- Email: [email protected]
A fluorescence resonance energy transfer activation sensor for Arf6
Available online at www.sciencedirect.com
ANALYTICAL BIOCHEMISTRY Analytical Biochemistry 374 (2008) 243–249 www.elsevier.com/locate/yabio
A fluorescence resonance energy transfer activation sensor for Arf6 Brian Hall a, Mark A. McLean b, Kathryn Davis c, James E. Casanova c, Steven G. Sligar b,d, Martin A. Schwartz a,e,* a
d
Robert M. Berne Cardiovascular Research Center, University of Virginia, Charlottesville, VA 22908, USA b Department of Biochemistry, University of Illinois, Urbana, IL 61801, USA c Department of Cell Biology, University of Virginia, Charlottesville, VA 22908, USA Department of Chemistry, Center for Biophysics and Computational Biology, and College of Medicine, University of Illinois, Urbana, IL 61801, USA e Departments of Microbiology and Biomedical Engineering and Mellon Prostate Cancer Research Institute, University of Virginia, Charlottesville, VA 22908, USA Received 6 August 2007 Available online 3 December 2007
Abstract The involvement of the small GTPase Arf6 in Rac activation, cell migration, and cancer invasiveness suggests that it is activated in a spatially and temporally regulated manner. Small GTPase activation has been imaged in cells using probes in which the GTPase and a fragment of a downstream effector protein are fused to fluorescent reporter proteins that constitute a fluorescence resonance energy transfer (FRET) donor/acceptor pair. Unlike other Ras family GTPases, the N terminus of Arf6 is critical for membrane targeting and, thus, cannot be modified by fusion to a fluorescent protein. We found that the previously described C-terminal green fluorescent protein (GFP) derivative also shows diminished membrane targeting. Therefore, we inserted a fluorescent protein into an inert loop within the Arf6 sequence. This fusion showed normal membrane targeting, nucleotide-dependent interaction with the downstream effector GGA3, and normal regulation by a GTPase-activating protein (GAP) and a guanine nucleotide exchange factor (GEF). Using the recently developed CyPET/YPET fluorescent proteins as a FRET pair, we found that Arf6–CyPET underwent efficient energy transfer when bound to YPET–GGA3 effector domain in intact cells. The addition of platelet-derived growth factor (PDGF) to fibroblasts triggered a rapid and transient increase in FRET, indicative of Arf6 activation. These reagents should be useful for investigations of Arf6 activation and function. 2007 Elsevier Inc. All rights reserved. Keywords: Membrane traffic; Fluorescence resonance energy transfer; Signal transduction; Cell migration
The Arf family of small GTPases consists of six members (Arf1–Arf6) that regulate membrane trafficking [1]. The best understood member of the family is Arf1, which mediates formation of Golgi-derived coated vesicles via GTP-dependent interaction with both coatamer and clathrin adaptor subunits. Arf6 is less well understood but is implicated in the endocytosis of plasma membrane proteins, regulated secretion, and trafficking from recycling endosomes to the plasma membrane. GGA proteins 1 to 3 are clathrin adaptors and effectors for Arf family proteins *
Corresponding author. Fax: +1 434 924 2828. E-mail address: [email protected] (M.A. Schwartz).
0003-2697/$ - see front matter 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2007.11.032
that regulate vesicle coating [2]. Arf6 is also implicated in cell motility, at least in part by activating the small GTPase Rac [3–5]. Arf6 expression is elevated in a subset of invasive breast carcinomas, and its inhibition decreases cancer cell migration and invasiveness [6]. Regulators of Arf6 are also implicated in oncogenic transformation or progression [7,8]. The current view of cell regulation is that spatial and temporal characteristics of signaling pathways are crucial for determining cellular responses [9]. In this study, we set out to develop a fluorescence-based assay to measure local activation of Arf6 in living cells. Unlike other Ras family members, the N terminus of Arf6 cannot be modi-
244
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
fied because it is critical for membrane association. Previous studies, therefore, used C-terminal fusions with fluorescent proteins [10]. A fluorescence resonance energy transfer (FRET)1 assay for Arf6 activation that used an Arf6–CFP (cyan fluorescent protein) construct was developed recently; however, FRET efficiency appears to be low [11]. While developing our own assay, we found that C-terminally tagged Arf6 constructs have a substantial defect in membrane association. Therefore, we generated an Arf6 construct containing an internal fluorescent protein that shows improved behavior. Using recently developed CFP/YFP (yellow fluorescent protein) derivatives optimized for FRET applications (CyPET and YPET) [12], we developed an improved FRET-based assay for visualizing Arf6 activation in living cells. Materials and methods
For construction of the YPet–GGA3, the coding region of YPet was amplified from the parent vector with the following primers, adding the indicated restriction sites: YPet (KpnI) forward (5 0 -GCCGGTACCGCCACCATGGCTA AAGGTGAAGAATTATTCACTGG-3 0 ) and YPet (SpeI) reverse (5 0 -GCCACTAGTTTTGTACAATTCATTCATA CCCTCGG-3 0 ). The coding region of amino acids 148 to 303 of human GGA3 was amplified from pRSET–GGA3, which contains the full-length human gene. The forward primer (5 0 -GG CACTAGTGACCCACCAATTCCTGTGGATAGGAC GC-3 0 ) added an SpeI restriction site; the reverse primer (5 0 -GGCGAATTCTCAGATGACCTGCCCTTCAATAA TTGTTTTG-3 0 ) added a stop codon and an EcoRI restriction site. These PCR products were then cloned into pEF4– myc–HisC (Invitrogen) for expression in mammalian cells. All vectors were verified by DNA sequencing.
Plasmid construction
Cell culture and transfection
The ARF6 gene was subcloned from a hemagglutinin (HA)-tagged ARF6 complementary DNA (cDNA) expression vector into pUC19 between the HindIII and EcoRI restriction sites using PCR. Complementary mutagenic primers were designed to add a six-amino-acid linker, GSSAAG, between residues 143 and 144 of ARF6 and also to introduce the unique restriction sites XhoI and PstI. Presence of the ARF6 linker gene was confirmed by restriction analysis. Initially, enhanced green fluorescent protein (EGFP) was inserted into the Arf6 sequence. An N-terminal linker GSSAGS and a C-terminal linker SAGAAG were added to EGFP using pEGFP (Clontech) as a template for PCR. The PCR product was cloned into the unique XhoI and PstI sites of the ARF6 linker gene, resulting in an internal fusion with EGFP between residues 144 and 145 of ARF6 attached by six-amino-acid linkers. Restriction analysis and DNA sequencing were used to confirm the presence of the ARF6–EGFP fusion. The EGFP was then replaced with Arf6–CyPet. The CyPet coding region was amplified from the parent vector to add restriction sites with the following primers: CyPet (XhoI) forward (5 0 -GCGCTCGAGTGCTGGAAGTTCT AAAGGTGAAGAATTATTCGGCGGTATCGTCC-3 0 ) and CyPet (PstI) reverse (5 0 -CCCTGCAGCTCCAG CACTTTTGTACAATTCATCCATACCA TGGGTAAT ACCAGC-3 0 ). The active (Q67L) and dominant negative (T27N) Arf6–CyPET vectors were made by introducing point mutations into the wild-type (WT) version.
Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 1· penicillin/streptomycin/L-glutamine mix (Invitrogen) and 10% fetal bovine serum (FBS, Atlanta Biologicals). NIH–3T3 cells were transfected using Effectene reagent (Qiagen) as per the manufacturer’s instructions. For cotransfection of FRET constructs, 2 lg Arf6–CyPet and 1 lg YPet–GGA3 were used. After 5 h, Effectene was removed and cells were washed in DMEM + 10% FBS and allowed to express for 24 to 48 h. Transfected cells were plated on fibronectin-coated (10 lg/ml) coverslips approximately 3 h prior to imaging. For platelet-derived growth factor (PDGF) stimulation experiments, transfected cells were plated on fibronectin-coated coverslips as above, allowed to spread, and starved overnight in DMEM + 0.5% bovine serum albumin (BSA, Sigma) prior to imaging. Membrane fractionation Cells expressing either C-terminally tagged or internally tagged Arf6 were mechanically homogenized in buffer containing 3 mM imidazole and 300 mM sucrose (pH 7.4). The membrane fraction was prepared by centrifugation of postnuclear supernatants at 100,000g for 60 min. Equal amounts of cytosolic or membrane protein were then subjected to SDS–PAGE, and immunoblots were probed with antibody to Arf6. Nontransfected cells were used to determine the distribution of endogenous Arf6. Measurement of Arf6–GTP
1
Abbreviations used: FRET, fluorescence resonance energy transfer; CFP, cyan fluorescent protein; YFP, yellow fluorescent protein; HA, hemagglutinin; cDNA, complementary DNA; EGFP, enhanced green fluorescent protein; WT, wild-type; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; PDGF, platelet-derived growth factor; BSA, bovine serum albumin; GAP, GTPase-activating protein; GEF, guanine nucleotide exchange factor; GST, glutathione S-transferase; ROI, region of interest; IgG, immunoglobulin G; HRP, horseradish peroxidase; GFP, green fluorescent protein.
Cells were transfected with the appropriate Arf6–fluorescent protein fusion alone or were cotransfected with plasmids encoding the Arf6GAP (GTPase-activating protein) ACAP1 or the Arf6GEF (guanine nucleotide exchange factor) ARNO. Cells were then lysed and Arf6GTP recovered by pull-down with glutathione S-transferase (GST)–GGA3 as described previously [13].
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
Activity of Arf6–CyPet was determined by immunoblotting with polyclonal anti-Arf6 antibody. Microscopy and image analysis Cells were imaged live in homemade glass-bottomed 35mm dishes on a Nikon TE300 fluorescence microscope with temperature and humidity controls, and they were kept under 5% CO2 while on the microscope. Imaging was performed using a Nikon 60 · 1.4 NA Plan Apo oil immersion objective. Images were acquired with a 16-bit MicroMax cooled CCD camera (Princeton Instruments). CyPet and FRET emission images were acquired simultaneously using a D436/10 · excitation filter and a DualView image splitter (Optical Insights) with the following filters: 505dcxr dichroic, D465/30m (CyPet), and HQ535/30m (YPet) emission filters. YPet images were acquired separately using a D500/20 · excitation filter. All static images were acquired with phenol red-free DMEM + 1% FBS with an ND8 filter in place, with exposure times of 1.0 s for CyPet/FRET and 0.25 s for YPet. For time lapse images, phenol red-free DMEM + 0.5% BSA was used; medium was covered with mineral oil, and OxyFluor antibleaching agent was used as per the manufacturer’s instructions. Both ND4 and ND8 filters were used, with exposure times of 3.0 s for CyPet/FRET and 1.0 s for YPet. Total time for acquisition of both images did not exceed 5 s per cell per time point. Hardware control and image capture were accomplished using ISEE and IPLab software, and image processing was performed using ImageJ. FRET analysis All images were flat-field corrected by first obtaining at least 10 images from regions of the coverslips containing no cells. Then these images were averaged, and experimental images were divided by the averaged background image and scaled by 1000, yielding images with a very uniform background. Finally, the mean of a representative region of the background was subtracted from the entire image. Bleed-through corrections were performed using cells expressing CyPet or YPet alone. Images were processed as above. Measurements of mean values from regions of interest (ROIs) in CyPet or YPet and FRET channels were plotted using Excel; a line was fit to the data, the slope of which was used as the bleed-through correction factor. Bleed-through from YPet excitation to CyPet emission was nonexistent with this filter set; therefore, the only corrections necessary were the subtraction of 436 nm excitation bleed-through from both fluorophores from the FRET image. Quantified FRET values represent arbitrary FRET efficiencies, not absolute ones. Antibodies and reagents Rabbit anti-Arf6 591 was made in cooperation with Covance Research Products. Anti-GM130 (clone 35)
245
monoclonal antibody was obtained from BD Biosciences, anti-c-myc (9E10) antibody was obtained from Santa Cruz Biotechnology, and anti-FLAG M2 monoclonal antibody was obtained from Sigma. For Western blots, secondary antibodies were anti-rabbit and anti-mouse immunoglobulin G (IgG)–horseradish peroxidase (HRP) conjugates obtained from Amersham Biosciences. Secondary antibody for immunofluorescence was Alexa-546-conjugated antimouse IgG obtained from Invitrogen/Molecular Probes. Results Improved fluorescent Arf6 construct Fluorescence images of cells expressing the previously described Arf6 construct with a C-terminal green fluorescent protein (GFP) [10] suggested that diffuse fluorescence was higher than endogenous or HA-tagged Arf6 (not shown). To examine this issue more quantitatively, we fractionated cells and examined the localization of both endogenous Arf6 and transfected Arf6–GFP(CT). The C-terminally modified Arf6 was present mainly in the soluble fraction, in contrast to the endogenous protein that was found in both the cytosol and the particulate fraction (Fig. 1A). Although cell lysis and subsequent dilution in low-ionic-strength buffer probably exaggerate the amount of cytoplasmic Arf6 compared with intact cells, the results still indicate decreased membrane association of the C-terminally tagged construct. Therefore, we considered alternative fluorescent Arf6 derivatives. Examination of the crystal structure of Arf6
Fig. 1. Characterization of fluorescent Arf6 derivatives. (A) Internally tagged Arf6–CyPet(INT) and endogenous Arf6 associate with membranes more efficiently than does C-terminally tagged Arf6(CT). ‘‘CON’’ represents control untransfected cells. Cytosolic and membrane fractions from HeLa cells transiently transfected with either Arf6–CyPET(INT) or Arf6– GFP(CT) were separated by PAGE and Western blotted with polyclonal anti-Arf6. ‘‘end. Arf6’’ represents endogenous Arf6, which is distinguished from fluorescent protein (FP)–Arf6 by its molecular weight. Similar results were seen in three experiments. (B) Effect of a GAP (ACAP1) and a GEF (EFA6). HeLa cells were cotransfected with Arf6–CyPet(INT) together with ACAP1 or EFA6. GTP-bound Arf6 was detected using the GGA3 pull-down assay [13]. Total Arf6 was detected with polyclonal anti-Arf6. Expression of the transfected proteins was confirmed by Western blot. Similar results were seen in three experiments.
246
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
in GTP- and GDP-bound states revealed that an exposed loop between the a4 helix and b6 strand (residues 140– 148) was invariant between these conformations and was well removed from both the effector binding and membrane targeting regions [14]. Therefore, it seemed likely that this loop could accommodate a fluorescent protein without affecting Arf6 function. An initial attempt to insert a circularly permuted GFP after Arf6 Ile144 resulted in protein that did not fold properly (not shown). However, a subsequent construct in which GFP was inserted with six-amino-acid spacers at the normal C and N termini resulted in production of stable and fluorescent protein. Fractionation of cells expressing this internally tagged Arf6–GFP(INT) showed that it associated with the membrane fraction similarly to the endogenous protein (Fig. 1A). Therefore, this construct was examined further. First, we prepared a fluorescent derivative more suitable for the FRET-based assay. Nguyen and Daugherty recently developed CFP and YFP proteins with enhanced FRET characteristics that they named CyPET and YPET [12]. Therefore, we made an Arf6–CyPET(INT) construct. This construct was expressed in cells alone, together with ACAP1 (an Arf6-specific GAP), or together with EFA6 (an Arf6-specific GEF). Cell lysates were subjected to pull-down assays using the GGA3 effector domain immobilized on GST–agarose beads [13]. The Arf6–CyPET(INT) protein showed increased binding to beads in the presence of the GEF and decreased binding to beads in the presence of the GAP (Fig. 1B). These data demon-
strate, first, that the Arf6–CyPET(INT) protein binds to an effector in a nucleotide-dependent manner and, second, that this construct is responsive to activation and inactivation by GEFs and GAPs, respectively. Therefore, Arf6– CyPET(INT) appears to be an improved fluorescent Arf6 derivative that models the behavior of the WT protein more accurately. GGA3 effector construct We then attempted to prepare an effector domain labeled with the YPET fluorescence acceptor. Examination of structures of the Arf1–GGA complex [15,16] suggested that the N-terminal end of the GGA GAT domain was on the same side of the complex as the CyPET group within the Arf6 structure. Thus, a fluorophore placed at this site should be reasonably close to the CyPET in Arf6–CyPET(INT). Based on previous studies showing that Arf6 binding was mediated by the GAT domain [15], we prepared a construct consisting of YPET followed by residues 148 to 303 from GGA3. We first tested the construct by localization. As expected for an Arf-binding protein, the brightest fluorescence was observed in a distinct perinuclear region (Fig. 2A). When cells were fixed and labeled for the Golgi protein GM130, there was excellent colocalization. A diffuse fluorescence signal was also observed over the cytoplasm, plasma membrane, and cell nucleus and was more evident at longer exposures (Fig. 3A).
Fig. 2. Characterization of GGA3–YPET. (A) GGA3–YPET was expressed in NIH 3T3 cells, which were fixed and stained for GM130, a Golgi marker. YPet–GGA3 (green) colocalized extensively with the Golgi marker (red) as shown in the merged image. (B) Cells expressing YPET-only or YPET–GGA3 were plated on fibronectin-coated coverslips for 3 h and then imaged for YPET. Both cell spreading and total fluorescence intensity were determined for each cell. Spreading is expressed as cell area in pixels, and fluorescence intensity is expressed in arbitrary units. Values are means ± standard deviations. *P < 0.025, **P < 0.002.
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
247
cence intensity were measured for each expressing cell after replating. YPET–GGA3 at low expression levels had no effect on cell spreading compared with control YPET-only cells (Fig. 2B). At higher levels, however, cell spreading was decreased. Brightness levels in the neighborhood of 1000 (arbitrary scale) did not detectably inhibit Arf6 function but gave sufficient signal strength for imaging. This level is conservative given that in the FRET assay Arf6–CyPET is cotransfected and, thus, any inhibition would be diminished. FRET measurements We then expressed the CyPET and YPET constructs in cells and measured FRET intensity. Coexpression of Arf6–CyPET with YPET–GGA3 resulted in a significant FRET signal (Fig. 3A, upper panel), indicating an interaction between these proteins. FRET was highest at cell edges, as expected for Arf6. When CyPET–Arf6 was coexpressed with YPET only (which lacked the GGA3 moiety), FRET was nearly undetectable (Fig. 3A, lower panel). We then examined nucleotide dependence. In the context of the Arf6–CyPET(INT) construct, we made a GDP-locked dominant negative mutant, Arf6 T27N, and a GTPase-deficient activated mutant, Arf6 Q67L [18]. When coexpressed with YPET–GGA3, the T27N mutant showed very low FRET (Fig. 3B), whereas the active mutant showed high FRET compared with WT. Quantitation of multiple images showed that total FRET intensity per cell for WT Arf6 was 3.5 ± 2.0 (arbitrary units, n = 5), whereas for N27 Arf it was 0.18 ± 0.16 (n = 5) and for Q67L Arf6 it was 39.3 ± 13.9 (n = 7). When YPET only was used instead of YPET fused with Arf6, total FRET per cell was 0.23 ± .06 (n = 5), indicating that the N27 construct was essentially negative. Therefore, FRET reports the nucleotide-dependent interaction between Arf6 and the effector construct. Fig. 3. Nucelotide-dependent FRET. (A) WT Arf6–CyPET(INT) was coexpressed with similar levels of YPET–GGA3 or with YPET only. Fluorescence from each fluorophore and the FRET intensity were recorded. Results are representative of at least five experiments. (B) Arf6–CyPET(INT) constructs containing dominant-negative (T27N) or constitutively activating (Q67L) mutations were coexpressed with YPET– GGA3. Fluorescence from each fluorophore and the FRET intensity were recorded. Results are representative of at least five experiments.
Soluble effector domains at high levels inhibit the function of GTPases [17]. To determine the expression levels suitable for an Arf6 assay, we used the observation that inhibiting Arf6 blocks cell spreading [3]. Therefore, we transfected cells with cDNA coding for YPET–GGA3, detached the cells with trypsin–EDTA, and replated on coverslips coated with fibronectin. For comparison, another group of cells was transfected with a corresponding YPET-only construct. Both cell area and total fluores-
Regulation of Arf6 activity To test whether FRET can detect GEF and GAP activity, Arf6–CyPET and YPET–GGA3 were coexpressed with ACAP1, a GAP for Arf6, or with ARNO, an Arf6 GEF. FRET images were recorded, and then the cells were fixed with formaldehyde and stained for the epitope-tagged GAP or GEF proteins to confirm expression in the same cells. Coexpression with the Arf6 GAP ACAP1 essentially eliminated the FRET signal (Fig. 4). When quantified, total FRET per cell in the presence of ACAP1 was 0.04 ± 0.06 (arbitrary units, n = 5), which is not significantly different from the YPET-only and T27N Arf6 constructs. Conversely, coexpression with the Arf6 GEF ARNO increased the total FRET signal per cell to 26.6 ± 11.8 (n = 5) compared with Arf6 alone (3.5 ± 2.0). These data show that FRET is sensitive to changes in nucleotide loading of WT Arf6–CyPET and
248
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
Fig. 4. Effect of a GEF and a GAP. Arf6–CyPet and YPet–GGA3 were cotransfected with either the Arf6 GAP ACAP1 or the GEF ARNO. After recording individual fluorophores and FRET images, cells were fixed and stained for the epitope-tagged GEF or GAP construct to confirm coexpression. GEF expression increased FRET, whereas GAP expression nearly eliminated it. Results are representative of at least five experiments.
Fig. 5. Response to PDGF. (A) Time lapse images of cells expressing Arf6–CyPET(INT) and YPET–GGA3 were taken for 5 min, and then 10 ng/ml PDGF was added and imaging was continued. Results are representative of three experiments. (B) Quantitation of FRET from panel A over the whole cell at each time point.
confirm the biochemical assays demonstrating that the Arf6–CyPET(INT) construct interacts appropriately with GEFs and GAPs. To test whether the assay can report stimulation of Arf6 through endogenous receptors, cells expressing WT Arf6– CyPET and YPET–GGA3 were treated with PDGF. Time lapse images showed rapid activation following the addition of PDGF and a return to baseline at later times (Fig. 5). Control time courses without PDGF showed little change in FRET over the same time period (data not shown). We conclude that FRET between Arf6–CyPET(INT) and YPET–GGA3 is able to measure local Arf6 activation within living cells.
Discussion In this study, we first developed an improved Arf6–fluorescent protein construct in which the fluorescent protein is inserted into a loop within the Arf6 structure. This construct showed better membrane targeting than the widely used C-terminally tagged Arf6. Therefore, it should be a useful reagent for a variety of applications in addition to FRET assays. We then developed an effector construct designed to serve as an efficient FRET acceptor for the Arf6–CyPET. This construct employed a YPET fused to the GAT domain of GGA3. It was designed to have high affinity
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
for GTP–Arf6 and, based on recent structural analysis of the Arf6–GGA1 complex, to bring the two fluorophores into close proximity. The acceptor construct showed efficient FRET when expressed with the constitutively active Q67L Arf6, and energy transfer was dependent on GTP loading of the Arf6. Moreover, the WT Arf6 responded appropriately to expression of a GEF or a GAP and showed a transient increase when cells were stimulated by the addition of PDGF. These data indicate that these constructs can be used to assay local Arf6 activation in living cells. A previous study developed a FRET assay for Arf6 that used a C-terminally tagged Arf6–CFP together with a GGA3–YFP that used a shorter GGA3 fragment [11]. Although the assay was able to detect an increase in FRET around phagosomes, this Arf6 construct has reduced membrane association and the assay has not found other applications. Improved membrane targeting of the Arf6– CyPET(INT) construct, optimized placement of the fluorescent proteins, and the improved CyPET–YPET FRET pair most likely all contribute to the improved efficiency of this assay. These reagents should be useful for elucidating the spatial and temporal patterns of the Arf6 activation in cell motility and membrane trafficking in a variety of systems. The same design should also be useful for analyzing other Arf proteins that bind to GGA3.
Conclusions We have demonstrated that an Arf6 construct containing an internal fluorescent protein is a better probe than the widely used C-terminally tagged fusion protein. When coexpressed with an effector domain linked to a fluorescence acceptor, Arf6 binds the effector construct in a GTP-dependent manner, leading to a large increase in FRET. FRET imaging can thereby detect local Arf6 activation due to growth factor stimulation. This system should be readily adaptable to other Arf family members for measurement of spatial and temporal activation.
Acknowledgments This work was supported by U.S. Public Health Service grant U54 GM64346. We are grateful to Patrick Daugherty for generously providing the CyPET and YPET vectors and to Paul Randazzo for helpful discussions.
249
References [1] C. D’Souza-Schorey, P. Chavrier, ARF proteins: Roles in membrane traffic and beyond, Nat. Rev. Mol. Cell Biol. 7 (2006) 347–358. [2] J.S. Bonifacino, The GGA proteins: Adaptors on the move, Nat. Rev. Mol. Cell Biol. 5 (2004) 23–32. [3] H. Radhakrishnan, O. Al-Awar, Z. Khachikian, J.G. Donaldson, ARF6 requirement for Rac ruffling suggests a role for membrane trafficking in cortical actin rearrangements, J. Cell Sci. 112 (1999) 855–866. [4] L.C. Santy, K.S. Ravichandran, J.E. Casanova, The DOCK180/Elmo complex couples ARNO-mediated Arf6 activation to the downstream activation of Rac1, Curr. Biol. 15 (2005) 1749–1754. [5] M. Franco, P.J. Peters, J. Boretto, E. van Donselaar, A. Neri, C. D’Souza-Schorey, P. Chavrier, EFA6, a sec7 domain-containing exchange factor for ARF6, coordinates membrane recycling and actin cytoskeleton organization, EMBO J. 18 (1999) 1480–1491. [6] S. Hashimoto, Y. Onodera, A. Hashimoto, M. Tanaka, M. Hamaguchi, A. Yamada, H. Sabe, Requirement for Arf6 in breast cancer invasive activities, Proc. Natl. Acad. Sci. USA 101 (2004) 6647–6652. [7] H. Sabe, Y. Onodera, Y. Mazaki, S. Hashimoto, ArfGAP family proteins in cell adhesion, migration, and tumor invasion, Curr. Opin. Cell Biol. 18 (2006) 558–564. [8] L. Martinu, J.M. Masuda-Robens, S.E. Robertson, L.C. Santy, J.E. Casanova, M.M. Chou, The TBC (Tre-2/Bub2/Cdc16) domain protein TRE17 regulates plasma membrane-endosomal trafficking through activation of Arf6, Mol. Cell. Biol. 24 (2004) 9752–9762. [9] A. Miyawaki, Visualization of the spatial and temporal dynamics of intracellular signaling, Dev. Cell 4 (2003) 295–305. [10] J.K. Schweitzer, C. D’Souza-Schorey, Localization and activation of the ARF6 GTPase during cleavage furrow ingression and cytokinesis, J. Biol. Chem. 277 (2002) 27210–27216. [11] P. Beemiller, A.D. Hoppe, J.A. Swanson, A phosphatidylinositol-3kinase-dependent signal transition regulates ARF1 and ARF6 during Fcg receptor-mediated phagocytosis, PLoS Biol. 4 (2006) 987–999. [12] A.W. Nguyen, P.S. Daugherty, Evolutionary optimization of fluorescent proteins for intracellular FRET, Nat. Biotechnol. 23 (2005) 355–360. [13] L.C. Santy, J.E. Casanova, Activation of ARF6 by ARNO stimulates epithelial cell migration through downstream activation of both Rac1 and phospholipase D, J. Cell Biol. 154 (2001) 599–610. [14] S. Pasqualato, J. Menetrey, M. Franco, J. Cherfils, The structural GDP/GTP cycle of human Arf6, EMBO Rep. 2 (2001) 234–238. [15] T. Shiba, M. Kawasaki, H. Takatsu, T. Nogi, N. Matsugaki, N. Igarashi, M. Suzuki, R. Kato, K. Nakayama, S. Wakatsuki, Molecular mechanism of membrane recruitment of GGA by ARF in lysosomal protein transport, Nat. Struct. Biol. 10 (2003) 386–393. [16] S. Suer, S. Misra, L.F. Saidi, J.H. Hurley, Structure of the GAT domain of human GGA1: A syntaxin amino-terminal domain fold in an endosomal trafficking adaptor, Proc. Natl. Acad. Sci. USA 100 (2003) 4451–4456. [17] N. Meller, M. Irani-Tehrani, W.B. Kiosses, M.A.D. Pozo, M.A. Schwartz, Zizimin1, a novel Cdc42 activator, reveals a new GEF domain for Rho proteins, Nat. Cell Biol. 4 (2002) 639–647. [18] C. D’Souza-Schorey, G. Li, M.I. Colombo, P.D. Stahl, A regulatory role for ARF6 in receptor-mediated endocytosis, Science 267 (1995) 1175–1178.
ANALYTICAL BIOCHEMISTRY Analytical Biochemistry 374 (2008) 243–249 www.elsevier.com/locate/yabio
A fluorescence resonance energy transfer activation sensor for Arf6 Brian Hall a, Mark A. McLean b, Kathryn Davis c, James E. Casanova c, Steven G. Sligar b,d, Martin A. Schwartz a,e,* a
d
Robert M. Berne Cardiovascular Research Center, University of Virginia, Charlottesville, VA 22908, USA b Department of Biochemistry, University of Illinois, Urbana, IL 61801, USA c Department of Cell Biology, University of Virginia, Charlottesville, VA 22908, USA Department of Chemistry, Center for Biophysics and Computational Biology, and College of Medicine, University of Illinois, Urbana, IL 61801, USA e Departments of Microbiology and Biomedical Engineering and Mellon Prostate Cancer Research Institute, University of Virginia, Charlottesville, VA 22908, USA Received 6 August 2007 Available online 3 December 2007
Abstract The involvement of the small GTPase Arf6 in Rac activation, cell migration, and cancer invasiveness suggests that it is activated in a spatially and temporally regulated manner. Small GTPase activation has been imaged in cells using probes in which the GTPase and a fragment of a downstream effector protein are fused to fluorescent reporter proteins that constitute a fluorescence resonance energy transfer (FRET) donor/acceptor pair. Unlike other Ras family GTPases, the N terminus of Arf6 is critical for membrane targeting and, thus, cannot be modified by fusion to a fluorescent protein. We found that the previously described C-terminal green fluorescent protein (GFP) derivative also shows diminished membrane targeting. Therefore, we inserted a fluorescent protein into an inert loop within the Arf6 sequence. This fusion showed normal membrane targeting, nucleotide-dependent interaction with the downstream effector GGA3, and normal regulation by a GTPase-activating protein (GAP) and a guanine nucleotide exchange factor (GEF). Using the recently developed CyPET/YPET fluorescent proteins as a FRET pair, we found that Arf6–CyPET underwent efficient energy transfer when bound to YPET–GGA3 effector domain in intact cells. The addition of platelet-derived growth factor (PDGF) to fibroblasts triggered a rapid and transient increase in FRET, indicative of Arf6 activation. These reagents should be useful for investigations of Arf6 activation and function. 2007 Elsevier Inc. All rights reserved. Keywords: Membrane traffic; Fluorescence resonance energy transfer; Signal transduction; Cell migration
The Arf family of small GTPases consists of six members (Arf1–Arf6) that regulate membrane trafficking [1]. The best understood member of the family is Arf1, which mediates formation of Golgi-derived coated vesicles via GTP-dependent interaction with both coatamer and clathrin adaptor subunits. Arf6 is less well understood but is implicated in the endocytosis of plasma membrane proteins, regulated secretion, and trafficking from recycling endosomes to the plasma membrane. GGA proteins 1 to 3 are clathrin adaptors and effectors for Arf family proteins *
Corresponding author. Fax: +1 434 924 2828. E-mail address: [email protected] (M.A. Schwartz).
0003-2697/$ - see front matter 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2007.11.032
that regulate vesicle coating [2]. Arf6 is also implicated in cell motility, at least in part by activating the small GTPase Rac [3–5]. Arf6 expression is elevated in a subset of invasive breast carcinomas, and its inhibition decreases cancer cell migration and invasiveness [6]. Regulators of Arf6 are also implicated in oncogenic transformation or progression [7,8]. The current view of cell regulation is that spatial and temporal characteristics of signaling pathways are crucial for determining cellular responses [9]. In this study, we set out to develop a fluorescence-based assay to measure local activation of Arf6 in living cells. Unlike other Ras family members, the N terminus of Arf6 cannot be modi-
244
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
fied because it is critical for membrane association. Previous studies, therefore, used C-terminal fusions with fluorescent proteins [10]. A fluorescence resonance energy transfer (FRET)1 assay for Arf6 activation that used an Arf6–CFP (cyan fluorescent protein) construct was developed recently; however, FRET efficiency appears to be low [11]. While developing our own assay, we found that C-terminally tagged Arf6 constructs have a substantial defect in membrane association. Therefore, we generated an Arf6 construct containing an internal fluorescent protein that shows improved behavior. Using recently developed CFP/YFP (yellow fluorescent protein) derivatives optimized for FRET applications (CyPET and YPET) [12], we developed an improved FRET-based assay for visualizing Arf6 activation in living cells. Materials and methods
For construction of the YPet–GGA3, the coding region of YPet was amplified from the parent vector with the following primers, adding the indicated restriction sites: YPet (KpnI) forward (5 0 -GCCGGTACCGCCACCATGGCTA AAGGTGAAGAATTATTCACTGG-3 0 ) and YPet (SpeI) reverse (5 0 -GCCACTAGTTTTGTACAATTCATTCATA CCCTCGG-3 0 ). The coding region of amino acids 148 to 303 of human GGA3 was amplified from pRSET–GGA3, which contains the full-length human gene. The forward primer (5 0 -GG CACTAGTGACCCACCAATTCCTGTGGATAGGAC GC-3 0 ) added an SpeI restriction site; the reverse primer (5 0 -GGCGAATTCTCAGATGACCTGCCCTTCAATAA TTGTTTTG-3 0 ) added a stop codon and an EcoRI restriction site. These PCR products were then cloned into pEF4– myc–HisC (Invitrogen) for expression in mammalian cells. All vectors were verified by DNA sequencing.
Plasmid construction
Cell culture and transfection
The ARF6 gene was subcloned from a hemagglutinin (HA)-tagged ARF6 complementary DNA (cDNA) expression vector into pUC19 between the HindIII and EcoRI restriction sites using PCR. Complementary mutagenic primers were designed to add a six-amino-acid linker, GSSAAG, between residues 143 and 144 of ARF6 and also to introduce the unique restriction sites XhoI and PstI. Presence of the ARF6 linker gene was confirmed by restriction analysis. Initially, enhanced green fluorescent protein (EGFP) was inserted into the Arf6 sequence. An N-terminal linker GSSAGS and a C-terminal linker SAGAAG were added to EGFP using pEGFP (Clontech) as a template for PCR. The PCR product was cloned into the unique XhoI and PstI sites of the ARF6 linker gene, resulting in an internal fusion with EGFP between residues 144 and 145 of ARF6 attached by six-amino-acid linkers. Restriction analysis and DNA sequencing were used to confirm the presence of the ARF6–EGFP fusion. The EGFP was then replaced with Arf6–CyPet. The CyPet coding region was amplified from the parent vector to add restriction sites with the following primers: CyPet (XhoI) forward (5 0 -GCGCTCGAGTGCTGGAAGTTCT AAAGGTGAAGAATTATTCGGCGGTATCGTCC-3 0 ) and CyPet (PstI) reverse (5 0 -CCCTGCAGCTCCAG CACTTTTGTACAATTCATCCATACCA TGGGTAAT ACCAGC-3 0 ). The active (Q67L) and dominant negative (T27N) Arf6–CyPET vectors were made by introducing point mutations into the wild-type (WT) version.
Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 1· penicillin/streptomycin/L-glutamine mix (Invitrogen) and 10% fetal bovine serum (FBS, Atlanta Biologicals). NIH–3T3 cells were transfected using Effectene reagent (Qiagen) as per the manufacturer’s instructions. For cotransfection of FRET constructs, 2 lg Arf6–CyPet and 1 lg YPet–GGA3 were used. After 5 h, Effectene was removed and cells were washed in DMEM + 10% FBS and allowed to express for 24 to 48 h. Transfected cells were plated on fibronectin-coated (10 lg/ml) coverslips approximately 3 h prior to imaging. For platelet-derived growth factor (PDGF) stimulation experiments, transfected cells were plated on fibronectin-coated coverslips as above, allowed to spread, and starved overnight in DMEM + 0.5% bovine serum albumin (BSA, Sigma) prior to imaging. Membrane fractionation Cells expressing either C-terminally tagged or internally tagged Arf6 were mechanically homogenized in buffer containing 3 mM imidazole and 300 mM sucrose (pH 7.4). The membrane fraction was prepared by centrifugation of postnuclear supernatants at 100,000g for 60 min. Equal amounts of cytosolic or membrane protein were then subjected to SDS–PAGE, and immunoblots were probed with antibody to Arf6. Nontransfected cells were used to determine the distribution of endogenous Arf6. Measurement of Arf6–GTP
1
Abbreviations used: FRET, fluorescence resonance energy transfer; CFP, cyan fluorescent protein; YFP, yellow fluorescent protein; HA, hemagglutinin; cDNA, complementary DNA; EGFP, enhanced green fluorescent protein; WT, wild-type; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; PDGF, platelet-derived growth factor; BSA, bovine serum albumin; GAP, GTPase-activating protein; GEF, guanine nucleotide exchange factor; GST, glutathione S-transferase; ROI, region of interest; IgG, immunoglobulin G; HRP, horseradish peroxidase; GFP, green fluorescent protein.
Cells were transfected with the appropriate Arf6–fluorescent protein fusion alone or were cotransfected with plasmids encoding the Arf6GAP (GTPase-activating protein) ACAP1 or the Arf6GEF (guanine nucleotide exchange factor) ARNO. Cells were then lysed and Arf6GTP recovered by pull-down with glutathione S-transferase (GST)–GGA3 as described previously [13].
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
Activity of Arf6–CyPet was determined by immunoblotting with polyclonal anti-Arf6 antibody. Microscopy and image analysis Cells were imaged live in homemade glass-bottomed 35mm dishes on a Nikon TE300 fluorescence microscope with temperature and humidity controls, and they were kept under 5% CO2 while on the microscope. Imaging was performed using a Nikon 60 · 1.4 NA Plan Apo oil immersion objective. Images were acquired with a 16-bit MicroMax cooled CCD camera (Princeton Instruments). CyPet and FRET emission images were acquired simultaneously using a D436/10 · excitation filter and a DualView image splitter (Optical Insights) with the following filters: 505dcxr dichroic, D465/30m (CyPet), and HQ535/30m (YPet) emission filters. YPet images were acquired separately using a D500/20 · excitation filter. All static images were acquired with phenol red-free DMEM + 1% FBS with an ND8 filter in place, with exposure times of 1.0 s for CyPet/FRET and 0.25 s for YPet. For time lapse images, phenol red-free DMEM + 0.5% BSA was used; medium was covered with mineral oil, and OxyFluor antibleaching agent was used as per the manufacturer’s instructions. Both ND4 and ND8 filters were used, with exposure times of 3.0 s for CyPet/FRET and 1.0 s for YPet. Total time for acquisition of both images did not exceed 5 s per cell per time point. Hardware control and image capture were accomplished using ISEE and IPLab software, and image processing was performed using ImageJ. FRET analysis All images were flat-field corrected by first obtaining at least 10 images from regions of the coverslips containing no cells. Then these images were averaged, and experimental images were divided by the averaged background image and scaled by 1000, yielding images with a very uniform background. Finally, the mean of a representative region of the background was subtracted from the entire image. Bleed-through corrections were performed using cells expressing CyPet or YPet alone. Images were processed as above. Measurements of mean values from regions of interest (ROIs) in CyPet or YPet and FRET channels were plotted using Excel; a line was fit to the data, the slope of which was used as the bleed-through correction factor. Bleed-through from YPet excitation to CyPet emission was nonexistent with this filter set; therefore, the only corrections necessary were the subtraction of 436 nm excitation bleed-through from both fluorophores from the FRET image. Quantified FRET values represent arbitrary FRET efficiencies, not absolute ones. Antibodies and reagents Rabbit anti-Arf6 591 was made in cooperation with Covance Research Products. Anti-GM130 (clone 35)
245
monoclonal antibody was obtained from BD Biosciences, anti-c-myc (9E10) antibody was obtained from Santa Cruz Biotechnology, and anti-FLAG M2 monoclonal antibody was obtained from Sigma. For Western blots, secondary antibodies were anti-rabbit and anti-mouse immunoglobulin G (IgG)–horseradish peroxidase (HRP) conjugates obtained from Amersham Biosciences. Secondary antibody for immunofluorescence was Alexa-546-conjugated antimouse IgG obtained from Invitrogen/Molecular Probes. Results Improved fluorescent Arf6 construct Fluorescence images of cells expressing the previously described Arf6 construct with a C-terminal green fluorescent protein (GFP) [10] suggested that diffuse fluorescence was higher than endogenous or HA-tagged Arf6 (not shown). To examine this issue more quantitatively, we fractionated cells and examined the localization of both endogenous Arf6 and transfected Arf6–GFP(CT). The C-terminally modified Arf6 was present mainly in the soluble fraction, in contrast to the endogenous protein that was found in both the cytosol and the particulate fraction (Fig. 1A). Although cell lysis and subsequent dilution in low-ionic-strength buffer probably exaggerate the amount of cytoplasmic Arf6 compared with intact cells, the results still indicate decreased membrane association of the C-terminally tagged construct. Therefore, we considered alternative fluorescent Arf6 derivatives. Examination of the crystal structure of Arf6
Fig. 1. Characterization of fluorescent Arf6 derivatives. (A) Internally tagged Arf6–CyPet(INT) and endogenous Arf6 associate with membranes more efficiently than does C-terminally tagged Arf6(CT). ‘‘CON’’ represents control untransfected cells. Cytosolic and membrane fractions from HeLa cells transiently transfected with either Arf6–CyPET(INT) or Arf6– GFP(CT) were separated by PAGE and Western blotted with polyclonal anti-Arf6. ‘‘end. Arf6’’ represents endogenous Arf6, which is distinguished from fluorescent protein (FP)–Arf6 by its molecular weight. Similar results were seen in three experiments. (B) Effect of a GAP (ACAP1) and a GEF (EFA6). HeLa cells were cotransfected with Arf6–CyPet(INT) together with ACAP1 or EFA6. GTP-bound Arf6 was detected using the GGA3 pull-down assay [13]. Total Arf6 was detected with polyclonal anti-Arf6. Expression of the transfected proteins was confirmed by Western blot. Similar results were seen in three experiments.
246
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
in GTP- and GDP-bound states revealed that an exposed loop between the a4 helix and b6 strand (residues 140– 148) was invariant between these conformations and was well removed from both the effector binding and membrane targeting regions [14]. Therefore, it seemed likely that this loop could accommodate a fluorescent protein without affecting Arf6 function. An initial attempt to insert a circularly permuted GFP after Arf6 Ile144 resulted in protein that did not fold properly (not shown). However, a subsequent construct in which GFP was inserted with six-amino-acid spacers at the normal C and N termini resulted in production of stable and fluorescent protein. Fractionation of cells expressing this internally tagged Arf6–GFP(INT) showed that it associated with the membrane fraction similarly to the endogenous protein (Fig. 1A). Therefore, this construct was examined further. First, we prepared a fluorescent derivative more suitable for the FRET-based assay. Nguyen and Daugherty recently developed CFP and YFP proteins with enhanced FRET characteristics that they named CyPET and YPET [12]. Therefore, we made an Arf6–CyPET(INT) construct. This construct was expressed in cells alone, together with ACAP1 (an Arf6-specific GAP), or together with EFA6 (an Arf6-specific GEF). Cell lysates were subjected to pull-down assays using the GGA3 effector domain immobilized on GST–agarose beads [13]. The Arf6–CyPET(INT) protein showed increased binding to beads in the presence of the GEF and decreased binding to beads in the presence of the GAP (Fig. 1B). These data demon-
strate, first, that the Arf6–CyPET(INT) protein binds to an effector in a nucleotide-dependent manner and, second, that this construct is responsive to activation and inactivation by GEFs and GAPs, respectively. Therefore, Arf6– CyPET(INT) appears to be an improved fluorescent Arf6 derivative that models the behavior of the WT protein more accurately. GGA3 effector construct We then attempted to prepare an effector domain labeled with the YPET fluorescence acceptor. Examination of structures of the Arf1–GGA complex [15,16] suggested that the N-terminal end of the GGA GAT domain was on the same side of the complex as the CyPET group within the Arf6 structure. Thus, a fluorophore placed at this site should be reasonably close to the CyPET in Arf6–CyPET(INT). Based on previous studies showing that Arf6 binding was mediated by the GAT domain [15], we prepared a construct consisting of YPET followed by residues 148 to 303 from GGA3. We first tested the construct by localization. As expected for an Arf-binding protein, the brightest fluorescence was observed in a distinct perinuclear region (Fig. 2A). When cells were fixed and labeled for the Golgi protein GM130, there was excellent colocalization. A diffuse fluorescence signal was also observed over the cytoplasm, plasma membrane, and cell nucleus and was more evident at longer exposures (Fig. 3A).
Fig. 2. Characterization of GGA3–YPET. (A) GGA3–YPET was expressed in NIH 3T3 cells, which were fixed and stained for GM130, a Golgi marker. YPet–GGA3 (green) colocalized extensively with the Golgi marker (red) as shown in the merged image. (B) Cells expressing YPET-only or YPET–GGA3 were plated on fibronectin-coated coverslips for 3 h and then imaged for YPET. Both cell spreading and total fluorescence intensity were determined for each cell. Spreading is expressed as cell area in pixels, and fluorescence intensity is expressed in arbitrary units. Values are means ± standard deviations. *P < 0.025, **P < 0.002.
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
247
cence intensity were measured for each expressing cell after replating. YPET–GGA3 at low expression levels had no effect on cell spreading compared with control YPET-only cells (Fig. 2B). At higher levels, however, cell spreading was decreased. Brightness levels in the neighborhood of 1000 (arbitrary scale) did not detectably inhibit Arf6 function but gave sufficient signal strength for imaging. This level is conservative given that in the FRET assay Arf6–CyPET is cotransfected and, thus, any inhibition would be diminished. FRET measurements We then expressed the CyPET and YPET constructs in cells and measured FRET intensity. Coexpression of Arf6–CyPET with YPET–GGA3 resulted in a significant FRET signal (Fig. 3A, upper panel), indicating an interaction between these proteins. FRET was highest at cell edges, as expected for Arf6. When CyPET–Arf6 was coexpressed with YPET only (which lacked the GGA3 moiety), FRET was nearly undetectable (Fig. 3A, lower panel). We then examined nucleotide dependence. In the context of the Arf6–CyPET(INT) construct, we made a GDP-locked dominant negative mutant, Arf6 T27N, and a GTPase-deficient activated mutant, Arf6 Q67L [18]. When coexpressed with YPET–GGA3, the T27N mutant showed very low FRET (Fig. 3B), whereas the active mutant showed high FRET compared with WT. Quantitation of multiple images showed that total FRET intensity per cell for WT Arf6 was 3.5 ± 2.0 (arbitrary units, n = 5), whereas for N27 Arf it was 0.18 ± 0.16 (n = 5) and for Q67L Arf6 it was 39.3 ± 13.9 (n = 7). When YPET only was used instead of YPET fused with Arf6, total FRET per cell was 0.23 ± .06 (n = 5), indicating that the N27 construct was essentially negative. Therefore, FRET reports the nucleotide-dependent interaction between Arf6 and the effector construct. Fig. 3. Nucelotide-dependent FRET. (A) WT Arf6–CyPET(INT) was coexpressed with similar levels of YPET–GGA3 or with YPET only. Fluorescence from each fluorophore and the FRET intensity were recorded. Results are representative of at least five experiments. (B) Arf6–CyPET(INT) constructs containing dominant-negative (T27N) or constitutively activating (Q67L) mutations were coexpressed with YPET– GGA3. Fluorescence from each fluorophore and the FRET intensity were recorded. Results are representative of at least five experiments.
Soluble effector domains at high levels inhibit the function of GTPases [17]. To determine the expression levels suitable for an Arf6 assay, we used the observation that inhibiting Arf6 blocks cell spreading [3]. Therefore, we transfected cells with cDNA coding for YPET–GGA3, detached the cells with trypsin–EDTA, and replated on coverslips coated with fibronectin. For comparison, another group of cells was transfected with a corresponding YPET-only construct. Both cell area and total fluores-
Regulation of Arf6 activity To test whether FRET can detect GEF and GAP activity, Arf6–CyPET and YPET–GGA3 were coexpressed with ACAP1, a GAP for Arf6, or with ARNO, an Arf6 GEF. FRET images were recorded, and then the cells were fixed with formaldehyde and stained for the epitope-tagged GAP or GEF proteins to confirm expression in the same cells. Coexpression with the Arf6 GAP ACAP1 essentially eliminated the FRET signal (Fig. 4). When quantified, total FRET per cell in the presence of ACAP1 was 0.04 ± 0.06 (arbitrary units, n = 5), which is not significantly different from the YPET-only and T27N Arf6 constructs. Conversely, coexpression with the Arf6 GEF ARNO increased the total FRET signal per cell to 26.6 ± 11.8 (n = 5) compared with Arf6 alone (3.5 ± 2.0). These data show that FRET is sensitive to changes in nucleotide loading of WT Arf6–CyPET and
248
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
Fig. 4. Effect of a GEF and a GAP. Arf6–CyPet and YPet–GGA3 were cotransfected with either the Arf6 GAP ACAP1 or the GEF ARNO. After recording individual fluorophores and FRET images, cells were fixed and stained for the epitope-tagged GEF or GAP construct to confirm coexpression. GEF expression increased FRET, whereas GAP expression nearly eliminated it. Results are representative of at least five experiments.
Fig. 5. Response to PDGF. (A) Time lapse images of cells expressing Arf6–CyPET(INT) and YPET–GGA3 were taken for 5 min, and then 10 ng/ml PDGF was added and imaging was continued. Results are representative of three experiments. (B) Quantitation of FRET from panel A over the whole cell at each time point.
confirm the biochemical assays demonstrating that the Arf6–CyPET(INT) construct interacts appropriately with GEFs and GAPs. To test whether the assay can report stimulation of Arf6 through endogenous receptors, cells expressing WT Arf6– CyPET and YPET–GGA3 were treated with PDGF. Time lapse images showed rapid activation following the addition of PDGF and a return to baseline at later times (Fig. 5). Control time courses without PDGF showed little change in FRET over the same time period (data not shown). We conclude that FRET between Arf6–CyPET(INT) and YPET–GGA3 is able to measure local Arf6 activation within living cells.
Discussion In this study, we first developed an improved Arf6–fluorescent protein construct in which the fluorescent protein is inserted into a loop within the Arf6 structure. This construct showed better membrane targeting than the widely used C-terminally tagged Arf6. Therefore, it should be a useful reagent for a variety of applications in addition to FRET assays. We then developed an effector construct designed to serve as an efficient FRET acceptor for the Arf6–CyPET. This construct employed a YPET fused to the GAT domain of GGA3. It was designed to have high affinity
FRET activation sensor for Arf6 / B. Hall et al. / Anal. Biochem. 374 (2008) 243–249
for GTP–Arf6 and, based on recent structural analysis of the Arf6–GGA1 complex, to bring the two fluorophores into close proximity. The acceptor construct showed efficient FRET when expressed with the constitutively active Q67L Arf6, and energy transfer was dependent on GTP loading of the Arf6. Moreover, the WT Arf6 responded appropriately to expression of a GEF or a GAP and showed a transient increase when cells were stimulated by the addition of PDGF. These data indicate that these constructs can be used to assay local Arf6 activation in living cells. A previous study developed a FRET assay for Arf6 that used a C-terminally tagged Arf6–CFP together with a GGA3–YFP that used a shorter GGA3 fragment [11]. Although the assay was able to detect an increase in FRET around phagosomes, this Arf6 construct has reduced membrane association and the assay has not found other applications. Improved membrane targeting of the Arf6– CyPET(INT) construct, optimized placement of the fluorescent proteins, and the improved CyPET–YPET FRET pair most likely all contribute to the improved efficiency of this assay. These reagents should be useful for elucidating the spatial and temporal patterns of the Arf6 activation in cell motility and membrane trafficking in a variety of systems. The same design should also be useful for analyzing other Arf proteins that bind to GGA3.
Conclusions We have demonstrated that an Arf6 construct containing an internal fluorescent protein is a better probe than the widely used C-terminally tagged fusion protein. When coexpressed with an effector domain linked to a fluorescence acceptor, Arf6 binds the effector construct in a GTP-dependent manner, leading to a large increase in FRET. FRET imaging can thereby detect local Arf6 activation due to growth factor stimulation. This system should be readily adaptable to other Arf family members for measurement of spatial and temporal activation.
Acknowledgments This work was supported by U.S. Public Health Service grant U54 GM64346. We are grateful to Patrick Daugherty for generously providing the CyPET and YPET vectors and to Paul Randazzo for helpful discussions.
249
References [1] C. D’Souza-Schorey, P. Chavrier, ARF proteins: Roles in membrane traffic and beyond, Nat. Rev. Mol. Cell Biol. 7 (2006) 347–358. [2] J.S. Bonifacino, The GGA proteins: Adaptors on the move, Nat. Rev. Mol. Cell Biol. 5 (2004) 23–32. [3] H. Radhakrishnan, O. Al-Awar, Z. Khachikian, J.G. Donaldson, ARF6 requirement for Rac ruffling suggests a role for membrane trafficking in cortical actin rearrangements, J. Cell Sci. 112 (1999) 855–866. [4] L.C. Santy, K.S. Ravichandran, J.E. Casanova, The DOCK180/Elmo complex couples ARNO-mediated Arf6 activation to the downstream activation of Rac1, Curr. Biol. 15 (2005) 1749–1754. [5] M. Franco, P.J. Peters, J. Boretto, E. van Donselaar, A. Neri, C. D’Souza-Schorey, P. Chavrier, EFA6, a sec7 domain-containing exchange factor for ARF6, coordinates membrane recycling and actin cytoskeleton organization, EMBO J. 18 (1999) 1480–1491. [6] S. Hashimoto, Y. Onodera, A. Hashimoto, M. Tanaka, M. Hamaguchi, A. Yamada, H. Sabe, Requirement for Arf6 in breast cancer invasive activities, Proc. Natl. Acad. Sci. USA 101 (2004) 6647–6652. [7] H. Sabe, Y. Onodera, Y. Mazaki, S. Hashimoto, ArfGAP family proteins in cell adhesion, migration, and tumor invasion, Curr. Opin. Cell Biol. 18 (2006) 558–564. [8] L. Martinu, J.M. Masuda-Robens, S.E. Robertson, L.C. Santy, J.E. Casanova, M.M. Chou, The TBC (Tre-2/Bub2/Cdc16) domain protein TRE17 regulates plasma membrane-endosomal trafficking through activation of Arf6, Mol. Cell. Biol. 24 (2004) 9752–9762. [9] A. Miyawaki, Visualization of the spatial and temporal dynamics of intracellular signaling, Dev. Cell 4 (2003) 295–305. [10] J.K. Schweitzer, C. D’Souza-Schorey, Localization and activation of the ARF6 GTPase during cleavage furrow ingression and cytokinesis, J. Biol. Chem. 277 (2002) 27210–27216. [11] P. Beemiller, A.D. Hoppe, J.A. Swanson, A phosphatidylinositol-3kinase-dependent signal transition regulates ARF1 and ARF6 during Fcg receptor-mediated phagocytosis, PLoS Biol. 4 (2006) 987–999. [12] A.W. Nguyen, P.S. Daugherty, Evolutionary optimization of fluorescent proteins for intracellular FRET, Nat. Biotechnol. 23 (2005) 355–360. [13] L.C. Santy, J.E. Casanova, Activation of ARF6 by ARNO stimulates epithelial cell migration through downstream activation of both Rac1 and phospholipase D, J. Cell Biol. 154 (2001) 599–610. [14] S. Pasqualato, J. Menetrey, M. Franco, J. Cherfils, The structural GDP/GTP cycle of human Arf6, EMBO Rep. 2 (2001) 234–238. [15] T. Shiba, M. Kawasaki, H. Takatsu, T. Nogi, N. Matsugaki, N. Igarashi, M. Suzuki, R. Kato, K. Nakayama, S. Wakatsuki, Molecular mechanism of membrane recruitment of GGA by ARF in lysosomal protein transport, Nat. Struct. Biol. 10 (2003) 386–393. [16] S. Suer, S. Misra, L.F. Saidi, J.H. Hurley, Structure of the GAT domain of human GGA1: A syntaxin amino-terminal domain fold in an endosomal trafficking adaptor, Proc. Natl. Acad. Sci. USA 100 (2003) 4451–4456. [17] N. Meller, M. Irani-Tehrani, W.B. Kiosses, M.A.D. Pozo, M.A. Schwartz, Zizimin1, a novel Cdc42 activator, reveals a new GEF domain for Rho proteins, Nat. Cell Biol. 4 (2002) 639–647. [18] C. D’Souza-Schorey, G. Li, M.I. Colombo, P.D. Stahl, A regulatory role for ARF6 in receptor-mediated endocytosis, Science 267 (1995) 1175–1178.