A fifth human cytomegalovirus glycoprotein B genotype

0 INSTITLJTPASTEURELSEVIER

Res. Virol. 1998, 149, 109-114

Paris 1998

A fifth human cytomegalovirus D.H. Shepp (l) (*), M.E.

Match

glycoprotein B genotype

(l), S.M. Lipson

(‘3 2, and R.G. Pergolizzi

(I) Center for AIDS Research

and Treatment, Division of Infectious Diseases, Department (2) Department of Laboratories and (3) Department of Research, North Shore University Hospital, New York University School of Medicine, Manhasset, NY, USA 11030

c3) of Medicine,

SUMMARY

Genetic variation in glycoprotein B (gB) may play a role in human cytomegalovirus (HCMV) pathogenesis. Using restriction endonuclease digestion and DNA sequencing, a unique gB genotype was identified in eight HCMV strains isolated from five patients with the acquired immune deficiency syndrome. Nucleic acid homology to the four previously described gB genotypes ranged from 79 to 91% for the two major variable regions of gB. Studies of the role of gB in HCMV pathogenesis should recognize the existence of live gB genotypes. Key-words: CMV, AIDS, Glycoprotein;

Genotypes, Human CMV, Glycoprotein B.

INTRODUCTION

Human cytomegalovirus (HCMV) strains can be grouped according to similarities in the DNA and amino acid sequence of certain polymorphic gene regions. The HCMV UL 55 gene encodes glycoprotein B (gB) (Chee et al, 1990) and contains such polymorphic regions (Chou and Dennison, 1991). HCMV gB, a constituent of the viral envelope, is involved in virus cell receptor interactions (Navarro ef al, 1993) and is a major target for host immunologic response (Kniess er al., 1991; Marshall ef al., 1992). Differences in HCMV gB genotype have been associated with varying rates and severity of disease expression in marrow transplant recipients (Fries et al., 1994) and in the acquired immune deficiency syndrome

Submitted

November

(AIDS) (Shepp et aZ., 1996), suggesting gB may be a virulence factor for HCMV. Previously, four distinct HCMV gB genotypes have been described (Chou and Dennison, 1991). This report identifies a fifth gB genotype.

MATERIALS

AND METHODS

HCMV was isolated from clinical specimens in MRC-5 cells as previously described (Lipson et al., 1992). Isolates were stored at -75°C prior to study and were either passaged l-2 times or used directly without further culture. After phenol/chloroform extraction of DNA from infected MRC-5 cells, polymerase chain reaction (PCR) was used to amplify two segments of CMV gB containing the major

5, 1997, accepted January 29, 1998.

(*) Corresponding author: Division of Infectious Diseases, North Shore University Hospital, 300 Community Drive, Manhasset, NY, USA 11030.

D.H. SHEPP

110

sequence variability within this gene (Chou, 1992). The variable region at the 5’ end of the gB open reading frame (ORF) was amplified using the following nested oligonucleotide primers : CB-5 : 5’-CCTCATCGCTGCTGGATT, CB-6 : 5’-TGACTCCCACCACATCTC, CB-7 : 5’-ATTTGGCCCGCGACGAACAT, CB-8 : 5’-CTCCGTACTTGAGGGTAGTG. The sequences of these primers correspond to nucleotides 124-141, 392-409, 139-158 and 375394, respectively, of the gB gene (Cranage et al., 1986). The product amplified by the inner primers varies in size from 250 to 256 bp for the previously described gB genotypes (Chou, 1992). A second variable region flanking the gp55 cleavage site was amplified by PCR using nested oligonucleotide primers, as previously described (Shepp et al., 1996). This segment varies in size between 550556 bp (Chou and Dennison, 1991). Precautions to avoid PCR contamination were observed (Kwok and Higuchi, 1989). The HCMV gB genotype was determined by analysis of fragment sizes generated by digestion of the PCR product amplified from the gp55 cleavage site variable region with the restriction endonuclease Mae111 (Boehringer Mannheim, Indianapolis IN) as previously described (Shepp et al., 1996). DNA sequences were determined by the cycle sequencing method (Lee et al., 1992) using an automated DNA sequencer (model 373A, Applied Biosystems, Foster City, CA). The consensus sequence for HCMV gB genotypes 3 and 4 was derived from sequences 326, 354, 359, 191 and 128 (GenBank accession numbers M60928, M60933, M60934, M60926 and M60924) (Chou and Dennison, 1991) and 2614-92, 918-91, 2563-92, 219-92, 2093-93, 1218-91, 2515-92, 75-94, 419-91, 171291, 1553-91 (GenBank accession numbers U88697, U88693, AFO43073, U88695, U88699, AF043076, AF043077, AF043075, U88704, U88702, AFO43074, U88700, U88703, U88701, AF043080) included in a previous report (Shepp et al., 1996).

RESULTS Figure 1 shows the novel pattern of fragment sizes seen after Mae111 digestion of the PCR product amplified from the gp55 cleavage site

AIDS bp @ HCMV

= = = =

acquired immunodeficiency base pair. glycoprotein B. human cytomegalovirus.

syndrome.

ET AL.

variable region for three strains of HCMV isolated from three patients with AIDS. This pattern was first seen during genotyping of more than 100 HCMV isolates (author’s unpublished data). Isolates 556-91 and 1637-92 were recovered from gastrointestinal biopsies and 2145-92 from peripheral blood polymorphonuclear leukocytes (PBPLs). The pattern of fragment sizes (362, 138, 50) is distinct from those seen with gB genotype 1 (281, 138, 137), genotype 2 (188, 138, 137, 90) and genotype 4 (216, 202, 138) and is distinguished from genotype 3 pattern (362, 188) by the presence of a second Mae111 site (fig. 2). Five additional isolates having the same novel pattern of fragment sizes also were identified (data not shown). Two (216-91 and 1568-93) were isolated from the PBPLs of two additional patients with AIDS. One (2424-92)

was recovered

from

the bron-

choalveolar lavage fluid of the patient from whom 2145-92 was isolated and two (125-91 and 93 l-9 1) were isolated from the throat and PBPLs, respectively, of the patient from whom 556-9 1 was obtained. The DNA sequence of both variable regions was determined for isolates 556-91, 1637-92, 2145-92, 2424-92, 1568-93 and 216-91 (Genbank accession numbers U88705, AF043083, U88696, AF04308 1, U88698, AF043079, U88694, AF043078, AF043720, AF043072, AF043721, AFO43082). The sequences were distinct from those of the previously

described

gen-

otypes (fig. 2). The consensus of these six sequences was compared to the consensus sequences for the previously described HCMV gB genotypes (table I). Homology of the consensus DNA sequence of the 5’ variable region was closest to genotype 1 (89.4%). The size of the amplified fragment was distinct from those of the previously recognized genotypes (262 bp). Compared to gB genotype 1, a 9-bp insertion was

identified

between

nucleotides

(fig. 2A). The last three nucleotides

HIV ORF PBPL PCR

= = = =

human immunodeficiency virus. open reading frame. peripheral blood polymorphonuclear polymerase chain reaction.

84 and 85

of this inser-

leukocyte.

A FIFTH

HUMAN

CYTOMEGALOVIRUS

2

GLYCOPROTEIN

B GENOTYPE

111

In contrast, homology of the consensus DNA sequence of the gp55 cleavage site region was closest to genotype 3 (90.5%) and the size of the amplified fragment was identical (550 bp). Homology was significantly greater over the first 230 nucleotides than over the remaining 284 nucleotides (96.5 % vs. 85.9% ; p < 0.001, chi-squared test). DNA homology to the other 4 previously described gB genotypes was lower (table IB). Homology to a recently described gp55 cleavage site region variant of genotype 1 (Rasmussen et al., 1997) was 79.8%. Amino acid homology to genotype 3 was 95.9%, with all seven coding changes appearing in the second half of the gene fragment (fig. 2B). For both variable regions, amino acid and DNA homology among the six genotype 5 isolates was 2 99%. Intragenotypic variability was found at loci different from those associated with intergenotypic variability.

13

DISCUSSION

5

Fig. 1. Ethidium-bromide-stained gel showing patterns of DNA fragments following digestion of PCR-amplified gB gene segments with the restriction endonuclease Mu&I. Lane 1 =Phi Xl74 RF DNA-Hue111 digest; lanes 2-4= gB group 5 clinical isolates 556-91, 214592, 1637-92; arrows indicate fragment sizes (bp) characteristic of this gB group; lane 5 = pBR322 DNA-MspI digest ; lanes 6-9 = control digests of HCMV isolates belonging to gB group 1, 2, 3 and 4, respectively, as determined previously by DNA sequencing (Shepp et al., 1996).

tion are also characteristic of the other three previously described genotypes, but the first 6 nucleotides are unique to this novel genotype. In addition to the corresponding 3 amino acid insertion, 6 other amino acid coding changes were seen. Overall amino acid homology to genotype 1 in this region was 86.8%.

In a previous study, HCMV gB genotyping using restriction endonuclease Mae111 digestion of the PCR-amplified gp55 cleavage site variable region reliably identified one of four established gB genotypes (Shepp et al., 1996). During expanded studies, a fifth gB genotype of HCMV was suspected based on the appearance of a novel fragment pattern. DNA sequencing of six of these isolates confirmed a unique sequence encoding both an extra Mae111 site and seven amino acid substitutions within this gene region, and a unique, divergent sequence in the other major variable region of gB. One isolate (2145-92), classified in our previous study as a variant of genotype 3 on the basis of DNA sequence alone, was then recognized as belonging to this new genotype. The divergence of this novel genotype from its closest homologues in both variable regions studied is greater than the divergence among several of the other four genotypes. Divergence of this fifth genotype from the other four genotypes also exceeds the divergence of the recently described variant of gen-

112

D.H. SHEPP ET AL.

*......................... TGGLV”I*PGII*IS :I, L ACACGCGGTCTGGTGGTGTTCTGGCAAGGTA?CAAGC~G~AATCTCTGTTGGA~TTAG~ACGTTTAGC~AATAGCTCTGGTGTAAACGCTACGCGT -------*------2’--------C-G--------G--~--------C-----G---T-C-------------------------T--------.. _______--:-...:...-...-...;...-...:..;:

1

L

I

It

L

A:.SSGVWATR

-

-455 -1365 -

-

-

-

-

8

-

-

~RS~R8T~r”TT*bsLI*D8”~~“~T~*~G~T -.*~GA~GCAAG~G**GC~C~.~=**C~~T~CG~CT*CCCT~TCGCTGG*G**CG~T*CGGT~CG~~GTGTGCTTT*CGCCC*GCTGC~GTTT*CC . ..----C---------=--G . ..GG---------c-----G-----*--~-G---~--*-------~--~---c-----*-----------c--=-*----=G--------81---R---------------

-481 -1161

YDTLRWYIWPALA**AR*WC”~*~~T~~“~~= TACGICICGTTGCGCAACTIC*TT~*CCGGGCGCTGGC*C~G~TCGCCG~~GCCTGGTGCGTGG*TC**CGGC.GC~CTCT*G*GGTTTTC***G~* --*--*----------G------C--*--T----*----G-----------G----.---*-----------------C--------C-----G--_ _ _ _ _ 8 _ _ _ _ _ __ __

-519 -1557

LSKIYPSIILSAI CTCAGCAAGATTAACCCGTCAGCCATTCTCTCAGCC~TC -----------C--T--~--------------G----_________-_-

Fig. 2. Consensus nucleotide

.

_

_

_

_

_

_

_

_

_

-

-

-

-

-

-

-

-532 -1596

and encoded amino acid sequence of two variable regions of a novel fifth HCMV gB genotype.

Nucleotide and amino acid numbering corresponds to the published sequence for HCMV (Spaete et al., 1988). Symbols used: -=sequence homology; * = nucleotide deletion ; X = amino acid deletion. A) The variable region at the 5’ end of the gB ORF shown aligned with the corresponding consensus nucleotide and amino acid sequences for HCMV gB genotype 1 (Spaete et al., 1988). B) The variable region flanking the gp55 cleavage site shown aligned to the consensus nucleotide and amino acid sequences for HCMV gB genotype 3. There is a deletion at nucleotides 1522-1524 for both gB genotypes 3 and 5. Recognition sites for restriction endonuclease Mae111 (GTXAC) are indicated by the bars. The dashed box indicates sequences corresponding to primers gB1319 and gB1319N, used in another genotyping system (Chou and Dennison, 1991; Rasmussen et al., 1997).

otype 1 (Rasmussen et al., 1997), which is 97.1% homologous to gB genotype 1 in the region flanking the gp55 cleavage site and 100% homologous to genotype 1 in the 5’ variable region. Because the pattern of homology to previously described genotypes differed for the two gene regions examined, this fifth HCMV genotype may have arisen via recombination.

Previous studies have determined the gB genotype of HCMV isolates, but have not identified this novel variant (Chou and Dennison, 1991 ; Fries et aZ., 1994 ; Rasmussen et al., 1997 ; Vogelberg er al., 1996; Zipeto et al., 1995). Several potential explanations for the failure of previous studies to identify this genotype can be offered. First, this genotype is unusual, constituting approximately 5 percent of isolates from patients

A FIFTH Table

B

CYTOMEGALOVIRUS

I. Percent amino acid (italics) and DNA homology among HCMV gB genotypes.

gB Genotype A

HUMAN

1

2

3

4

5

2 3 4 5

74.0 74.0 76.4 86.8

79.5 loo 90.0 74.4

79.5 100 90.0 74.4

81.5 92.6 92.6 73.0

89.4 79.5 79.5 79.4 -

1 2 3 4 5

9F4 86.1 94.8 83.8

91.7 85.5 92.5 83.1

81.9 85.1 84.4 95.9

92.9 89.6 81.3 84.5

80.3 83.2 90.5 80.6 -

1

-

Sequences for gB genotypes 1 and 2 were those for HCMV strains Towne (Spaete et al.. 1988) and AD169 (Cranage ef al.. 1986). Consensus DNA sequences for gB genotypes 3 and 4 were derived as described in the text. The two major regions of sequence variability within gB were examined: A) variable region at the 5’ end of gB ; B) variable region flanking the gp55 cleavage site.

GLYCOPROTEIN

113

B GENOTYPE

amplification of this novel genotype ficult using these primers.

may be dif-

An increasing body of data suggests that HCMV gB genotype distribution differs according to patient group and sexual practices, and that the occurrence and severity of HCMV disease is influenced by the gB genotype (Fries et al., 1994 ; Rasmussen et al., 1997 ; Shepp et al., 1996). However, the pathophysiologic mechanisms that account for such differences are unknown. Future investigations should seek to identify differences in viral growth characteristics or tissue tropism, or in host immunologic response which may account for such differences in disease expression. Such studies should include all five gB genotypic variants.

Acknowledgments This work was supported by the JaneandDayton Brown andDayton T. Brown, Jr. Virology LaboratoryFund.

with human immunodeficiency virus (HIV) infection, and has not to date been identified among isolates from other patient groups (author’s unpublished data). Only one previous study has examined a meaningful number of isolates from patients with HIV infection (Rasmussen er al., 1997). Geographic differences in the prevalence of this genotype may exist. Isolates in the present study were obtained from patients in the New York region, while the previous study (Rasmussen et al., 1997) examined isolates from California. Previous studies also performed genotyping using different PCR primers and digestion with two different restriction endonucleases, Hi&I and RsaI. The portion of the fifth gB genotype flanked by those primers lacks an RsaI site found in gB genotype 3 and should therefore generate a unique pattern upon digestion. However, one of the PCR primers used with that genotyping system (gB 13 19) (Chou and Dennison, 1991) and a subsequent modification of it (gB 13 19N) (Rasmussen et al., 1997) span a region of sequence divergence within the gp55-cleavage site variable region of gB genotype 5. These primers contain 3 and 4 mismatches, respectively, relative to genotype 5, including 1 at the 3’ end (fig. 2B). Therefore,

Un cinquiSme gCnotype de la glycoprotiine du cytom&galovirus humain

B

La variation genetique de la glycoproteine

peut jouer

un role

B (gB) dans la pathogen&se du

cytomegalovirus humain (CMVH). A l’aide d’une digestion par endonuclease de restriction et d’un skquen9aged’ADN, un genotype unique de la gB a Cte identifie dans huit souches isol&s provenant de cinq patients atteints du syndrome d’immunodeficience acquise. L’homologie de l’acide nucleique des quatre genotypes antkieurement d&its varie de 79 a 91% pour les 2 regions variables majeures de la gB. Les etudes sur le role de la gB dans la patho genbse du CMVH devraient accrediter l’existence d’un cinquieme genotype de la gB. Mats-cl&s: CMV, SIDA, Glycoproteine Genotypes, CMV humain, Glycoprottine B.

;

References Chee, M.S., Bankier, A.T., Beck, S., Bohni, R., Brown, C.M., Cemy, R., Horsnell, T., Hutchison, C.A. III, Kouzarides,

T., Martignetti,

J.A.,

Preddi,

E., Satch-

114

D.H. SHEPP ET AL.

well, SC., Tomlinson, P., Weston, K.M. & Barrel, B.G. (1990), Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr. Top. Microbial. Immunol., 154, 125169. Chou, S. & Dennison, K.M. (1991), Analysis of interstrain variation in cytomegalovirus glycoprotein B sequences encoding neutralization-related epitopes. J. Infect. Dis., 163, 1229-1234. Chou, S. (1992), Comparative analysis of sequence variation in gpl16 and gp55 components of glycoprotein B of human cytomegalovirus. Virology, 188, 388390. Cranage, M.P., Kouzarides, T., Bankier, A.T., Satchwell, S., Weston, K., Tomlinson, P., Barrel, B., Hart, H., Bell, S.E., Minson, A.C. & Smith, G.L. (1986), Identification of the human cytomegalovirus glycoprotein B gene and induction of neutralizing antibodies via its expression in recombinant vaccinia virus. EMBO J., 5, 3057-3063. Fries, B.C., CHou, S., Boeckh, M. & Torok-Storb, B. (1994), Frequency distribution of cytomegalovirus envelope glycoprotein genotypes in bone marrow transplant recipients. J. Infect. Dis., 169, 769-774. Kniess, N., Mach, M., Fay, J. & Britt, W.H. (1991), Distribution of linear antigenic sites on glycoprotein gp55 of human cytomegalovirus. J. Virol., 65, 138-146. Kwok, S. & Higuchi, R. (1989), Avoiding false positives with PCR. Nature (Lond.), 339, 237-238. Lee, L.G., Connell, CR., Woo, S.L., Cheng, R.D., McArdle, B.F., Fuller, C.W., Halloran, W.D. & Wilson, R.K. (1992). DNA sequencing with dye-labeled terminators and T7 DNA polymerase: effect of dyes and dNTP’s on incorporation of dye-terminators and probability analysis of termination fragments. Nucleic Acids Res., 20, 2471-2483. Lipson, S.M., Kaplan, M.H., Simon, J.K., Ciamician, Z. & Tseng, L.-F. (1992), Improved detection of cytome-

galovirus viremia in AIDS patients using shell vial and indirect immunoperoxidase methodologies. J. Med. Virol., 38, 36-43. Marshall, G.S., Rabalais, G.P., Stout, G.G. & Waldeyer, S.L. (1992), Antibodies to recombinant-derived glycoprotein B after natural human cytomegalovirus infection correlate with neutralizing activity. J. Infect. Dis., 165, 381-384. Navarro, D., Paz, P., Tugizov, S., Topp, K., LaVail, J. & Peira, L. (1993), Glycoprotein B of human cytomegalovirus promotes virion penetration into cells, transmission of infection from cell to cell, and fusion of infected cells. Virology, 197, 143-158. Rasmussen, L., Hong, C., Zipeto, D., Morris, S., Sherman, D., Chou, S., Miner, R., Drew, W.L., Wolitz, R., Dowling, A., Warford, A. & Merigan, T.C. (1997), Cytomegalovirus gB genotype distribution differs in human immunodeficiency virus-infected patients and immunocompromised allograft recipients. J. Infect. Dis., 175, 179-184. Shepp, D.H., Match, ME., Ashraf, A.B., Lipson, S.M., Millan, C. & Pergolizzi, R. (1996), Cytomegalovirus glycoprotein B groups associated with retinitis in AIDS. J. Infect. Dis., 174, 184-187. Spaete, R.R., Thayer, R.M., Probert, W.S., Marsiarz, F.R., Chamberlain, S.H., Rasmussen, L., Merigan, T.C. & Pachl, C. (1988), Human cytomegalovirus strain Towne glycoprotein B is processed by proteolytic cleavage. Virology, 167, 207-225. Vogelberg, C., Meyer-Konig, U., Hufert, F.T., Kirste, G. & von Laer, D. (1996), Human cytomegalovirus glycoprotein B genotypes in renal transplant recipients. J. Med. Viral., 50, 31-34. Zipeto, D., Morris, S., Hong, C., Dowling, A., Wolitz, R., Merigan, T.C. & Rasmussen, L. (1995), Human cytomegalovirus (CMV) DNA in plasma reflects quantity of CMV DNA present in leukocytes. J. Clin. Microbial., 33, 2607-2611.