFREP bonded with the bacteria in shrimp hemolymph. After LPS challenge, hemolymph from the shrimp was drawn out and centrifuged at 600 g 3 min to remove hemocytes. The obtained supernate was centrifuged once more at 10,000  g to collect the bacteria. One part of the bacteria was grown on LB plates and another part was dropped on a slide for immunocytochemical analysis. 2.12. Bacteria clearance assay Shrimp weighing (8e10) g each were separated into four groups. The rMjFREP2 and GST (15 mg per shrimp) were incubated with V. anguillarum or S. aureus (2  107 CFU per shrimp) for 30 min and then injected into different groups of shrimp. The GST protein was used as control. Hemolymph was extracted at 5, 15, and 30 min after bacterial injection. The hemolymph was diluted and cultured

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM2977_proof ■ 15 May 2014 ■ 4/9

4

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

on LB solid plates overnight. The number of bacteria was counted. The assay was repeated in triplicate. 2.13. Fluorescent labeling of bacteria and phagocytosis assay V. anguillarum and S. aureus were collected at logarithmic phase by centrifugation at 4500 rpm for 10 min. After the sample was washed twice with PBS, the bacteria were labeled with FITC (Sigma) for 1.5 h at 37  C and washed again with PBS twice. After fixation in 4% paraformaldehyde was performed for 30 min, the labeled bacteria were washed twice and used in the phagocytosis assay [27]. After bacterial injection, shrimp hemocytes were isolated at 5, 15, and 30 min (three shrimp at each time point) and resuspended with PBS (PH 7.4) at 106 cells ml
1, then dropped onto glass slides. The fluorescence microscope (Olympus BX51) was used to count hemocytes containing labeled bacteria. The phagocytic percentage (PP) was calculated as follows: PP ¼ (cells ingesting bacteria/cells observed)  100%. The assay was conducted in triplicate. The data were analyzed by t-test.

Fig. 2. MjFREP2 was upregulated by bacteria challenge. (A) Temporal expression profiles of MjFREP2 in hemocytes after V. anguillarium challenge, analyzed by qRT-PCR (upper panel) and western blot (bottom panel). (B) Temporal expression profiles of MjFREP2 in hemocytes after S. aureus challenge, analyzed by qRT-PCR (upper panel) and western blot (bottom panel). Asterisks indicate significant differences P < 0.05.

2.14. RNAi assay The MjFREP2 cDNA fragment amplified by MjFREP2-Fi and MjFREP2-Ri (Table 1) was used as template for dsRNA synthesis. By comparison, the cDNA fragment of GFP used for dsGFP synthesis was amplified using primers GFP-Fi and GFP-Ri (Table 1). Assay for dsRNA synthesis was performed in accordance with previous reports [28]. The dsRNA (40 mg) was injected into the abdominal segment of each shrimp. To enhance the RNAi effect, the second injection was performed 12 h after the first injection. The dsGFP was used as the control. The hemocytes were collected from the shrimp at 24 h after the second injection, and total RNA was extracted and detected by RT-PCR using primers MjFREP2-RT-F and MjFREP2-RT-R (Table 1) to check the effect of RNAi. To evaluate the function of MjFREP2 in vivo, V. anguillarum and S. aureus (2  107 CFU) were injected into MjFREP2-silenced shrimp. The hemolymph was extracted from the shrimp 1 h after bacteria injection and was spread on LB plates for quantification of bacteria populations. The dsGFP-treated shrimp were used as control. Assays were performed in triplicate. 2.15. Mortality rates of MjFREP2-silenced shrimp after V. anguillarum or S. aureus infection To study the function of MjFREP2 in vivo, we performed mortality assays using MjFREP2-silenced shrimp. The gene-silenced

shrimp were divided into two groups (40 shrimp for each group). V. anguillarum or S. aureus (2  107 CFU) was injected into the shrimp 24 h after the second dsRNA injection, and dsGFP-injected group was used as control. The dead shrimp were counted every 12 h and the assay was repeated three times. 3. Results 3.1. Cloning and sequence analysis of MjFREP2 The full-length of MjFREP2 cDNA was 1138 bp with an open reading frame (ORF) of 954 bp (GenBank accession no. KJ158837). The ORF of MjFREP2 encoded a putative 317-amino acid protein with a calculated molecular weight of about 36 kDa. This putative protein consisted of a signal peptide, the N-terminal unknown region, and C-terminal FReD. It had four potential Asn-linked glycosylation sites at residue 29, 130, 136, and 287, and two potential calcium-binding sites in the C-terminal (Fig. S1). The alignment of the MjFREP2 with MjFREP1 (AEM76723) and other FREPs are shown in Fig. S2, All FREPs contain four conserved cysteine residues, which contributed to the correct folding of FREPs. It shows 27% identity between MjFREP1 and MjFREP2. Both MjFREP1 and 2 have no conserved domains at the N-terminal unknown region. However, MjFREP1 at the N-terminal region is rich of the residue glutamic acid (E) and that of MjFREP2 is rich of glycine (G). In

Fig. 1. MjFREP2 distributed in all tested tissues except cell-free hemolymph. (A) Purification and polyclonal antibody detection of recombinant MjFREP2. Lane M, standard protein marker. Lane 1, purified rMjFREP2 of E. coli with pGEX4T-1; lane 2, MjFREP2 in normal hemocytes of shrimp was detected with polyclonal antibody. (B) The transcripts of MjFREP2 were examined by semi-quantitative RT-PCR. (C) The tissue distribution of MjFREP2 protein was investigated by Western blot.

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM2977_proof ■ 15 May 2014 ■ 5/9

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

5

Fig. 3. Recombinant MjFREP2 agglutination in different bacteria (V. anguillarum and S. aureus) via Ca2D dependent manner. The bacteria tested were suspended in TBS at 2  108 Cfu/ml. Agglutination was observed under microscope. Bar ¼ 20 mm.

Q2

phylogenetic analysis, FREPs were divided into two groups: Group I and II. The Group I includes 3 subgroups: FREPs from crayfish and prawn; FREPs from vertebrates, African clawed frog Xenopus laevis and cattle Bos taurus; FREPs from horseshoe crabs. MjFREP1 belongs to first subgroup and MjFREP2 belongs to the third one. The group II consists of the vertebrate FREPs (Fig. S3).

B. subtilis, and S. aureus), and Gram-negative bacteria (B. megaterium, E. coli, K. pneumoniae, and V. anguillarum) were analyzed (Fig. 4A). To further study the molecule that MjFREP2 binds with, ELISA was performed to detect direct binding activity to the polysaccharides, including PGN, LTA and LPS. Results showed that

3.2. MjFREP2 widely distributed and upregulated by bacterial challenge The semi-quantitative RT-PCR and western blot was used to analyze MjFREP2 tissue distribution by determining RNA and protein levels. As shown in Fig. 1A and B, MjFREP2 existed in all tested tissues (hemocytes, heart, hepatopancreas, gills, stomach and intestine) but MjFREP2 proteins in cell-free hemolymph at protein level (Fig. 1B) was not detected. QRT-PCR was performed to analyze the time course expression of MjFREP2 in the hemocytes of shrimp after V. anguillarum or S. aureus challenge, the results showed that MjFREP2 was upregulated by bacterial challenge, whereas RNA and protein levels reached the highest level at 24 h post-injection (Fig. 2A and B). These results suggested that MjFREP2 may be related to immune defense against bacteria. 3.3. MjFREP2 agglutinated bacteria in calcium-dependent The bacterial agglutination activity of MjFREP2 was tested using a Gram-positive bacterium S. aureus, and a Gram-negative bacterium V. anguillarum. Results showed that MjFREP2 can agglutinate both bacteria and that agglutinating activity was calcium dependent (Fig. 3). 3.4. MjFREP2 bound to microorganisms through binding to polysaccharides To determine whether or not MjFREP2 can bind microorganisms, we conducted the bacterium-binding assay. The recombinant MjFREP2 bound to several Gram-positive bacteria (B. thuringiensis,

Fig. 4. Recombinant MjFREP2 bound to bacteria and polysaccharides. (A) Western blot was used to analyze the binding activity of rMjFREP2 to seven bacteria using MjFREP2 polyclonal antiserum as the first antibody. (B) ELISA was performed to detect binding activity of rMjFREP2 to different carbohydrates (PGN, LPS, and LTA).

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM2977_proof ■ 15 May 2014 ■ 6/9

6

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

Fig. 5. MjFREP2 secreted by hemocytes and bound to bacteria in shrimp hemolymph. (A). Immunocytochemical analysis to detect the MjFREP2 in shrimp hemocytes. Green fluorescence signal indicating distribution of MjFREP2 in hemocytes; the blue color showed the nucleus of hemocytes stained with DAPI. (B) The bacteria on the LB solid medium of glass plate were extracted from the hemolymph of three normal shrimp. (C) Immunocytochemical assay to detect MjFREP on the bacteria isolate from shrimp hemolymph. Bacteria from hemolymph of normal shrimp (upper panel) or LPS challenged shrimp (bottom panel). The green color shows MjFREP2 bound to the surface of bacteria. Bar ¼ 20 mm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

MjFREP2 can bind to PGN, LTA, and LPS, high binding affinity was also found to be protein concentration dependent (Fig. 4B). These results suggested that MjFREP2 could bind to different bacteria by binding to the polysaccharides on their surfaces. 3.5. MjFREP2 secreted by hemocytes and bound to bacteria in shrimp hemolymph The hemocytes from the control, V. anguillarum-challenged, and S. aureus-challenged groups were collected and used for immunocytochemical analysis. The results showed a strong green signal in the hemocytic cytoplasm of the control group. After a 5 min challenge by V. anguillarum or S. aureus, most of MjFREP2 proteins were transferred from the cell cytoplasm to the membrane, and the green signal became weaker than that in normal hemocytes (Fig. 5A). MjFREP2 should be secreted out of the cells similar to other plasma FREPs because MjFREP2 contains a signal peptide. However, as shown in Fig. 1B, MjFREP2 proteins could be hardly detected in the

free hemolymph by western blot. Previous reports and our unpublished study found that the circulating hemolymph of healthy shrimp contains low and stable numbers of bacteria. Therefore, the secreted MjFREP2 could bind to the bacteria in the hemolymph. To test the hypothesis, we first isolated the bacteria from the shrimp hemolymph and verified our result by in vitro culture. We then determined whether or not MjFREP2 could bind to the bacteria by the immunocytochemical method. The results showed that bacteria were presented in shrimp hemolymph (Fig. 5B) and MjFREP2 could be detected on the surface of the bacteria isolated from the healthy shrimp hemolymph. The green signal of MjFREP2 on the bacteria became stronger if the shrimp were challenged by a lipopolysaccharide (Fig. 5C). These results suggested that a new MjFREP2 could be secreted out of hemocytes under normal or unchallenged conditions, but more proteins could be secreted out of the cells and bound to bacteria under LPS challenge. This result could also be accounted for the secreted soluble MjFREP2 that could not be detected in the cell-free hemolymph (Fig. 1B).

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM2977_proof ■ 15 May 2014 ■ 7/9

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

7

Fig. 6. MjFREP2 promoted bacterial clearance in shrimp. (A) and (B). MjFREP2 was incubated with V. anguillarum or S. aureus and then injected into M. japonicas. The hemolymph was draw out and cultured on the LB plate for bacterial count. GST was used as control. (C). Efficiency of MjFREP2 interference was detected through mRNA and protein levels. (D) and (E). After RNAi of MjFREP2 with dsMjfrep2 injection, V. anguillarum or S. aureus were injected into the Mjfrep2-silenced shrimp and same method was used for bacterial count. These results were statistic analyzed by t-test, and significant difference was accepted when *P < 0.05, or when there is extremely significant difference **P < 0.01. The mortality of the FREP2-silenced shrimp challenged by bacteria. (F), efficiency of MjFREP2 interference was detected at mRNA and protein levels. The shrimp was first double injected with dsMjFREP2 to silence the gene and then challenged by V. anguillarium (G) and S. aureus (H). The mortality was monitored every 12 h. Cumulative mortality means total dead shrimp/ total shrimp used in the experiment. DsGFP-injected shrimp were used as control.

3.6. MjFREP2 enhanced the bacterial clearance in vivo If MjFREP2 was upregulated by bacteria challenge and directly bound to the surface of bacteria, what is the function of MjFREP2 in vivo? To answer this question, we performed bacterial clearance experiments. Considering that most of the bacteria were eliminated within 0.5e1 h [22,29], we checked the bacterial clearance rate after a 30 min challenge of rMjFREP2 with V. anguillarum and S. aureus. The results showed that the number of bacteria was quite low in rMjFREP2-coated bacteria compared with the control group (Fig. 6A and B). These results indicated that rMjFREP2 could facilitate bacteria clearance in M. japonicus.

RNAi assay was used to silence MjFREP2. At 24 h after dsMjFREP2 injection, the MjFREP2 was knocked down in the shrimp (Fig. 6F). The shrimp were then infected with V. anguillarum or S. aureus, and bacterial clearance assay was observed. The results showed that bacterial clearance significantly declined in the MjFREP2-silenced shrimp compared with the shrimp with dsGFP injection at 30 min (Fig. 6E). We further analyzed mortality of MjFREP2-silenced shrimp challenged by Vibrio anguilarum or S. aureus. The results revealed that cumulative mortality of MjFREP2-silenced shrimp challenged with V. anguilarum was much more (90.5%) compared with control (38.0%) at 36 h, whereas the shrimp challenged with S. aureus exhibited 85.7% cumulative mortality, while control (shrimp were

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM2977_proof ■ 15 May 2014 ■ 8/9

8

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

injected with dsGFP and challenged with same bacteria) percentage was 46.4% at 48 h (Fig. 6FeH). All of these results suggested that MjFREP2 performed an important function in the antibacterial immunity of M. japonicus. 3.7. MjFREP2 promoted the phagocytosis of hemocytes To understand the reason that MjFREP2 contributed to bacterial clearance, we performed a phagocytosis assay. The FITC labeled bacteria were initially incubated with rMjFREP2 and then injected into the shrimp. Hemocytes were collected and observed under the microscope. The result showed that phagocytic activity of hemocytes was apparently enhanced in comparison with control, and the activity increased as the time went on (Fig. 7). This suggested that MjFREP2 promoted the phagocytosis of hemocytes. 4. Discussion FREPs are present in invertebrates and vertebrates and mainly function as PRRs [3,10]. In the present study, a new FREP from M. japonicus (MjFREP2) was identified and functionally characterized. MjFREP2 was upregulated by bacterial challenge and could bind and agglutinate different bacteria. It can also enhance bacterial clearance by promoting the hemocyte phagocytosis. In our previous study, we identified MjFREP1 in shrimp M. japonicus [21]. Similarities and differences were observed between MjFREP1 and MjFREP2. The two FREPs in the shrimp clustered different subgroups in phylogenetic analysis (Fig. S3). MjFREP1 has no signal peptide in its primary structure and is mainly distributed in the gill, heart, and hepatopancreas. Its expression is increased after bacterial and viral infection. MjFREP2 is shown to have the signal peptide, presented in the tested six tissues including hemocytes hart, hepatopancreas gill, stomach and intestine and upregulated by V. anguillarum and S. aureus challenge. MjFREP1 can bind to Gram-positive bacteria and Gram-negative bacteria by binding to LPS and PGN. MjFREP2 also bind to Grampositive bacteria and Gram-negative bacteria by binding to LPS and PGN and LTA. MjFREP1 can also bind to VP28 of WSSV and may be involved in antibacterial and antiviral defense and MjFREP2 is involved in antibacterial responses. The members of FREP family all contain a common C-terminal FReD, but differ in their N-terminal regions. These domains at Nterminal, when they occur, can be two- or three-stranded coiled coils, simple tethers, fibronectin type III domains (FN3), or collagen domains and others [7]. For example, ficolins are a group of multimeric lectins made up of single subunits and each of which is composed of a collagen-like domain and a fibrinogen-like domain. Tenascins contain EGF-like repeats and fibronectin-III domains except an FReD. Tachylectins consist of a short N-terminal Cyscontaining segment and a C-terminal FreD. Ficolin-like proteins from freshwater crayfish P. leniusculus contain repeated Gln-rich region in the N-terminal and an FReD at C-terminal [19]. Ficolinlike protein in giant freshwater prawn M. rosenbergii has the coiled coil region in the N-terminal and an FReD in the C-terminal [20]. Except the common FReD, the N-terminal unknown region of MjFREP1 is rich of the residue glutamic acid (E) and that of MjFREP2 is rich of glycine (G). Therefore, the MjFREPs are different from other reported FREPs in the primary structure, especially at the Nterminal. In our opinion, the protein superfamily should be named FREPs, standing for fibrinogen-related proteins, to better reflect their conserved structural unit and even evolution history. Using immunocytochemistry, we found that MjFREP2 is located in the cytoplasm of hemocytes and could be transported to the membrane after bacterial challenge. MjFREP2 can be secreted into the hemolymph because MjFREP2 contains a signal peptide.

Fig. 7. MjFREP2 promoted phagocytosis of shrimp hemocytes. (A) RMjFREP2 was incubated with FITC labeled V. anguillarium and then injected into shrimp, hemocytes were collected and hemocytes with labeled bacteria were examined and counted using a microscope. (B) RMjFREP2 was incubated with FITC labeled S. aureus and then injected into shrimp, GST was used as control. The low panel of A or B is the statistic analysis of phagocytosis. Data show the mean  SD of three independent experiments. Results were subjected to t-test analysis, and significant differences were accepted when *P < 0.05, or when there is extremely significant difference **P < 0.01. Bar ¼ 20 mm.

However, we could not detect the protein in the bacterialchallenged hemolymph. To find this protein, we isolated the bacteria present in the shrimp hemolymph for immunocytochemistry analysis. Results showed that MjFREP2 did bind to the surface of bacteria in the hemolymph (Fig. 5C). After stimulation of LPS, the

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55

YFSIM2977_proof ■ 15 May 2014 ■ 9/9

J.-J. Sun et al. / Fish & Shellfish Immunology xxx (2014) 1e9

binding signal on the surface of bacteria became stronger. Therefore, MjFREP2 secreted from hemocytes bound to the bacteria in the hemolymph. We know that the hemocyte phagocytosis plays an important role in the innate immunity of shrimp [30]. To further study the function of MjFREP2 after binding to pathogens, we conducted bacterial clearance and hemocyte phagocytosis assays. The injected MjFREP2 (a kind of overexpression) can enhance bacterial clearance and promote phagocytic activity of hemocytes. However, the abilities of MjFREP2 were impaired after knockdown of MjFREP2. To further confirm these results, we analyzed the cumulative mortality of MjFREP2-silenced shrimp, and the result showed that mortality was significantly higher than that of the control group. This result also suggested that the binding of MjFREP2 to pathogens could initiate antibacterial responses by facilitating bacterial phagocytosis; this protein may also function as one of the PRRs or as an opsonin in immune response. Our study may contribute to better understand the ability of MjFREP2 to promote phagocytic activity in hemocytes and enhance clearance of bacteria in the immune responses. In summary, our study suggested that MjFREP2 could recognize the invading pathogens in M. japonicus and facilitate bacterial clearance by promoting bacterial phagocytosis of hemocytes. Acknowledgments This study was supported financially by the National Natural Science Foundation of China (Grant No. 31130056), National Basic Research Program of China (973 Program, Grant No. 2012CB114405), Ph.D. Programs Foundation of the Ministry of Education of China (Grant No. 20110131130003), and the Provincial Natural Science Foundation of Shandong, China (Grant No. ZR2011CM014). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2014.05.005. References [1] Christophides GK, Vlachou D, Kafatos FC. Comparative and functional genomics of the innate immune system in the malaria vector Anopheles gambiae. Immunol Rev 2004;198:127e48. [2] Wang XW, Wang JX. Pattern recognition receptors acting in innate immune system of shrimp against pathogen infections. Fish Shellfish Immunol 2013;34:981e9. [3] Adema CM, Hertel LA, Miller RD, Loker ES. A family of fibrinogen-related proteins that precipitates parasite-derived molecules is produced by an invertebrate after infection. Proc Natl Acad Sci U S A 1997;94:8691e6. [4] Gorbushin AM, Panchin YV, Iakovleva NV. In search of the origin of FREPs: characterization of Aplysia californica fibrinogen-related proteins. Dev Comp Immunol 2010;34:465e73. [5] Lu J, Le Y. Ficolins and the fibrinogen-like domain. Immunobiology 1998;199: 190e9.

9

[6] Zhang SM, Leonard PM, Adema CM, Loker ES. Parasite-responsive IgSF members in the snail Biomphalaria glabrata: characterization of novel genes with tandemly arranged IgSF domains and a fibrinogen domain. Immunogenetics 2001;53:684e94. [7] Doolittle RF, McNamara K, Lin K. Correlating structure and function during the evolution of fibrinogen-related domains. Protein Sci 2012;21:1808e23. [8] Hanington PC, Zhang SM. The primary role of fibrinogen-related proteins in invertebrates is defense, not coagulation. J Innate Immun 2011;3:17e27. [9] Matsushita M, Fujita T. The role of ficolins in innate immunity. Immunobiology 2002;205:490e7. [10] Runza VL, Schwaeble W, Mannel DN. Ficolins: novel pattern recognition molecules of the innate immune response. Immunobiology 2008;213:297e 306. [11] Zhang XL, Ali MA. Ficolins: structure, function and associated diseases. Adv Exp Med Biol 2008;632:105e15. [12] Endo Y, Matsushita M, Fujita T. Role of ficolin in innate immunity and its molecular basis. Immunobiology 2007;212:371e9. [13] Hein E, Bay JT, Munthe-Fog L, Garred P. Ficolin-2 reveals different analytical and biological properties dependent on different sample handling procedures. Mol Immunol 2013;56:406e12. [14] Dong Y, Dimopoulos G. Anopheles fibrinogen-related proteins provide expanded pattern recognition capacity against bacteria and malaria parasites. J Biol Chem 2009;284:9835e44. [15] Gokudan S, Muta T, Tsuda R, Koori K, Kawahara T, Seki N, et al. Horseshoe crab acetyl group-recognizing lectins involved in innate immunity are structurally related to fibrinogen. Proc Natl Acad Sci U S A 1999;96:10086e91. [16] Kairies N, Beisel HG, Fuentes-Prior P, Tsuda R, Muta T, Iwanaga S, et al. The 2.0-A crystal structure of tachylectin 5A provides evidence for the common origin of the innate immunity and the blood coagulation systems. Proc Natl Acad Sci U S A 2001;98:13519e24. [17] Rini JM, Lobsanov YD. New animal lectin structures. Curr Opin Struct Biol 1999;9:578e84. [18] Thomsen T, Schlosser A, Holmskov U, Sorensen GL. Ficolins and FIBCD1: soluble and membrane bound pattern recognition molecules with acetyl group selectivity. Mol Immunol 2011;48:369e81. [19] Wu C, Soderhall K, Soderhall I. Two novel ficolin-like proteins act as pattern recognition receptors for invading pathogens in the freshwater crayfish Pacifastacus leniusculus. Proteomics 2011;11:2249e64. [20] Zhang XW, Wang XW, Huang Y, Hui KM, Shi YR, Wang W, et al. Cloning and characterization of two different ficolins from the giant freshwater prawn Macrobrachium rosenbergii. Dev Comp Immunol 2014;44:359e69. [21] Chai YM, Zhu Q, Yu SS, Zhao XF, Wang JX. A novel protein with a fibrinogenlike domain involved in the innate immune response of Marsupenaeus japonicus. Fish Shellfish Immunol 2012;32:307e15. [22] Shi XZ, Wang L, Xu S, Zhang XW, Zhao XF, Vasta GR, et al. A galectin from the kuruma shrimp (Marsupenaeus japonicus) functions as an opsonin and promotes bacterial clearance from hemolymph. PLoS One 2014;9:e91794. [23] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 2013;30:2725e9. [24] Du XJ, Wang JX, Liu N, Zhao XF, Li FH, Xiang JH. Identification and molecular characterization of a peritrophin-like protein from fleshy prawn (Fenneropenaeus chinensis). Mol Immunol 2006;43:1633e44. [25] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680e5. [26] Zhang H, Wang L, Song L, Song X, Wang B, Mu C, et al. A fibrinogen-related protein from bay scallop Argopecten irradians involved in innate immunity as pattern recognition receptor. Fish Shellfish Immunol 2009;26:56e64. [27] Zong R, Wu W, Xu J, Zhang X. Regulation of phagocytosis against bacterium by Rab GTPase in shrimp Marsupenaeus japonicus. Fish Shellfish Immunol 2008;25:258e63. [28] Wang S, Chen AJ, Shi LJ, Zhao XF, Wang JX. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response. PLoS One 2012;7:e30057. [29] Haine ER, Moret Y, Siva-Jothy MT, Rolff J. Antimicrobial defense and persistent infection in insects. Science 2008;322:1257e9. [30] Wang XW, Zhao XF, Wang JX. C-type lectin binds to beta-integrin to promote hemocytic phagocytosis in an invertebrate. J Biol Chem 2014;289:2405e14.

Please cite this article in press as: Sun J-J, et al., A fibrinogen-related protein (FREP) is involved in the antibacterial immunity of Marsupenaeus japonicus, Fish & Shellfish Immunology (2014), http://dx.doi.org/10.1016/j.fsi.2014.05.005

56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110