A flock of sheep, goats and cattle: ancient DNA analysis reveals complexities of historical parchment manufacture

Journal of Archaeological Science 37 (2010) 1317–1325

Contents lists available at ScienceDirect

Journal of Archaeological Science journal homepage: http://www.elsevier.com/locate/jas

A flock of sheep, goats and cattle: ancient DNA analysis reveals complexities of historical parchment manufacture Michael G. Campana a, *, Mim A. Bower b, Melanie J. Bailey c, Frauke Stock d, Tamsin C. O’Connell a, b, Ceiridwen J. Edwards e, Caroline Checkley-Scott f, Barry Knight g, Matthew Spencer h, Christopher J. Howe i a

Department of Archaeology, University of Cambridge, Downing Street, Cambridge CB2 3DZ, UK McDonald Institute for Archaeological Research, University of Cambridge, Downing Street, Cambridge CB2 3ER, UK University of Surrey Ion Beam Centre, Guildford GU2 7XH, UK d Smurfit Institute of Genetics, Trinity College, Dublin 2, Ireland e Research Laboratory for Archaeology and the History of Art, University of Oxford, Dyson Perrins Building, South Parks Road, Oxford OX1 3QY, UK f The John Rylands University Library, University of Manchester, 150 Deansgate, Manchester M3 3EH, UK g Collection Care Department, The British Library, 96 Euston Road, London NW1 2DB, UK h School of Biological Sciences, University of Liverpool, Biosciences Building, Crown Street, Liverpool L69 7ZB, UK i Department of Biochemistry, University of Cambridge, Downing Site, Tennis Court Road, Cambridge CB2 1QW, UK b c

a b s t r a c t Keywords: Ancient DNA Historic DNA Parchment Skin materials DNA preservation Jumping PCR

Parchments comprise one of the most common and valuable sources of archaeological and historical data. Previous studies have shown that parchment also preserves genetic data. These data could be valuable for population studies, to understand past animal husbandry, the development of breeds and varieties and to comment on the provenance of parchments. To improve our understanding of DNA contained in parchments, we analysed genetic data, including both mitochondrial and autosomal loci, from 18th to 19th century English parchments which stable isotope analysis had indicated were wellpreserved. DNA results were unexpected. All but one of the parchments produced multiple sequences matching several different species. Ion beam analysis ruled out surface treatments of the parchments (including ink and animal glues) as the origin of these multiple sequences. Our results suggest that the DNA content of parchment is more complex than previous research has suggested and that multiple stages of parchment manufacture, treatment and storage are preserved in parchment DNA extracts. Ó 2009 Elsevier Ltd. All rights reserved.

1. Introduction Parchment is one of the most common and versatile materials in the historical record. Derived from depilated animal skins that have been stretched, dried and scraped to form stiff, durable sheets, parchments provide excellent, long-lasting surfaces for writing and artwork. Because of their durability and abundance, parchments provide a vast wealth of historical information, from the lifes and deaths of kings to the development of calligraphic and artistic styles. Recently, there has been interest in extracting and analysing DNA from parchments (e.g. Bar-Gal et al., 2001; Burger et al., 2000, 2001; Poulakakis et al., 2007; Woodward et al., 1996). These data could permit us to investigate numerous questions of both

* Corresponding author. Tel.: þ44 1223 339327; fax: þ44 1223 339285. E-mail address: [email protected] (M.G. Campana). 0305-4403/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.jas.2009.12.036

historical and scientific significance. For instance, many parchments are produced in ways (e.g. by splitting of the skins) that prevent easy identification of their source species by the hair grain pattern (Reed, 1972). Genetic analysis could be used to identify not only the species, but in principle, the variety or source population of the original skin. Because of the abundance of parchments, they might also be used to study population evolution over time and track the development of modern breeds and varieties. Despite the number of publications, we have little understanding of the DNA content of parchment, and we are unable to predict which samples are likely to yield genetic information (Bower et al., 2009). This introduces a limitation, since, to date, ancient parchment DNA analysis protocols are destructive. Therefore there is a justified reluctance to commit valuable manuscripts to genetic screening, despite the potential value of the information that may be gleaned from them. Improving our understanding of parchment’s DNA content would allow us to develop a predictive model for sampling of historic manuscripts.

1318

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325

We report here a study of a set of 18th–19th century English manuscripts. Previous research (e.g. Burger et al., 2001) suggested that both mitochondrial and autosomal DNA may be wellpreserved in this material. As in previous studies (e.g. Bar-Gal et al., 2001), we analysed the cytochrome b gene (CytB) and mitochondrial DNA control regions (D-loop) to identify the source species of our samples and evaluate the nature of DNA in the parchments. We also trialled STRs for species identification on a subset of our samples (as in Burger et al., 2000, 2001). We also measured the parchments’ stable carbon and nitrogen isotope ratios to gain further information on their composition and origin. Carbon and nitrogen isotopic ratios can be used to narrow the range of candidate source species of a parchment, since they reflect diet (Schwarcz and Schoeninger, 1991). Percentage nitrogen can inform on the nature of the collagen in the parchment. This is a potentially valuable assay, since DNA is unlikely to be preserved in environments where more stable biomolecules, such as collagen, are not (Cooper and Poinar, 2000; Poinar et al., 1996; Kaufmann et al., 2002). Moreover, since parchment is comprised almost exclusively of collagen, it should possess C/N ratios very similar to pure ‘collagen’ (Haines, 1999; Ambrose, 1990). Finally, we conducted ion beam analysis to investigate possible surface treatments of the parchments (for example, treatments containing animal products) that might contribute to the endogenous DNA profile and affect species identification. Ion beam analysis comprises a variety of techniques utilising an ion beam accelerated to MeV energies to excite the surface of a sample. The resulting X-ray and backscattered particle spectra are used to determine the elemental composition of the sample. Ion beam analysis techniques are well established for detection of surface treatments on materials of historical interest, including parchments (see Vodopivec et al., 2005). Moreover, these techniques are nondestructive, which is necessary for analysing valuable manuscripts. Here, we present the results of our multidisciplinary study to improve our understanding of the DNA content in parchments, and assess their potential as a repository of genetic information. 2. Materials Thirteen historic parchments dating from 1730 to 1830 were obtained from G. David Booksellers, Cambridge (Table 1). These consisted of legal documents of little historical or monetary value (e.g. marriage licences and housing deeds). Several of the 13 individual parchments had previously been grouped to form single documents. We treated the individual parchments that comprised these documents as separate samples. One document (1730) comprised two parchments (1730A and 1730B). One document (1829) comprised five parchments (1829A–1829E). The 1763 package consisted of one manuscript containing two attached parchments (1763A and 1763B) and two unattached, unrelated manuscripts (1763C and 1763D). Where necessary, modern parchments from domestic cattle (Bos taurus; sample COW), sheep (Ovis aries; sample SHP) and goat (Capra hircus; sample GOT) were analysed for comparison. 3. Parchment analysis methods

Table 1 Composition of samples under investigation by identified sequences. Sample

Date

Sequence

1730Aa 1730Ba 1763A

1730 1730 1763

1763B

1763

1763C

1763

1763D

1763

1814a 1829A

1814 1829

1829B

1829

1829C

1829

1829D

1829

1829E

1829

1830a COW SHPa GOTa

1830 Modern Modern Modern

Bovid (probably Bos Bovid (probably Bos Ovis aries Capra hircus Homo sapiens Bos taurus Artefactsb Capra hircus 1 Capra hircus 2 Capra hircus 3 Capra hircus 4 Artefacts Bos taurus Artefacts Ovis aries Capra hircus Artefacts Bovid (probably Bos Ovis aries 1 Ovis aries 2 Capra hircus 1 Capra hircus 2 Capra hircus 3 Artefacts Capra hircusb Homo sapiens Artefactsb Ovis aries 1 Ovis aries 2 Homo sapiens Artefacts Ovis aries Capra hircus Artefacts Ovis aries 1b Ovis aries 2 Capra hircus Bos taurus Artefactsb Bovid (probably Bos Bos taurus No amplification No amplification

Total % sequence taurus) taurus)

taurus)

taurus)

100 100 19 17 7 24 33 64 14 4 4 14 67 33 60 10 30 100 8 8 8 8 58 8 55 5 40 20 10 10 60 27 9 64 11 9 5 55 20 100 100 N/A N/A

All of the artefact sequences are lumped together. a Samples were only included in the CytB experiments. Except in samples solely investigated in the CytB experiments, identifications are based on the clonal sequences from the D-loop experiments. If multiple distinct sequences from a single species were identified in a sample, these sequences have been scored individually. b Sequences were obtained in two independent laboratories, although not all of the individual distinct artefact sequences were replicated for any of these extracts. Total values may not equal 100% because of rounding.

Godwin Laboratory (Department of Earth Sciences, University of Cambridge). Stable isotope concentrations are measured as the ratio of the heavier isotope to the lighter isotope relative to an internationally defined standard, Pee Dee Belemnite (VPDB) for carbon, and atmospheric nitrogen (AIR) for nitrogen (Hoefs, 1997). Isotopic results are reported as d values (d13C and d15N) in permil (&) values, where d13CVPDB ¼ [(13/12Csample/13/12CVPDB)  1]  1000& and d15NAIR ¼ [(15/14Nsample/15/14NAIR)  1]  1000&. Based on replicate analyses of international and laboratory standards, measurement errors were less than 0.2& for d13C and d15N.

3.1. Stable isotope analysis 3.2. Genetic analysis For each analysis, w1.5 mg of parchment was sampled and weighed precisely into tin capsules. Samples were analysed in triplicate to ensure accuracy. Isotopic analyses were performed using an automated elemental analyser coupled in continuous-flow mode to an isotope-ratio-monitoring mass-spectrometer (Costech elemental analyser coupled to a Finnigan MAT253 mass-spectrometer) at the

All relevant procedures were undertaken to authenticate results (Cooper and Poinar, 2000; Consult Supplementary material for details). DNA extractions were modified from Kalma´r et al. (2000). A 1–200 mm2 piece of parchment was removed with a sterilised scalpel blade or pair of scissors and digested overnight in extraction

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325

buffer. DNA was precipitated in ethanol. The supernatant was removed and the DNA resuspended in highly purified water, pH 8.0. Raw extracts were purified with a QIAquick PCR Purification Kit (Qiagen) as required. PCR cocktails were constructed in a dedicated sterile glove box in the Department of Biochemistry, University of Cambridge. Thermocycling and downstream procedures were conducted at the McDonald Institute for Archaeological Research. Three samples (1763A, 1829B and 1829E) were independently replicated in Dublin. A 149 bp fragment of the bovine CytB gene was amplified with the primers cyBa and cyBb (Burger et al., 2001; Table 2). We then identified the best preserved samples for further study based on the CytB results. A total of 150–370 bp of the D-loop were amplified from nine of the parchments (1763A–D, 1829A–E) using three sets of overlapping primers (systems AN2F-AN1R, ANMF-ANRR and AN2FANRR; Table 2). Finally, pilot STR experiments were conducted on samples 1763A, 1829A and MOD with the markers ETH225, HEL13, INRA005 and INRA063 (FAO, 2004; Kemp et al., 1995; Table 2). PCR products were purified or re-amplified as necessary. MtDNA amplicons were sequenced directly or cloned and sequenced as necessary. Sequences were tentatively identified using BLAST (Altschul et al., 1990). STRs were genotyped on an ABI 3730 sequencer (Applied Biosystems) and analysed with GENEMAPPER 4.0 (Applied Biosystems). 3.3. Phylogenetic analysis D-loop sequences were aligned with MEGA 4.0 (Tamura et al., 2007) based on their BLAST identification and edited by eye. Median-joining networks were constructed with NETWORK 4.5 (Bandelt et al., 1999, www.fluxus-engineering.com). 1152 goat (C. hircus) and 1051 sheep (Ovis aries) sequences that are publicly available (GenBank, Benson et al., 2008; http://www.ncbi.nlm.nih. gov/) were included for comparison. We examined effects of sample size on network topologies by removing arbitrary numbers of GenBank sequences from the alignments. We examined the effects of the rare haplotypes on network topologies by including and excluding these sequences. Networks containing only members of a single species and networks containing members of multiple species were constructed and compared. Both un-rooted and rooted networks were constructed and compared. Rooting was performed with sequences from Barbary sheep (Ammotragus lervia, GenBank accession NC_009510) and domestic cattle (Bos taurus, GenBank accession NC_001567).

1319

samples. Multiple points were analysed on both the front and back of the parchments to control for variation across the surfaces. To gain micrometer resolution and higher accuracy, a selection of samples was analysed using the microbeam line. For each beam line, particle induced X-ray emission (PIXE) and backscattered particle (BS) spectra were simultaneously recorded. 4. Results 4.1. Stable isotope analysis All parchments possessed C/N ratios near that of pure ‘collagen’, indicating the samples were well-preserved. Only two samples (1730A and 1763A) had atomic C/N ratios (3.9 and 3.7 respectively) slightly outside the accepted range of 2.9–3.6 for pure ‘collagen’ (Ambrose, 1990; Supplementary Table 1). These data indicate that our parchments were well-preserved and likely to yield amplifiable DNA. d13C values ranged between 23.2& and 21.6&, while d15N were between þ8.0& and þ14.2& (Supplementary table 1). 4.2. Genetic analyses A total of 19% of CytB and 100% of D-loop PCRs containing parchment extracts yielded amplification products. However, Dloop reactions often produced multiple bands when visualised by ethidium bromide staining under UV light. 4.2.1. Cytochrome b We sequenced directly a total of 14 CytB amplicons from samples 1730A–B, 1763A, 1814, 1829A and 1830. BLAST searches returned the CytB B. taurus reference sequence (GenBank accession NC_001567) as the best match for all amplicons (84% identical). Occasionally, sequences matched the putative Southeast Asian bovid ‘Pseudonovibos spiralis’ equally well, but the database sequence (GenBank accession AF281084) for this species is probably a B. taurus contaminant (Olson and Hassanin, 2003). Very short (<100 bp), poor quality sequences occasionally possessed identity to mammals other than B. taurus and Bos indicus. These may be a result of ‘jumping PCR’ artefacts or nuclear-inserted mitochondrial sequences (numts; see below). w4% of no-template and mock-extract controls were contaminated with bovine DNA (Supplementary material), which is consistent with previous reports indicating that 5% of laboratory reagents are contaminated with these sequences (Leonard et al., 2007). The data from these contaminated set-ups were disregarded.

3.4. Ion beam analysis Ion beam analysis was conducted at the University of Surrey Ion Beam Centre (Simon et al., 2004) using a 2.5 MeV Heþ beam. A first analysis was carried out on the external beam line in order to analyse the large parchments non-destructively, without taking

4.2.2. Mitochondrial control region For 1763A–D, 1829A–E and MOD, we sequenced 228 clones from 20 D-loop PCR products and sequenced directly the products from an additional 15 reactions. A representative sample of sequences has been deposited in GenBank (accessions GU169301–GU169327).

Table 2 Primers used in this study. Marker

Forward primer 50 / 30

Reverse primer 50 / 30

Dye

CytB D-loop D-loop D-loop ETH225 HEL13 INRA005 INRA063

(cyBa) GAATCTGCCTAATCCTACAAATCC (AN2F) GCCCCATGCATATAAGCAAG (ANMF) ATTACCATGCCGCGTGAAACC (AN2F) GCCCCATGCATATAAGCAAG TGCCACTATTTCCTCCAACA TAAGGACTTGAGATAAGGAG CAATCTGCATGAAGTATAAATAT CCCACAAAGTAACGGCATAAA

(cyBb) CTCCGTTTGCGTGTATGTATCG (AN1R) CACGCGGCATGGTAATTAAG (ANRR) TCCATCGAGATGTCTTATTTAAGAGGA (ANRR) TCCATCGAGATGTCTTATTTAAGAGGA TTCTGTGGCATTAGAGAAAGG CCATCTACCTCCATCTTAAC CTTCAGGCATACCCTACACC TGCTTGGAAGAAAGTTTGG

VIC FAM VIC VIC

CytB primers were obtained from Burger et al. (2001). D-loop primers are from Bailey et al. (1996) or R. Bollongino (personal communication, 2007). Primer names for the CytB and D-loop primer pairs are in parentheses before the primer sequences. STR primer sequences were derived from the FAO (2004) and Kemp et al. (1995).

1320

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325

The modern cow parchment yielded a single consistent sequence matching domestic cattle (B. taurus). All of the historic parchments produced multiple distinct clonal sequences. These did not originate from laboratory reagents or contamination by laboratory workers during genetic analysis since reactions using mock extracts and no-template controls did not yield products. A group of sequences possessing 80–88% identity to all pecorans (an artiodactyl clade including the giraffidae, the bovidae, the cervidae, the moschidae and the antelocapridae) in GenBank were found on all historic parchments. These (hereafter referred to as ‘artefact sequences’) typically represented w30% of the clones from a given parchment, and are suspected to be PCR artefacts or numts (see below). Two parchments (1763B and 1763C) gave sequences that matched a single recognizable species (goat and cow respectively), although the goat sequences on 1763B were not identical. Individual clones from other parchments matched more than one recognizable species, namely goat (C. hircus; 93% identity), sheep (O. aries; 100% identity), cow (B. taurus; 100% identity) or human (Homo sapiens; 100% identity; Table 1). In several parchments, independent clones corresponding to the same species were not identical. Sequences from single species were sometimes strongly divergent from one another (up to 10% divergent for sheep and 5% for goats) within individual parchments. However, it was difficult to determine the exact number of distinct haplotypes of any one species on a parchment because certain variant sequences could have been the result of closely related, but distinct, haplotypes or aberrant bases caused by amplification of DNA lesions common in ancient DNA (Pa¨a¨bo et al., 1989; Gilbert et al., 2005). Many of the sequences were shared across multiple parchments. These sequences were not shared across all parchments in each package. The parchments sharing sheep sequences were not the same ones as those sharing goat sequences, and the parchments sharing sequences were not consistently on the outside of the packages (the samples most likely to share sequences between different packages of parchments from surface contact). Blank extractions, in which tubes were left open in the parchment storage cabinet and the laminar flow hood to monitor cross-contamination

between samples, never yielded PCR products. Therefore, these sequences are unlikely to be the result of cross-contamination between samples. Only one parchment (1763C) yielded a single D-loop sequence from a single recognizable species: 24 of 36 clones from two independent 1763C extracts (12 from each extract amplified using two different sets of primers) were identical and matched domestic cow (B. taurus; 100% identity), with the remaining 12 clones consisting of the artefact sequences mentioned above. However, this sequence may not represent a single individual since the majority of European cattle share the same mtDNA sequence (Troy et al., 2001). To test whether some of the extraneous sequences on the other parchments originated from localised treatments such as glue derived from animal products, multiple DNA extractions from across individual parchments (1763A and 1763B) were performed and analysed to investigate whether sequences could be localised to particular parchment areas. No pattern suggesting sequence localisation was identified. 4.2.3. STRs 100% of the STR PCRs gave positive amplification. Although modern parchment produced a clear STR profile, the 1763A and 1829A parchment electropherograms had so many strong peaks it was impossible to determine the alleles or even the number of alleles present in the sample. These could be the result of stutter peaks caused by PCR misamplification or DNA damage, or the presence of multiple individual sequences. Given the mtDNA results, the latter explanation is very likely. 4.3. Ion beam analysis All the parchments in the 1763 package possessed similar elemental spectra (Fig. 1). Even 1763C, the one parchment to possess a single mtDNA sequence from a single identifiable species (see above), did not differ significantly in composition from the other parchments in the package (Supplementary material). The compositions of the 1829 parchments were also similar. When

Fig. 1. PIXE elemental spectra of parchments from the 1763 parchments (top) and 1763A compared to 1829 parchments (bottom). The x-axis is energy, while the y-axis denotes counts in log scale. Individual spectra are represented by different colours. As shown by the top image, the chemical composition is not significantly different between all parchments in the 1763 package. It can be seen in the bottom image that the 1829 parchments (in blue and green) are depleted in sulphur, chlorine and potassium and enriched in copper compared to the 1763 parchments (in black).

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325

1321

Fig. 2. Comparisons of PIXE spectra from four points across the front of parchment 1763A (top) and between the front and back of parchment 1763A (bottom). The x-axis is energy, while the y-axis denotes counts in log scale. The points were adjacent to locations from which DNA was extracted. Individual spectra are represented by different colours. In the bottom image, spectra from the back are in green and blue, while the spectrum from the front is in black. There do not appear to be any significant compositional differences between all of these data points.

comparing between the packages, the 1829 parchments were significantly depleted in light elements (sulphur, chlorine and potassium) and enriched in copper in relation to the 1763 parchments. This compositional difference is probably the result of changing manufacturing methods between 1763 and 1829 or varying procedures used by different manufacturers. Elemental compositions were consistent across multiple points from the same parchment using the external beam line (Fig. 2). No significant differences were detected between the front and back of the parchments (Fig. 2). The depth profiling capability of backscattering analysis detected no evidence of a surface treatment since the spectra were consistent with a substantially uniform elemental composition across the probed depth of several tens of microns. The parchments 1763A and 1763B possessed several glue spots and were written with at least two inks – a rusty, reddish ink and a black ink. The external beam line showed clear compositional differences between the parchments and the inks and glue. The glue spot was enriched in copper. The reddish ink was enriched in iron, while the black ink contained elevated levels of copper and mercury.

To investigate the compositional differences of the inks and glues further, elemental maps were constructed using the microbeam line (Fig. 3, Supplementary Fig. 4). This analysis detected clear differentiations between the elemental compositions of the inks and glue spots versus the areas without these treatments. The glue spots were enriched in copper, silicon, iron, potassium and sulphur (Supplementary Fig. 2). The reddish ink was enriched in sulphur and iron. These elements mapped with the ink and glue spots and had not migrated into the surrounding parchment (Fig. 3). 5. Discussion The identification of multiple sequences pertaining to both multiple species and multiple individuals from single species in our parchment extracts is unexpected. A first possibility is that the DNA in the parchments was not well-preserved and that all the sequences originated from external contamination during storage. One could argue that the parchments’ stable isotopic ratios provide evidence for poor biomolecular preservation. The parchments possessed d15N values (þ8.0& to þ14.2&; Supplementary Table 1) far higher than those that would be expected from the terrestrial

Fig. 3. An inked letter from parchment 1763A under the microscope (left) with fine-scale microbeam mapping of sulphur (centre) and iron (right). Note that the sulphur and iron have not diffused significantly into the surrounding parchment.

1322

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325

herbivores (sheep, goats and cattle) identified on our parchments (typically around 5&). Instead, they cluster with values characteristic of collagen from terrestrial omnivores such as domestic pig or humans (typically around 8&: Hedges et al., 2008; Schoeninger and DeNiro, 1984). The only identified omnivore sequences matched Homo sapiens, an unlikely source material. No sequence matched domestic pig (Sus scrofa), the only domestic omnivore likely to be used for parchment. Current data, however, indicate that liming during parchment production alters the structure of collagen in a variety of ways, including the elimination of the amino acids’ side-chain amides (Haines, 1999). This suggests that the production or treatment of these parchments elevated the d15N values, possibly via the elimination of isotopically light nitrogenous compounds. Nevertheless, these alteration(s) did not significantly affect the C/N ratios, which indicated that our parchments were well preserved and may yield ancient DNA. We confirmed this with the reliable amplification of both mitochondrial and autosomal loci. We anticipated that our results would be similar to those of previously published studies and that our parchment samples would yield single individual sequences, with variation between parchment sheets, but not within a given parchment sheet. Instead, we obtained multiple sequences from each parchment sheet, originating from both multiple individuals within a species and from multiple species. This was particularly clear in the results obtained from the mitochondrial control region. The CytB locus possessed less variation within an individual parchment sheet. Although at first glance the D-loop results appear to contradict the CytB evidence, analysis of our CytB primers using AMPLIFY 1.2 (William Engels, Genetics Department, University of Washington) predicted that they were biased towards the amplification of cattle DNA and would only poorly amplify goat sequences, while not amplifying sheep sequences at all. Tests of CytB primers on the modern parchments confirmed these predictions. This explains the discrepancy in the percentages of positive amplicons in our historic parchment extracts between the CytB (19%) and D-loop (100%) experiments. The specificity of the CytB primers may explain Burger et al. (2000) relatively low success rates using the same primers in recovering DNA from historic parchments (50% of their extracts yielded PCR products) and the absence of multiple distinct sequences in these extracts. Therefore, since the D-loop primers amplified bovine and ovicaprine DNA well, we relied on these for the identification of species on the parchments. 5.1. Network analysis of sequences We compared our parchment D-loop sequences to reference data in the public domain (1051 sheep D-loop sequences and 1152 goat sequences; Fig. 4). Median-joining networks revealed that the most common parchment ‘sheep’ sequence matched (100% identity) only one individual from Tibet (GenBank accession DQ903201; Wang et al., 2007). Given its rarity, the Tibetan sequence is possibly the result of a numt or in situ DNA recombination (Lopez et al., 1996; Pa¨a¨bo et al., 1990). However, since we obtained this sequence from multiple pieces of parchment, it is probably genuinely representative of the animals from which the parchment pieces were derived. The rarer parchment ‘sheep’ sequences fall within sheep clade ‘‘B’’ (Pedrosa et al., 2005). The parchment ‘goat’ sequences clustered by themselves and possessed combinations of mutations that do not appear in known goats (Fig. 4). No modern goat sequence matched the common parchment ‘goat’ sequence with better than 93% identity. This pattern is consistent with the parchment ‘goat’ sequences being the chimeric products of ‘jumping PCR’ (Pa¨a¨bo et al., 1990) and raises questions as to their reliability since ancient DNA results must

Fig. 4. Median-joining networks depicting the relationships of the sheep and goat sequences obtained from the parchments studied to modern sequences from GenBank. Network 1 (top) compares 311 bp of the parchment ‘sheep’ sequences to sheep sequences available from GenBank. In Network 2 (middle), 223 bp of the parchment ‘goat’ sequences are compared to those in GenBank. Network 3 (bottom) includes 217 bp of both the sheep and goat sequences from the previous two networks. Due to computing power limitations, Network 3 does not include rare haplotypes which only appear once in GenBank or on the parchments. Note that the parchment ‘goat’ sequences cluster by themselves.

make phylogenetic sense (Cooper and Poinar, 2000). Nevertheless, there are few publically available goat mtDNA sequences from the British Isles, rendering the omission of rare haplotypes likely. Moreover, the divergence between the parchment sequences and the modern sequences is no greater than between the known goat clades. Since the common parchment goat sequences are present

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325

on multiple parchments and we were able to replicate these sequences in an independent laboratory, it is likely that these sequences are genuinely representative of the animals from which the parchment pieces were derived. 5.2. Origin of the artefact sequences Analysis of the common artefact sequences by BLAST searches using 75 and 100 bp sliding windows indicated that many consisted of mixed goat, sheep, cattle and human sequences, a pattern suggestive of jumping PCR (Pa¨a¨bo et al., 1990). Several of these non-specific sequences appear on multiple parchments, and many share the same sequence structure (in terms of order and mixture of amplified fragments). This may be indicative of DNA damage ‘hotspots’ causing similar jumping PCR patterns (Gilbert et al., 2005). These data suggest that DNAs recovered from parchments may be more liable to the formation of chimeric products than those from other tissues (e.g. bone, hair, seeds). This could be a result of DNA diagenesis within parchments either during manufacture or over time. Alternatively, these sequences may be numts or chimeras of numts and mtDNA sequences in the animals from which the parchments were derived (Lopez et al., 1996). The amplification of numts has been problematic in analyses of closely related bovid species (e.g. Ovibos moschatus; Kolokotronis et al., 2007). Tests of our mitochondrial control region primers on a modern goat extract yielded sequences that were nearly identical (>99% identity) to a few of the artefact sequences. Moreover, some of these sequences were replicated in an independent laboratory. Further work is required to clarify these sequences’ origins. 5.3. A single parchment represents multiple individuals Our parchments might be expected to possess only one distinct sequence since they were made from single skins possessing no signs of repair. However, they yielded sequences of multiple species: sheep, goats, cattle and humans. The human sequences probably originate from handling of the parchments throughout their production and post-production history up to, and including, laboratory storage. We propose four non-mutually exclusive hypotheses to explain the presence of sequences representing multiple individuals: 1. Contamination during long-term storage. 2. One or more preparatory treatment(s) to improve the parchments’ writing surfaces. 3. The glues and inks used in the preparation of the manuscript. 4. The production process of the parchment itself. Hypothesis 1 is unlikely for our experimental parchments. If this were true, we might expect that parchments attached together would share almost identical DNA signatures. Although sequences were shared across the parchments, as discussed above, no parchments possessed the same mixture of sequences (Table 1). Furthermore, in the case of Hypothesis 1, we would expect that all parchments would produce a large quantity of contaminant human DNA (likely to be the most ubiquitous DNA during storage) and that the parchments on the outsides of the packages would probably produce the most human sequences. This was not the case as human sequences were rare (w2% of clones). Finally, such contamination would most likely be near the parchment surface. Since the parchments were surface-cleaned with bleach, ethanol and UV light, surface contamination should have been destroyed before DNA extraction.

1323

Our ion beam data identified no patterns consistent with a preparatory treatment, as mooted in Hypothesis 2. If the parchment were treated, we might expect differences in elemental spectra between points on a single side (due to unequal treatment) or differences between the front sides (the only sides that were written on) and the backs of the parchments (Reed, 1972, 1975). None of these differences was detected (Fig. 2). Similarly, we did not find evidence of ‘pouncing’ (rubbing with pumice which would leave a uniform, fine layer of silica molecules) or treatments with heavy metals (Reed, 1972, 1975). Although silica particles were identified (Supplementary material), they appear to be dirt accumulated on the surface of the parchment rather than evidence of pouncing. Furthermore, we found no difference between sample 1763C (the parchment producing a single sequence) and the remainder of the parchments in the 1763 package. There remains a slight possibility that a completely organic, perfectly uniform treatment that penetrated and affected the entire parchment may have been applied. Since the PIXE set-up we used cannot detect elements lighter than aluminium, while BS detects light elements (carbon, oxygen, etc.), but cannot identify their source compounds, such treatments could escape detection. For instance, these parchments may have been treated with milk, which historically was used in whiteners and preparatives (Reed, 1972, 1975). This could add mtDNA sequences and not leave significant detectable surface residues since the major non-organic components of milk (e.g. calcium, potassium and sodium) are already present in parchments (The Dairy Council, n.d.). The results of the ion beam and genetic analyses suggested that the glue and inks are not the primary source of the additional sequences. Fine-scale element mapping demonstrated that the elements in the inks and glues have not diffused into the surrounding parchments (Fig. 3). Since the extracts from the 1763 package were taken from areas without visible inks and glue spots and the ink and glue elements did not diffuse through the parchment, it is unlikely that these localised treatments introduced novel sequences into the extracts. Furthermore, multiple extractions from parchments with visible glue stains (1763A and 1763B) did not yield DNA evidence consistent with treatment localization. We are therefore left with Hypothesis 4. Parchment production of the 18th and 19th centuries was carried out on an industrial scale. Many skins from different animals were processed at the same time. Parchmenters’ tools would not have been sterile and DNA residues from multiple animals would have built up on them over time. Since DNA is water-soluble, DNA could have passed from one parchment to the other during stages such as washing, curing and depilation. This might also explain the high proportion of sequence artefacts and lesions, since the DNA would be transferred from one skin to another in hydrolytic environments (e.g. the various washes), which do not promote the preservation of DNA. Since multiple distinct DNA sequences are preserved within individual parchments, we suggest that a sheet of parchment represents a contemporaneous population of animals or ‘palimpsest’ of DNA sequences, rather than a single organism. Contrary to our results, several groups identified a single source species of analysed parchments. DNA analysis of the Dead Sea Scrolls revealed that fourteen fragments were made from either ibex (Capra ibex) or domestic goat (C. hircus; Bar-Gal et al., 2001; Woodward et al., 1996). Poulakakis et al. (2007) reported that three 13th–16th centuries Greek parchments were made from domestic goat. The discrepancy between their results and ours could be a result of differences in parchment manufacture and storage. However, similar mtDNA and isotopic results to ours were recovered from fragments of a 19th century leather Sefer Torah (C.J.E., unpublished), indicating that the presence of multiple DNA signatures is not limited to our samples. Furthermore, the analysis of the

1324

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325

Dead Sea Scrolls omitted cloning, so it is impossible to determine whether their sequences originated from a single individual or multiple (Bower et al., 2005; Cooper and Poinar, 2000). Poulakakis and co-workers cloned extensively, but their sample size was small and may not be representative. Although Burger et al. (2000, 2001) reported that STRs were useful in identifying source species of their historic and early modern parchments, the authors encountered difficulties in determining the genotypes of individual samples (J. Burger, personal communication 2008). They attributed this to DNA damage and polymerase error (J. Burger, personal communication 2008). Given our results, the ambiguity of this STR data may be the result of DNAs of multiple individuals present within the parchments as well as DNA damage and PCR artefacts. 5.4. A model for the DNA content of parchment We have previously outlined a simple theoretical model for DNA preservation in parchment (Bower et al., 2009). We considered the possibility that DNA sequences could migrate between skins during parchment production. Our empirical evidence strongly supports this hypothesis. It now appears that all steps of the production process may be preserved in the extractable DNAs, although this conclusion needs further systematic testing. Several stages of parchment production are particularly amenable to the passage of DNAs between parchments. The initial washing and curing, especially salt-curing in which fresh skins were stacked on top of each other with layers of salt to preserve them, would provide a salt-stable environment encouraging the movement of DNA molecules between parchments. DNAs may also have passed from one skin to another during the depilatory lime bath and the subsequent water rinse. Preparatory treatments (e.g. milk-based preparations) to improve the writing surface may also have added extraneous DNA molecules. Finally, DNAs may be added during parchment storage. Careful consideration of the age, source and context of individual parchments are thus necessary in order to deduce the likely source(s) of DNAs preserved in them. Although many of these production steps are parchmentspecific, some (e.g. curing and storage) are nearly universal to skin preparation and preservation. Many ancient DNA studies (e.g. Austin et al., 2003; Bunce et al., 2005; Higuchi et al., 1984; Shapiro et al., 2002) are based on skin materials stored in museums and private collections. Our evidence highlights the need to test that these materials do not include multiple sequences, since collectors of the 18th through to the early 20th centuries were not concerned about the genetic data preserved in their samples. These skins cannot be assumed to have been produced in the hermetic environments of today. 6. Conclusions The DNA content of parchment is more complex than previously thought. We have demonstrated that a significant proportion of historical parchments possess DNA signatures of multiple individuals and of multiple species. DNAs preserved in parchments possess very high proportions of DNA lesions and artefacts. These may be caused by the parchment manufacture itself, most likely during the curing or depilation stages during which the skins are placed in environments conducive to DNA transfer and hydrolysis. Nevertheless, DNA analysis of parchments, especially when combined with other techniques such as ion beam and stable isotope analyses, may yield fruitful insights into parchment manufacture and manuscript preparation. Although we may have difficulty in identifying the source species of a parchment using ancient DNA analysis alone, the collection of DNA sequences may

be characteristic of distinct manufacturing processes. This characteristic signature in turn could help identify the original parchment’s source and reconstruct its manufacture. Future experimental work should focus on identifying the characteristic signatures of different parchment manufacturing processes so that DNA from parchment can be used to its full potential. Acknowledgements We thank the Surrey Ion Beam Centre’s staff for all of their help. We are grateful to Mike Hall, James Rolfe and Catherine Kneale for their help with isotopic analysis. We thank Christopher de Hamel, Daniel Bradley and Ellen Nisbet for advice and encouragement. Joachim Burger and Gila Kahila Bar-Gal kindly supplied details of their extraction methods. Paula Reimer and Leon Litvack provided the Sefer torah. MAB is supported by the Leverhulme Trust, the Horserace Betting Levy Board, the Isaac Newton Trust and the McDonald Institute for Archaeological Research; MGC was supported by the Cambridge Overseas Trust, the Overseas Research Studentship and Peterhouse, Cambridge; CJE is supported by the Irish Research Council for Science Engineering and Technology (Basic Research Grant Scheme project number SC/202/510); FS is supported by a Genetime Marie Curie Training Studentship; MS was supported by The Arts and Humanities Research Council. Appendix. Supplementary data Supplementary data associated with this article can be found in the online version, at doi:10.1016/j.jas.2009.12.036. References Altschul, S., Gish, W., Miller, W., Myers, E., Lipman, D., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Ambrose, S.H., 1990. Preparation and characterization of bone and tooth collagen for isotopic analysis. J. Archaeol. Sci. 17, 431–451. Austin, J.J., Arnold, E.N., Bour, R., 2003. Was there a second adaptive radiation of giant tortoises in the Indian Ocean? Using mitochondrial DNA to investigate speciation and biogeography of Aldabrachelys (Reptilia, Testudinidae). Mol. Ecol. 12, 1415–1424. Bailey, J.F., Richards, M.B., Macaulay, V.A., Colson, I.B., James, I.T., Bradley, D.G., Hedges, R.E.M., Sykes, B.C., 1996. Ancient DNA suggests a recent expansion of European cattle from a diverse wild progenitor species. Proc. Roy. Soc. Lond. B. 263, 1467–1473. Bandelt, H.-J., Forster, P., Ro¨hl, A., 1999. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16, 37–48. Bar-Gal, G.K., Greenblatt, C., Woodward, S.R., Broshi, M., Smith, P., 2001. The genetic signature of the dead sea scrolls. In: Goodblatt, D., Pinnick, A., Schwartz, D. (Eds.), Historical Perspectives: from the Hasmoneans to Bar Kokhba in Light of the Dead Sea Scrolls: Proceedings of the Orion Center for the Study of the Dead Sea Scrolls and Associated Literature, 27–31 January, 1999. Brill, Leiden, pp. 165–171. Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Wheeler, D.L., 2008. GenBank. Nucleic Acids Res. 36, 25–30. Bower, M.A., Spencer, M., Matsumura, S., Nisbet, R.E.R., Howe, C.J., 2005. How many clones need to be sequenced from a single forensic or ancient DNA sample in order to determine a reliable consensus sequence? Nucleic Acids Res. 33, 2549– 2556. Bower, M.A., Campana, M.G., Checkley-Scott, C., Knight, B., Howe, C.J., 2009. The potential for extraction and exploitation of DNA from parchment. J. Inst. Conservation. Bunce, M., Szulkin, M., Lerner, H.R.L., Barnes, I., Shapiro, B., Cooper, A., Holdaway, R.N., 2005. Ancient DNA provides new insights into the evolutionary history of New Zealand’s extinct Giant Eagle. PLoS Biol. 3, 44–46. Burger, J., Hummel, S., Hermann, B., 2000. Palaeogenetics and cultural heritage. Species determination and STR-genotyping from ancient DNA in art and artefacts. Thermochimica Acta 365, 141–146. Burger, J., Pfeiffer, I., Hummel, S., Fuchs, R., Brenig, B., Hermann, B., 2001. Mitochondrial and nuclear DNA from (pre)historic hide-derived material. Anc. Biomol. 3, 227–238. Cooper, A., Poinar, H.N., 2000. Ancient DNA: do it right or not at all. Science 289, 1139. The Dairy Council, n.d. The Nutritional Composition of Dairy Products. Available from: http://www.milk.co.uk.

M.G. Campana et al. / Journal of Archaeological Science 37 (2010) 1317–1325 Food and Agricultural Organisation of the United Nations (FAO), 2004. Measurement of domestic animal diversity (MoDAD): recommended microsatellite markers. Secondary Guidel. for Dev. Natl. Farm Anim. Genet. Resour. Manage. Plans. Gilbert, M.T.P., Shapiro, B., Drummond, A., Cooper, A., 2005. Post-mortem DNA damage hotspots in Bison (Bison bison) provide evidence for both damage and mutational hotspots in human mitochondrial DNA. J. Archaeol. Sci. 32, 1053–1060. Haines, B.M., 1999. Parchment: the Physical and Chemical Characteristics of Parchment and the Materials Used in Its Conservation. The Leather Conservation Centre, Northampton. Hedges, R.E.M., Saville, A., O’Connell, T.C., 2008. Characterizing the diet of individuals at the Neolithic chambered tomb of Hazleton North, Gloucestershire, England, using stable isotopic analysis. Archaeometry 50, 114–128. Higuchi, R.G., Bowman, B., Freiberger, M., Ryder, O.A., Wilson, A.C., 1984. DNA sequences from the quagga, an extinct member of the horse family. Nature 312, 282–284. Hoefs, J., 1997. Stable Isotope Geochemistry. Springer-Verlag, Berlin. Kalma´r, T., Bachrati, C.Z., Marcsik, A., Rasko´, I., 2000. A simple and efficient method for PCR amplifiable DNA and extraction from ancient bones. Nucleic Acids Res. 28, i–iv. Kaufmann, M., Arensburg, B., Weiner, S., 2002. Ancient DNA in bones: the use of collagen content as an indicator of DNA preservation in: abstracts of the 6th international Conference of ancient DNA and associated biomolecules, Tel Aviv, Israel, July 21–25, 2002. Anc. Biomol. 4, 121–167. Kemp, S.J., Hishida, O., Wambugu, J., Rink, A., Longeri, M.L., Ma, R.Z., Da, Y., Lewin, H.A., Barendse, W., Teale, A.J., 1995. A panel of polymorphic bovine, ovine and caprine microsatellite markers. Anim. Genet. 26, 299–306. Kolokotronis, S.-O., MacPhee, R.D.E., Greenwood, A.D., 2007. Detection of mitochondrial insertion in the nucleus (numts) of Pleistocene and modern muskoxen. BMC Evol. Biol. 7, 67–76. Leonard, J.A., Shanks, O., Hofreiter, M., Kreuz, E., Hodges, L., Ream, W., Wayne, R.K., Fleisher, R.C., 2007. Animal DNA in PCR reagents plagues ancient DNA research. J. Archaeol. Sci. 34, 1361–1366. Lopez, J.V., Cevario, S., O’Brien, S.J., 1996. Complete nucleotide sequences of the domestic cat (Felis catus) mitochondrial genome and a transposed mtDNA tandem repeat (numt) in the nuclear genome. Genomics 33, 229–246. Olson, L., Hassanin, A., 2003. Contamination and chimerism are perpetuating the legend of the snake-eating cow with twisted horns (Pseudonovibos spiralis): a case study of the pitfalls of ancient DNA. Mol. Phylogenet. Evol. 27, 545–548.

1325

Pa¨a¨bo, S., Higuchi, R.G., Wilson, A.C., 1989. Ancient DNA and the polymerase chain reaction. J. Biol. Chem. 264, 9709–9712. Pa¨a¨bo, S., Irwin, D.M., Wilson, A.C., 1990. DNA damage promotes jumping between templates during enzymatic amplification. J. Biol. Chem. 265, 4718–4721. Pedrosa, S., Uzun, M., Arranz, J.-J., Gutie´rrez-Gil, B., San Primitivo, F., Bavo´n, Y., 2005. Evidence of three maternal lineages in near eastern sheep supporting multiple domestication events. Proc. R. Soc. B 272, 2211–2217. Poinar, H.N., Ho¨ss, M., Bada, J.L., Pa¨a¨bo, S., 1996. Amino acid racemisation and the preservation of ancient DNA. Science 272, 864–866. Poulakakis, N., Tselikas, A., Bitsakis, I., Mylonas, M., Lymberakis, P., 2007. Ancient DNA and the genetic signature of ancient Greek manuscripts. J. Archaeol. Sci. 34, 675–680. Reed, R., 1972. Ancient Skins, Parchments and Leathers. Seminar Press, London. Reed, R., 1975. The Nature and Making of Parchment. The Elemete Press, Leeds. Schoeninger, M.J., DeNiro, M.J., 1984. Nitrogen and carbon isotopic composition of bone collagen from marine and terrestrial animals. Geochim. Cosmochim. Acta 48, 625–639. Schwarcz, H.P., Schoeninger, M.J., 1991. Stable isotope analyses in human nutritional ecology. Yearbook Phys. Anthropol. 34, 283–321. Shapiro, B., Sibthorpe, D., Rambaut, A., Austin, J., Wragg, G.M., Bininda-Emonds, O.R.P., Lee, P.L.M., Cooper, A., 2002. Flight of the dodo. Science 295, 1683. Simon, A., Jeynes, C., Webb, R.P., Finnis, R., Tabatabaian, Z., Sellin, P., Breese, M.B.H., Fellows, D.F., van den Broek, R., Gwilliam, R.M., 2004. The new Surrey ion beam analysis facility. Nucl. Instrum. Meth. Phys. Res. B 219–220, 405–409. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. Troy, C.S., MacHugh, D.E., Bailey, J.F., Magee, D.A., Loftus, R.T., Cunningham, P., Chamberlain, A.T., Sykes, B.C., Bradley, D.G., 2001. Genetic evidence for neareastern origins of European cattle. Nature 410, 1088–1091. Vodopivec, J., Budnar, M., Pelicon, P., 2005. Application of the PIXE method to organic objects. Nucl. Instrum. Meth. Phys. Res. B 239, 85–93. Wang, X., Chen, H., Lei, C.Z., 2007. Genetic diversity and phylogenetic analysis of the mtDNA D-loop region in Tibetan sheep. Asian-australas. J. Anim. Sci. 20, 313–315. Woodward, S.R., Kahila, G., Smith, P., Greenblatt, C., Zias, J., Broshi, M., 1996. Analysis of parchment fragments from the Judean Desert using DNA techniques. In: Parry, D.W.G., Ricks, S.D. (Eds.), Current Research and Technological Developments of the Dead Sea Scrolls: Conference on the Texts from the Judean Desert, Jerusalem, 30 April, 1995. Brill, Leiden, pp. 215–238.