- Email: [email protected]
A frizzled homolog functions in a vertebrate Wnt signaling pathway
1302
Research Paper
A frizzled homolog functions in a vertebrate Wnt signaling pathway Julia Yang-Snyder*, Jeffrey R. Miller*, Jeffrey D. Brown*†, Cheng-Jung Lai*‡ and Randall T. Moon* Background: Wnts are secreted proteins implicated in cell–cell interactions during embryogenesis and tumorigenesis, but receptors involved in transducing Wnt signals have not yet been definitively identified. Members of a large family of putative transmembrane receptors homologous to the frizzled protein in Drosophila have been identified recently in both vertebrates and invertebrates, raising the question of whether they are involved in transducing signals for any known signaling factors. Results: To test the potential involvement of frizzled homologs in Wnt signaling, we examined the effects of overexpressing rat frizzled-1 (Rfz-1) on the subcellular distribution of Wnts and of dishevelled, a cytoplasmic component of the Wnt signalling pathway. We demonstrate that ectopic expression of Rfz-1 recruits the dishevelled protein — as well as Xenopus Wnt-8 (Xwnt-8), but not the functionally distinct Xwnt-5A — to the plasma membrane. Moreover, Rfz-1 is sufficient to induce the expression of two Xwnt-8-responsive genes, siamois and Xnr-3, in Xenopus explants in a manner which is antagonized by glycogen synthase kinase-3, which also antagonizes Wnt signaling. When Rfz-1 and Xwnt-8 are expressed together in this assay, we observe greater induction of these genes, indicating that Rfz-1 can synergize with a Wnt.
Addresses: *Howard Hughes Medical Institute and Department of Pharmacology, and †Molecular and Cellular Biology Program, University of Washington School of Medicine, Seattle, Washington 98195, USA. ‡Present
address: Howard Hughes Medical Institute, Harvard University, Fairchild Biochemistry Building, 7 Divinity Avenue, Cambridge, Massachusetts 02138, USA. Correspondence: Randall T. Moon E-mail: [email protected] Received: 18 July 1996 Revised: 19 August 1996 Accepted: 2 September 1996 Current Biology 1996, Vol 6 No 10:1302–1306 © Current Biology Ltd ISSN 0960-9822
Conclusions: The results demonstrate that a vertebrate frizzled homolog is involved in Wnt signaling in a manner which discriminates between functionally distinct Wnts, which involves translocation of the dishevelled protein to the plasma membrane, and which works in a synergistic manner with Wnts to induce gene expression. These data support the likely function of frizzled homologs as Wnt receptors, or as components of a receptor complex.
Background Several families of secreted factors, including Wnts [1,2], have been implicated in mediating embryological events and tumorigenesis. Although it has been shown that Wnts can signal in a non-cell-autonomous manner and are putative ligands, identification of candidate Wnt receptors has been hindered by the relative insolubility of Wnt proteins and by their tight association with cells [1,2]. However, vertebrate homologs of Drosophila frizzled have emerged as a large family of candidate transmembrane receptors [3,4]. Recent data have shown that dishevelled (dsh) is genetically downstream of both frizzled and Drosophila Wnt-1 (wingless) [5,6], raising the question of whether vertebrate homologs of frizzled [3,4] function directly in a Wnt signaling pathway. To pursue this question we chose animal cap explants of Xenopus embryos, rather than a cultured cell system, because some responses to Wnt signals are affected by cell adhesion [7]. We reasoned that this explant system would allow combined cell biological and molecular approaches using cells which are normally exposed to Wnt signals [7,8],
while maintaining the cells in a physiological state of adhesion.
Results and discussion Expression of Rfz-1 increases the extent of localization at the plasma membrane of Xwnt-8myc but not Xwnt-5Amyc
If frizzled homologs were expressed on the cell surface and involved in transducing a Wnt signal, potentially as part of a receptor complex, increased synthesis of frizzled polypeptides might increase the association of Wnts with the surface of these cells. As Wnts can be grouped into the functionally distinct Wnt-1 class (including Xenopus Wnt-1 (Xwnt-1), -3A, -8 and -8b) and the Wnt-5A class (including Xwnt-5A, -4 and -11) [7,8], a candidate Wnt receptor may interact with some but not all Wnts. To test these possibilities, we injected Xenopus embryos with RNAs encoding c-myc-tagged Xwnt-8 (Xwnt-8myc) or Xwnt-5A (Xwnt-5Amyc) in the presence of rat frizzled-1 (Rfz-1) RNA [4] or, as a control, RNA encoding the 5hydroxytryptamine 1c receptor (5HTR) [9]. To study whether Rfz-1 modulated the subcellular distribution of
Research Paper frizzled and Wnt signaling Yang-Snyder et al.
1303
Figure 1 Expression of Rfz-1 increases the extent of localization at the plasma membrane of Xwnt-8myc but not Xwnt-5Amyc. (a) Xwnt-8myc is localized intracellularly within the endoplasmic reticulum (ER) and Golgi, and is also present at moderate levels in association with the plasma membrane, after coinjection with control (5HTR) RNA. (b) Following coinjection of Rfz-1 RNA, the Xwnt8myc accumulates at the plasma membrane, while there is a decrease in intracellular-, ERand Golgi-associated staining. (c) Xwnt5Amyc is present intracellularly within the ER and Golgi, with low levels at the plasma membrane, after coinjection with control (5HTR) RNA. (d) Following coinjection of Rfz-1 RNA, the localization of Xwnt-5Amyc resembles controls (c) and is distinct from the membrane-associated Xwnt-8myc (b).
either functionally distinct Wnt, we used indirect immunofluorescence and confocal microscopy to monitor the distribution of the c-myc epitope (Fig. 1). We found that there was an increase in Xwnt-8myc at the plasma membrane, and a decrease in intracellular levels, when Xwnt-8myc was coexpressed with Rfz-1 (Fig. 1b) compared with when it was coexpressed with 5HTR (Fig. 1a). In contrast, the subcellular distribution of Xwnt5Amyc was comparable in the presence of either Rfz-1 (Fig. 1d) or 5HTR (Fig. 1c). That some of each Xwnt is detectable at the cell surface in the control explants (Fig. 1a,c) is consistent with Wnts being secreted proteins [1,2], and with these explants expressing multiple endogenous frizzled-related genes (data not shown). Analyzing explants which were not permeabilized with detergent prior to staining for c-myc, we observed that Rfz-1 increased the staining of extracellular Xwnt-8myc (data not shown). These results demonstrate that Rfz-1 stabilizes or recruits Xwnt-8myc to the plasma membrane, suggesting that Rfz-1 is a candidate for participating in Wnt signaling in a manner which distinguishes between functionally distinct Wnts. Expression of Rfz-1 recruits GFP-tagged Xdsh to the plasma membrane
Studies in Xenopus embryos have identified homologs of the known cytoplasmic components of the Drosophila wingless signaling pathway, including dsh [10], glycogen synthase kinase-3 (Xgsk-3) [11–12], and b-catenin [13–14]. Epistasis experiments in Drosophila place dsh at the top of this hierarchy of genetic interactions, and thus potentially nearest to a hypothetical Wnt receptor [5]. Further biochemical
data suggest that a small pool of dsh associates with a membrane fraction in response to Wnt signaling [15]. As dsh is also required for frizzled function in Drosophila [6], we tested whether Rfz-1, like Wnt signaling [15], could affect the subcellular localization of a dsh homolog. In the absence of ectopic Rfz-1, Xenopus dsh tagged with green fluorescent protein (Xdsh–GFP) was distributed in cells of Xenopus embryos with a punctate cellular distribution (Fig. 2c), as reported for dsh in late-stage Drosophila embryos [15]. However, coexpression of Xdsh–GFP with Rfz-1 resulted in a pronounced redistribution of Xdsh–GFP to the plasma membrane (Fig. 2d). These data demonstrate that Rfz-1, like Wnt signaling [15], increases the membrane association of a dsh homolog. We tested two additional aspects of the recruitment of Xdsh–GFP to the plasma membrane. As the above data showed that Rfz-1 led to a dramatic recruitment of Xdsh–GFP to the membrane, we asked whether this was sensitive to the level of Rfz-1. We found that lower amounts of Rfz-1 recruited less of the Xdsh–GFP to the membrane, which then accumulated to greater levels in the cytoplasmic compartment (data not shown). As this amount of Rfz-1 is nevertheless able to modulate gene expression in animal cap explants (discussed below) these results are consistent with evidence from Drosophila [15] that Wnt signaling can occur without a complete translocation of cytoplasmic dsh to the plasma membrane. Second, we asked whether ectopic expression of Xwnt-8 in animal caps would drive ectopic Xdsh–GFP to the plasma membrane. We found that Xwnt-8 did not promote the strong translocation of Xdsh–GFP to the plasma membrane, again consistent with minimal effects of Drosophila Wnt
1304
Current Biology 1996, Vol 6 No 10
Figure 2 Expression of Rfz-1 recruits GFP-tagged Xdsh to the plasma membrane. (a) Schematic diagram of Xdsh–GFP construct. (b) Control GFP localizes to both the cytoplasm and nucleus (N) of animal cap cells. (c) Xdsh–GFP is present throughout the cytoplasm in a punctate association with intracellular vesicles, after coexpression with control 5HTR. Diffuse and punctate Xdsh–GFP fluorescence is present in association with large organelles, which are found throughout the cytoplasm. (d) Xdsh–GFP is dramatically localized at the plasma membrane after coexpression with Rfz-1. Diffuse Xdsh–GFP fluorescence is also present in association with large intracellular organelles. In contrast to Xdsh–GFP injected caps (c), in cells coexpressing Rfz-1, the organelles associated with Xdsh–GFP were found exclusively in close apposition to the plasma membrane facing the blastocoel. Furthermore, few if any bright Xdsh–GFP spots were found in association with these organelles.
signaling on the translocation to the membrane of dsh [15], and consistent with the possibility that, without ectopic frizzled homologs, there are insufficient binding sites on the plasma membrane to recruit the ectopic Xdsh–GFP. Both Rfz-1 and Xwnt-8 induce Xnr-3 and siamois in a Xgsk-3-sensitive manner
The above experiments demonstrate that Rfz-1 modulates the subcellular distribution of one but not another functionally distinct Wnt, as well as a homolog of dsh. Whether these effects of Rfz-1 are direct biochemical interactions or require additional proteins is an important and unresolved issue, but would not address whether Rfz-1 functioned in a signaling capacity. We therefore pursued the issue of signaling by asking whether Rfz-1 would elicit changes in gene expression comparable to those obtained by a Wnt in explants of Xenopus embryos, and whether the activities of both Wnts and Rfz-1 would be reduced by Xgsk-3, which antagonizes Wnt signaling in Xenopus embryos by regulating the stability of b-catenin [16]. The genes Xnr-3 [17] and siamois [18] were induced by Xwnt-8 RNA in animal cap explants of Xenopus embryos (Fig. 3, lane 2), establishing these markers as a ‘read-out’ of Wnt signaling in this assay. These same genes were also reproducibly induced by Rfz-1 in this assay (Fig. 3, lane 3), whereas a frame-shifted hedgehog RNA, injected as a control, did not (Fig. 3, lane 1). The induction of these genes establishes that a frizzled homolog elicits a cellular response comparable to that obtained by Wnts, which presumably work in this system by activating an endogenous receptor. Whether frizzled induces these genes in a manner dependent upon endogenous ligands (for
example, Xwnt-8b [19]) in this assay is not known, but it is possible that, with overexpression of the receptor, the response could be ligand-independent. The comparable changes in gene expression in response to either Xwnt-8 or Rfz-1 are consistent with the activation of a shared signaling pathway. To test this further, we coexpressed Xgsk-3 in the presence of either Xwnt-8 or Rfz-1, to ask whether this known antagonist of Wnt signaling [5,16] would interfere with the ability of Rfz-1 to induce the marker genes. We observed that the induction of Xnr-3 and siamois by both Xwnt-8 (Fig. 3a, compare lanes 2 and 4) and by Rfz-1 (Fig. 3a, compare lanes 3 and 5) was reduced by Xgsk-3. This result supports the hypothesis that a shared signaling pathway activated by Xwnt-8 and by Rfz-1 contains a Xgsk-3-sensitive component(s). If induction of Xnr-3 and siamois by Xwnt-8 and Rfz-1 occurred via independent pathways, one might expect that coinjection of Xwnt-8 and Rfz-1 RNAs would result in an additive induction of these genes. However, a greater than additive induction might be expected if Xwnt-8 were capable of activating the signaling function of Rfz-1. To test this hypothesis, serial dilutions of Xwnt8 and Rfz-1 were used to find doses which would induce only low levels of Xnr3 and siamois expression (data not shown). When injected alone, these doses of Xwnt-8 (Fig. 3b, lane 2) and Rfz-1 (Fig. 3b, lane 3) induced low levels of Xnr-3 and siamois. When injected together, however, these doses of Xwnt-8 and Rfz-1 synergized to induce greater levels of Xnr3 and siamois (Fig. 3b, lane 4), suggesting that Xwnt-8 and Rfz-1 cooperate in a common signaling pathway. Finally, as siamois is likely to be an
Research Paper frizzled and Wnt signaling Yang-Snyder et al.
Figure 3
Injected RNAs
(a)
1 2 3 4 Control Xwnt-8 Rfz1 Xwnt–8 + + + control control Xgsk-3
5 Rfz1 + Xgsk-3
Xnr-3
siamois
H4
H4-RT
1 2 3 4 Control Xwnt-8 Rfz1 Xwnt-8 + + + control control Rfz1
(b)
Xnr-3
siamois
H4
1305
integral component of the hierarchy of regulatory genes which specify formation of the gastrula organizer [18], its induction by Xwnt-8 and Rfz-1 further support our longstanding hypothesis that a maternal Wnt pathway plays a key role in initiating the formation of the endogenous embryonic axes (reviewed in [16,19]).
Conclusions We have demonstrated that cells expressing Rfz-1 show an ability to recruit to the cell surface one but not another functionally distinct Wnt, as well as recruiting a cytoplasmic component of the Wnt pathway, dsh, to the plasma membrane. After submission of this manuscript, a related study was published [20], demonstrating that a new member of the Drosophila frizzled family, Dfz-2, stabilizes wingless (Drosophila Wnt-1) on the surface of cells. Taken with the current data, these two studies suggest evolutionary conservation of this activity of members of the frizzled family. Moreover, we have shown that Rfz-1 is sufficient to elicit changes in gene expression similar to those observed in response to Wnt expression, that Rfz-1 works synergistically with a Wnt in this assay, and that these changes in gene expression are reduced by glycogen synthase kinase-3, which antagonizes the Wnt pathway. We conclude that a vertebrate homolog of the Drosophila gene frizzled displays several properties consistent with its acting as a Wnt receptor, or part of a Wnt receptor complex. Important remaining issues include whether Rfz-1 binds directly or indirectly to Wnts or dsh, whether frizzled homologs are sufficient to act as receptors or are instead part of a multimeric complex, and the ongoing challenge of establishing the biochemical and cellular mechanisms by which Wnt signaling leads to changes in cell fate and cell behaviour.
Materials and methods H4-RT
Rfz-1 and Xwnt-8 synergistically induce Xnr-3 and siamois in a Xgsk-3sensitive manner. (a) Both Xwnt-8 (lane 2) and Rfz-1 (lane 3) induce expression of Xnr-3 and siamois in animal cap explants. This induction is inhibited by coinjection with Xgsk-3 RNA (lanes 4,5). Injection of frame-shifted hedgehog RNA (control) does not induce Xnr-3 or siamois (lane 1). Histone H4 (H4 panel) serves as a control for the reverse transcriptase (RT) reaction and gel loading. The polymerase chain reaction (PCR) was performed on duplicate samples of total RNA which had not been reverse transcribed, serving as a control for contamination with genomic DNA. The H4-RT panel is a representative example, obtained with the H4 primers. No signal was ever detected in the comparable minus reverse transcriptase controls for this or any other primers used. (b) Doses of Xwnt-8 (lane 2) and Rfz-1 (lane 3) RNA which result in submaximal induction of Xnr-3 and siamois synergize when coinjected, resulting in greater than additive induction of these genes (lane 4). As in (a), control RNA (lane 1) does not induce either gene. In another experiment with a greater dose of Xwnt-8 RNA the greater than additive induction of siamois (lane 4 relative to lanes 2,3) was evident but less dramatic.
Effects of Rfz-1 on membrane association of epitopetagged Wnts Synthetic mRNAs encoding either myc-tagged Xwnt-8 [21] or myctagged Xwnt-5A [22] were co-injected with mRNAs encoding 5HTR [9] or Rfz-1 [3] into the animal pole of 2- and 4-cell stage Xenopus embryos. Both Xwnt genes were in the vector pSP64T [23], whereas Rfz-1 was in the vector pCS2+ (a gift from D. Turner and R. Rupp). Approximately 0.25 ng of either Xwnt-8myc or Xwnt-5Amyc and 1 ng of either 5HTR or Rfz-1 mRNA were injected into each blastomere. Embryos were reared to stage 9, then animal caps were dissected and fixed in 4 % paraformaldehyde–PBS for 1–2 h at room temperature. Caps were washed in PBT (PBS plus 0.2 % Triton X-100) and incubated in antimyc monoclonal antibody (1:10 in PBT plus 10 % normal goat serum) overnight at 4 °C. Following several washes in PBT, caps were incubated in CY-3 conjugated goat anti-mouse antibodies (Jackson Immunolabs) for 2–4 h at room temperature. Caps were washed in PBT and mounted in Vectashield (Vector). Micrographs were obtained with a BioRad MRC-600 laser scanning confocal microscope using the rhodamine filter and a 20×, 0.75 N/A Plan-Apo objective. Images in the figure represent 10 sections per micrograph, taken at 1.5 nm Z steps.
Effects of Rfz-1 on cytoplasmic localization of dishevelled–GFP Animal poles of 4-cell stage Xenopus embryos were injected with either GFP RNA (0.5 ng), or Xdsh–GFP RNA (0.5 ng), in the presence
1306
Current Biology 1996, Vol 6 No 10
of either Rfz-1 RNA (2 ng) or 5HTR RNA (2 ng). Embryos were reared to stage 9 and animal caps were dissected and fixed in 4 % paraformaldehyde–PBS for 1–2 h at room temperature. Caps were washed in PBT and mounted in Vectashield. Micrographs were obtained with a BioRad MRC-600 laser scanning confocal microscope using the fluoroscein filter and a 60×, 1.4 N/A Plan-Apo objective. Images in the figure represent 10 sections per micrograph, taken at 1.5 nm Z steps. Xdsh–GFP was constructed by PCR amplification of full-length Xdsh [8], followed by subcloning of the product in-frame into the RNA expression vector pCS2+. The GFP gene [24] was then cloned in-frame at the carboxyl terminus of Xdsh.
Effects of Xgsk-3 and Xwnt-8 on gene expression induced by Rfz-1 Two-cell Xenopus embryos were injected with RNA as follows. For Figure 3a, Xwnt-8 (7.2 pg) or Rfz-1 1 (1.8 ng) RNAs were injected with either a control RNA (7.2 ng) or with Xgsk-3 RNA [16] (7.2 ng). For Figure 3b, Xwnt-8 (1.4 pg) and Rfz-1 (700 pg) RNAs were injected together or with a control RNA such that each embryo received approximately 700 pg of RNA. Animal caps were cut at stage 8 and cultured until sibling embryos reached stage 10. RNA preparation and RT–PCR was carried out as described previously with primers specific for Histone H4 [19], Xnr-3 (forward primer, 5′–3′ TCCACTTGTGCAGTTCCACAG; and reverse, 5′–3′ ATCTCTTCATGGTGCCTCAGG), and siamois (forward primer, 5′–3′ CTCCAGCCACCAGTACCAGATC; and reverse, 5′–3′ GGGGAGAGTGGAAAGTGGTTG). The PCR experiment in Fig. 3a was conducted in quadruplicate with comparable results; the data shown in Figure 3b were reflective of two experiments. Serial dilutions of these cDNAs demonstrated that this analysis was carried out in the exponential phase of PCR amplification.
10. 11. 12. 13. 14. 15. 16.
17. 18.
19. 20.
Acknowledgements The first three authors contributed equally to this work. We thank Henk Roelink for the rat frizzled-1 cDNA, Sergei Sokol for the Xenopus dishevelled cDNA, William Busa for the 5HTR cDNA, Rebecca Bates for assistance in cDNA construction, Minh Vo Sum for assistance in preparing figures, Stefan Hoppler, L. Lynn McGrew and the reviewers for comments on the manuscript, and the Keck Center for Advanced Studies of Neural Signaling for use of the confocal microscope. J.Y-S., and J.R.M. are Associates, and R.T.M an investigator, of the Howard Hughes Medical Institute, which supported this research. J.D.B. and C.J.L. were supported by Public Health Service Awards from the NIH.
References 1. Nusse R, Varmus HE: Wnt genes. Cell 1992, 69:1073–87. 2. Parr BA, McMahon AP: Wnt genes and vertebrate development. Curr Opin Genet Dev 1994, 4:523–528. 3. Wang Y, Macke JP, Abella BS, Andreasson K, Worley P, Gilbert DJ, et al.: A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J Biol Chem 1996, 271:4468–4476. 4. Chan SD, Karpf DB, Fowlkes ME, Hooks M, Bradley MS, Vuong V, et al.: Two homologs of the Drosophila polarity gene frizzled (fz) are widely expressed in mammalian tissues. J Biol Chem 1992, 267:25202–25207. 5. Klingensmith J, Nusse R: Signaling by wingless in Drosophila. Dev Biol 1994, 166:396–414. 6. Krasnow RE, Wong LL, Adler PN: dishevelled is a component of the frizzled signaling pathway in Drosophila. Development 1995, 121:4095–4102. 7. Torres MA, Yang-Snyder JA, Purcell SM, DeMarais AA, McGrew LL, Moon RT: Activities of the Wnt-1 class of secreted signaling factors are antagonized by the Wnt-5A class, and by a dominant negative cadherin, in early Xenopus development. J Cell Biol 1996, 133:1123–1137. 8. Du S, Purcell S, Christian J, McGrew L, Moon R: Identification of distinct classes and functional domains of Wnts through expression of wild-type and chimeric proteins in Xenopus embryos. Mol Cell Biol 1995, 15:2625–2634. 9. Ault KT, Durmowicz G, Harger PL, Galione A, Busa WB: Modulation of Xenopus embryo mesoderm-specific gene expression and dorso-anterior patterning by receptors that activate the
21. 22.
23. 24.
phosphatidylinositol cycle signal transduction pathway. Development 1996, 122:2033–2041. Sokol SY, Klingensmith J, Perrimon N, Itoh K: Dorsalizing and neuralizing properties of Xdsh, a maternally expressed Xenopus homolog of dishevelled. Development 1995, 121:1637–1647. Pierce SB, Kimelman D: Regulation of Spemann organizer formation by the intracellular kinase Xgsk-3. Development 1995, 121:755–65. Dominguez I, Itoh K, Sokol SY: Role of glycogen synthase kinase 3beta as a negative regulator of dorsoventral axis formation in Xenopus embryos. Proc Natl Acad Sci USA 1995, 92:8498–8502. DeMarais AA, Moon RT: The armadillo homologs beta-catenin and plakoglobin are differentially expressed during early development of Xenopus laevis. Dev Biol 1992, 153:337–346. Funayama N, Fagotto F, McCrea P, Grumbiner BM: Embryonic axis induction by the armadillo repeat domain of beta-catenin: evidence for intracellular signaling. J Cell Biol 1995, 128:959–968. Yanagawa S, van Leeuwen F, Wodarz A, Klingensmith J, Nusse R: The dishevelled protein is modified by wingless signaling in Drosophila. Genes Dev 1995, 9:1087–1097. Yost C, Torres M, Miller JR, Huang E, Kimelman D, Moon RT: The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev 1996, 10:1443–1454. Smith WC, McKendry R, Ribisi S, Harland RM: A nodal-related gene defines a physical and functional domain within the Spemann organizer. Cell 1995, 82:37–46. Lemaire P, Garrett N, Gurdon JB: Expression cloning of siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell 1995, 81:85–94. Cui Y, Brown JD, Moon RT, Christian JL: Xwnt-8b: a maternally expressed Xenopus Wnt gene with a potential role in establishing the dorsoventral axis. Development 1995, 121:2177–2186. Bhanot P, Brink M, Samos CH, Hsieh J-C, Wang Y, Macke JP, et al.: A new member of the frizzled family from Drosophila functions as a wingless receptor. Nature 1996, 382:225–230. Christian JL, Moon RT: Interactions between Xwnt-8 and Spemann organizer signaling pathways generate dorsoventral pattern in the embryonic mesoderm of Xenopus. Genes Dev 1993, 7:13–28. Moon RT, Campbell RM, Christian JL, McGrew LL, Shih J, Fraser S: Xwnt-5A: a maternal Wnt that affects morphogenetic movements after overexpression in embryos of Xenopus laevis. Development 1993, 119:97–111. Krieg PA, Melton DA: Function messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res 1984, 12:7057–7070. Heim R, Cubitt AB, Tsien RY: Improved green fluorescence. Nature 1995, 373:663–664.
Research Paper
A frizzled homolog functions in a vertebrate Wnt signaling pathway Julia Yang-Snyder*, Jeffrey R. Miller*, Jeffrey D. Brown*†, Cheng-Jung Lai*‡ and Randall T. Moon* Background: Wnts are secreted proteins implicated in cell–cell interactions during embryogenesis and tumorigenesis, but receptors involved in transducing Wnt signals have not yet been definitively identified. Members of a large family of putative transmembrane receptors homologous to the frizzled protein in Drosophila have been identified recently in both vertebrates and invertebrates, raising the question of whether they are involved in transducing signals for any known signaling factors. Results: To test the potential involvement of frizzled homologs in Wnt signaling, we examined the effects of overexpressing rat frizzled-1 (Rfz-1) on the subcellular distribution of Wnts and of dishevelled, a cytoplasmic component of the Wnt signalling pathway. We demonstrate that ectopic expression of Rfz-1 recruits the dishevelled protein — as well as Xenopus Wnt-8 (Xwnt-8), but not the functionally distinct Xwnt-5A — to the plasma membrane. Moreover, Rfz-1 is sufficient to induce the expression of two Xwnt-8-responsive genes, siamois and Xnr-3, in Xenopus explants in a manner which is antagonized by glycogen synthase kinase-3, which also antagonizes Wnt signaling. When Rfz-1 and Xwnt-8 are expressed together in this assay, we observe greater induction of these genes, indicating that Rfz-1 can synergize with a Wnt.
Addresses: *Howard Hughes Medical Institute and Department of Pharmacology, and †Molecular and Cellular Biology Program, University of Washington School of Medicine, Seattle, Washington 98195, USA. ‡Present
address: Howard Hughes Medical Institute, Harvard University, Fairchild Biochemistry Building, 7 Divinity Avenue, Cambridge, Massachusetts 02138, USA. Correspondence: Randall T. Moon E-mail: [email protected] Received: 18 July 1996 Revised: 19 August 1996 Accepted: 2 September 1996 Current Biology 1996, Vol 6 No 10:1302–1306 © Current Biology Ltd ISSN 0960-9822
Conclusions: The results demonstrate that a vertebrate frizzled homolog is involved in Wnt signaling in a manner which discriminates between functionally distinct Wnts, which involves translocation of the dishevelled protein to the plasma membrane, and which works in a synergistic manner with Wnts to induce gene expression. These data support the likely function of frizzled homologs as Wnt receptors, or as components of a receptor complex.
Background Several families of secreted factors, including Wnts [1,2], have been implicated in mediating embryological events and tumorigenesis. Although it has been shown that Wnts can signal in a non-cell-autonomous manner and are putative ligands, identification of candidate Wnt receptors has been hindered by the relative insolubility of Wnt proteins and by their tight association with cells [1,2]. However, vertebrate homologs of Drosophila frizzled have emerged as a large family of candidate transmembrane receptors [3,4]. Recent data have shown that dishevelled (dsh) is genetically downstream of both frizzled and Drosophila Wnt-1 (wingless) [5,6], raising the question of whether vertebrate homologs of frizzled [3,4] function directly in a Wnt signaling pathway. To pursue this question we chose animal cap explants of Xenopus embryos, rather than a cultured cell system, because some responses to Wnt signals are affected by cell adhesion [7]. We reasoned that this explant system would allow combined cell biological and molecular approaches using cells which are normally exposed to Wnt signals [7,8],
while maintaining the cells in a physiological state of adhesion.
Results and discussion Expression of Rfz-1 increases the extent of localization at the plasma membrane of Xwnt-8myc but not Xwnt-5Amyc
If frizzled homologs were expressed on the cell surface and involved in transducing a Wnt signal, potentially as part of a receptor complex, increased synthesis of frizzled polypeptides might increase the association of Wnts with the surface of these cells. As Wnts can be grouped into the functionally distinct Wnt-1 class (including Xenopus Wnt-1 (Xwnt-1), -3A, -8 and -8b) and the Wnt-5A class (including Xwnt-5A, -4 and -11) [7,8], a candidate Wnt receptor may interact with some but not all Wnts. To test these possibilities, we injected Xenopus embryos with RNAs encoding c-myc-tagged Xwnt-8 (Xwnt-8myc) or Xwnt-5A (Xwnt-5Amyc) in the presence of rat frizzled-1 (Rfz-1) RNA [4] or, as a control, RNA encoding the 5hydroxytryptamine 1c receptor (5HTR) [9]. To study whether Rfz-1 modulated the subcellular distribution of
Research Paper frizzled and Wnt signaling Yang-Snyder et al.
1303
Figure 1 Expression of Rfz-1 increases the extent of localization at the plasma membrane of Xwnt-8myc but not Xwnt-5Amyc. (a) Xwnt-8myc is localized intracellularly within the endoplasmic reticulum (ER) and Golgi, and is also present at moderate levels in association with the plasma membrane, after coinjection with control (5HTR) RNA. (b) Following coinjection of Rfz-1 RNA, the Xwnt8myc accumulates at the plasma membrane, while there is a decrease in intracellular-, ERand Golgi-associated staining. (c) Xwnt5Amyc is present intracellularly within the ER and Golgi, with low levels at the plasma membrane, after coinjection with control (5HTR) RNA. (d) Following coinjection of Rfz-1 RNA, the localization of Xwnt-5Amyc resembles controls (c) and is distinct from the membrane-associated Xwnt-8myc (b).
either functionally distinct Wnt, we used indirect immunofluorescence and confocal microscopy to monitor the distribution of the c-myc epitope (Fig. 1). We found that there was an increase in Xwnt-8myc at the plasma membrane, and a decrease in intracellular levels, when Xwnt-8myc was coexpressed with Rfz-1 (Fig. 1b) compared with when it was coexpressed with 5HTR (Fig. 1a). In contrast, the subcellular distribution of Xwnt5Amyc was comparable in the presence of either Rfz-1 (Fig. 1d) or 5HTR (Fig. 1c). That some of each Xwnt is detectable at the cell surface in the control explants (Fig. 1a,c) is consistent with Wnts being secreted proteins [1,2], and with these explants expressing multiple endogenous frizzled-related genes (data not shown). Analyzing explants which were not permeabilized with detergent prior to staining for c-myc, we observed that Rfz-1 increased the staining of extracellular Xwnt-8myc (data not shown). These results demonstrate that Rfz-1 stabilizes or recruits Xwnt-8myc to the plasma membrane, suggesting that Rfz-1 is a candidate for participating in Wnt signaling in a manner which distinguishes between functionally distinct Wnts. Expression of Rfz-1 recruits GFP-tagged Xdsh to the plasma membrane
Studies in Xenopus embryos have identified homologs of the known cytoplasmic components of the Drosophila wingless signaling pathway, including dsh [10], glycogen synthase kinase-3 (Xgsk-3) [11–12], and b-catenin [13–14]. Epistasis experiments in Drosophila place dsh at the top of this hierarchy of genetic interactions, and thus potentially nearest to a hypothetical Wnt receptor [5]. Further biochemical
data suggest that a small pool of dsh associates with a membrane fraction in response to Wnt signaling [15]. As dsh is also required for frizzled function in Drosophila [6], we tested whether Rfz-1, like Wnt signaling [15], could affect the subcellular localization of a dsh homolog. In the absence of ectopic Rfz-1, Xenopus dsh tagged with green fluorescent protein (Xdsh–GFP) was distributed in cells of Xenopus embryos with a punctate cellular distribution (Fig. 2c), as reported for dsh in late-stage Drosophila embryos [15]. However, coexpression of Xdsh–GFP with Rfz-1 resulted in a pronounced redistribution of Xdsh–GFP to the plasma membrane (Fig. 2d). These data demonstrate that Rfz-1, like Wnt signaling [15], increases the membrane association of a dsh homolog. We tested two additional aspects of the recruitment of Xdsh–GFP to the plasma membrane. As the above data showed that Rfz-1 led to a dramatic recruitment of Xdsh–GFP to the membrane, we asked whether this was sensitive to the level of Rfz-1. We found that lower amounts of Rfz-1 recruited less of the Xdsh–GFP to the membrane, which then accumulated to greater levels in the cytoplasmic compartment (data not shown). As this amount of Rfz-1 is nevertheless able to modulate gene expression in animal cap explants (discussed below) these results are consistent with evidence from Drosophila [15] that Wnt signaling can occur without a complete translocation of cytoplasmic dsh to the plasma membrane. Second, we asked whether ectopic expression of Xwnt-8 in animal caps would drive ectopic Xdsh–GFP to the plasma membrane. We found that Xwnt-8 did not promote the strong translocation of Xdsh–GFP to the plasma membrane, again consistent with minimal effects of Drosophila Wnt
1304
Current Biology 1996, Vol 6 No 10
Figure 2 Expression of Rfz-1 recruits GFP-tagged Xdsh to the plasma membrane. (a) Schematic diagram of Xdsh–GFP construct. (b) Control GFP localizes to both the cytoplasm and nucleus (N) of animal cap cells. (c) Xdsh–GFP is present throughout the cytoplasm in a punctate association with intracellular vesicles, after coexpression with control 5HTR. Diffuse and punctate Xdsh–GFP fluorescence is present in association with large organelles, which are found throughout the cytoplasm. (d) Xdsh–GFP is dramatically localized at the plasma membrane after coexpression with Rfz-1. Diffuse Xdsh–GFP fluorescence is also present in association with large intracellular organelles. In contrast to Xdsh–GFP injected caps (c), in cells coexpressing Rfz-1, the organelles associated with Xdsh–GFP were found exclusively in close apposition to the plasma membrane facing the blastocoel. Furthermore, few if any bright Xdsh–GFP spots were found in association with these organelles.
signaling on the translocation to the membrane of dsh [15], and consistent with the possibility that, without ectopic frizzled homologs, there are insufficient binding sites on the plasma membrane to recruit the ectopic Xdsh–GFP. Both Rfz-1 and Xwnt-8 induce Xnr-3 and siamois in a Xgsk-3-sensitive manner
The above experiments demonstrate that Rfz-1 modulates the subcellular distribution of one but not another functionally distinct Wnt, as well as a homolog of dsh. Whether these effects of Rfz-1 are direct biochemical interactions or require additional proteins is an important and unresolved issue, but would not address whether Rfz-1 functioned in a signaling capacity. We therefore pursued the issue of signaling by asking whether Rfz-1 would elicit changes in gene expression comparable to those obtained by a Wnt in explants of Xenopus embryos, and whether the activities of both Wnts and Rfz-1 would be reduced by Xgsk-3, which antagonizes Wnt signaling in Xenopus embryos by regulating the stability of b-catenin [16]. The genes Xnr-3 [17] and siamois [18] were induced by Xwnt-8 RNA in animal cap explants of Xenopus embryos (Fig. 3, lane 2), establishing these markers as a ‘read-out’ of Wnt signaling in this assay. These same genes were also reproducibly induced by Rfz-1 in this assay (Fig. 3, lane 3), whereas a frame-shifted hedgehog RNA, injected as a control, did not (Fig. 3, lane 1). The induction of these genes establishes that a frizzled homolog elicits a cellular response comparable to that obtained by Wnts, which presumably work in this system by activating an endogenous receptor. Whether frizzled induces these genes in a manner dependent upon endogenous ligands (for
example, Xwnt-8b [19]) in this assay is not known, but it is possible that, with overexpression of the receptor, the response could be ligand-independent. The comparable changes in gene expression in response to either Xwnt-8 or Rfz-1 are consistent with the activation of a shared signaling pathway. To test this further, we coexpressed Xgsk-3 in the presence of either Xwnt-8 or Rfz-1, to ask whether this known antagonist of Wnt signaling [5,16] would interfere with the ability of Rfz-1 to induce the marker genes. We observed that the induction of Xnr-3 and siamois by both Xwnt-8 (Fig. 3a, compare lanes 2 and 4) and by Rfz-1 (Fig. 3a, compare lanes 3 and 5) was reduced by Xgsk-3. This result supports the hypothesis that a shared signaling pathway activated by Xwnt-8 and by Rfz-1 contains a Xgsk-3-sensitive component(s). If induction of Xnr-3 and siamois by Xwnt-8 and Rfz-1 occurred via independent pathways, one might expect that coinjection of Xwnt-8 and Rfz-1 RNAs would result in an additive induction of these genes. However, a greater than additive induction might be expected if Xwnt-8 were capable of activating the signaling function of Rfz-1. To test this hypothesis, serial dilutions of Xwnt8 and Rfz-1 were used to find doses which would induce only low levels of Xnr3 and siamois expression (data not shown). When injected alone, these doses of Xwnt-8 (Fig. 3b, lane 2) and Rfz-1 (Fig. 3b, lane 3) induced low levels of Xnr-3 and siamois. When injected together, however, these doses of Xwnt-8 and Rfz-1 synergized to induce greater levels of Xnr3 and siamois (Fig. 3b, lane 4), suggesting that Xwnt-8 and Rfz-1 cooperate in a common signaling pathway. Finally, as siamois is likely to be an
Research Paper frizzled and Wnt signaling Yang-Snyder et al.
Figure 3
Injected RNAs
(a)
1 2 3 4 Control Xwnt-8 Rfz1 Xwnt–8 + + + control control Xgsk-3
5 Rfz1 + Xgsk-3
Xnr-3
siamois
H4
H4-RT
1 2 3 4 Control Xwnt-8 Rfz1 Xwnt-8 + + + control control Rfz1
(b)
Xnr-3
siamois
H4
1305
integral component of the hierarchy of regulatory genes which specify formation of the gastrula organizer [18], its induction by Xwnt-8 and Rfz-1 further support our longstanding hypothesis that a maternal Wnt pathway plays a key role in initiating the formation of the endogenous embryonic axes (reviewed in [16,19]).
Conclusions We have demonstrated that cells expressing Rfz-1 show an ability to recruit to the cell surface one but not another functionally distinct Wnt, as well as recruiting a cytoplasmic component of the Wnt pathway, dsh, to the plasma membrane. After submission of this manuscript, a related study was published [20], demonstrating that a new member of the Drosophila frizzled family, Dfz-2, stabilizes wingless (Drosophila Wnt-1) on the surface of cells. Taken with the current data, these two studies suggest evolutionary conservation of this activity of members of the frizzled family. Moreover, we have shown that Rfz-1 is sufficient to elicit changes in gene expression similar to those observed in response to Wnt expression, that Rfz-1 works synergistically with a Wnt in this assay, and that these changes in gene expression are reduced by glycogen synthase kinase-3, which antagonizes the Wnt pathway. We conclude that a vertebrate homolog of the Drosophila gene frizzled displays several properties consistent with its acting as a Wnt receptor, or part of a Wnt receptor complex. Important remaining issues include whether Rfz-1 binds directly or indirectly to Wnts or dsh, whether frizzled homologs are sufficient to act as receptors or are instead part of a multimeric complex, and the ongoing challenge of establishing the biochemical and cellular mechanisms by which Wnt signaling leads to changes in cell fate and cell behaviour.
Materials and methods H4-RT
Rfz-1 and Xwnt-8 synergistically induce Xnr-3 and siamois in a Xgsk-3sensitive manner. (a) Both Xwnt-8 (lane 2) and Rfz-1 (lane 3) induce expression of Xnr-3 and siamois in animal cap explants. This induction is inhibited by coinjection with Xgsk-3 RNA (lanes 4,5). Injection of frame-shifted hedgehog RNA (control) does not induce Xnr-3 or siamois (lane 1). Histone H4 (H4 panel) serves as a control for the reverse transcriptase (RT) reaction and gel loading. The polymerase chain reaction (PCR) was performed on duplicate samples of total RNA which had not been reverse transcribed, serving as a control for contamination with genomic DNA. The H4-RT panel is a representative example, obtained with the H4 primers. No signal was ever detected in the comparable minus reverse transcriptase controls for this or any other primers used. (b) Doses of Xwnt-8 (lane 2) and Rfz-1 (lane 3) RNA which result in submaximal induction of Xnr-3 and siamois synergize when coinjected, resulting in greater than additive induction of these genes (lane 4). As in (a), control RNA (lane 1) does not induce either gene. In another experiment with a greater dose of Xwnt-8 RNA the greater than additive induction of siamois (lane 4 relative to lanes 2,3) was evident but less dramatic.
Effects of Rfz-1 on membrane association of epitopetagged Wnts Synthetic mRNAs encoding either myc-tagged Xwnt-8 [21] or myctagged Xwnt-5A [22] were co-injected with mRNAs encoding 5HTR [9] or Rfz-1 [3] into the animal pole of 2- and 4-cell stage Xenopus embryos. Both Xwnt genes were in the vector pSP64T [23], whereas Rfz-1 was in the vector pCS2+ (a gift from D. Turner and R. Rupp). Approximately 0.25 ng of either Xwnt-8myc or Xwnt-5Amyc and 1 ng of either 5HTR or Rfz-1 mRNA were injected into each blastomere. Embryos were reared to stage 9, then animal caps were dissected and fixed in 4 % paraformaldehyde–PBS for 1–2 h at room temperature. Caps were washed in PBT (PBS plus 0.2 % Triton X-100) and incubated in antimyc monoclonal antibody (1:10 in PBT plus 10 % normal goat serum) overnight at 4 °C. Following several washes in PBT, caps were incubated in CY-3 conjugated goat anti-mouse antibodies (Jackson Immunolabs) for 2–4 h at room temperature. Caps were washed in PBT and mounted in Vectashield (Vector). Micrographs were obtained with a BioRad MRC-600 laser scanning confocal microscope using the rhodamine filter and a 20×, 0.75 N/A Plan-Apo objective. Images in the figure represent 10 sections per micrograph, taken at 1.5 nm Z steps.
Effects of Rfz-1 on cytoplasmic localization of dishevelled–GFP Animal poles of 4-cell stage Xenopus embryos were injected with either GFP RNA (0.5 ng), or Xdsh–GFP RNA (0.5 ng), in the presence
1306
Current Biology 1996, Vol 6 No 10
of either Rfz-1 RNA (2 ng) or 5HTR RNA (2 ng). Embryos were reared to stage 9 and animal caps were dissected and fixed in 4 % paraformaldehyde–PBS for 1–2 h at room temperature. Caps were washed in PBT and mounted in Vectashield. Micrographs were obtained with a BioRad MRC-600 laser scanning confocal microscope using the fluoroscein filter and a 60×, 1.4 N/A Plan-Apo objective. Images in the figure represent 10 sections per micrograph, taken at 1.5 nm Z steps. Xdsh–GFP was constructed by PCR amplification of full-length Xdsh [8], followed by subcloning of the product in-frame into the RNA expression vector pCS2+. The GFP gene [24] was then cloned in-frame at the carboxyl terminus of Xdsh.
Effects of Xgsk-3 and Xwnt-8 on gene expression induced by Rfz-1 Two-cell Xenopus embryos were injected with RNA as follows. For Figure 3a, Xwnt-8 (7.2 pg) or Rfz-1 1 (1.8 ng) RNAs were injected with either a control RNA (7.2 ng) or with Xgsk-3 RNA [16] (7.2 ng). For Figure 3b, Xwnt-8 (1.4 pg) and Rfz-1 (700 pg) RNAs were injected together or with a control RNA such that each embryo received approximately 700 pg of RNA. Animal caps were cut at stage 8 and cultured until sibling embryos reached stage 10. RNA preparation and RT–PCR was carried out as described previously with primers specific for Histone H4 [19], Xnr-3 (forward primer, 5′–3′ TCCACTTGTGCAGTTCCACAG; and reverse, 5′–3′ ATCTCTTCATGGTGCCTCAGG), and siamois (forward primer, 5′–3′ CTCCAGCCACCAGTACCAGATC; and reverse, 5′–3′ GGGGAGAGTGGAAAGTGGTTG). The PCR experiment in Fig. 3a was conducted in quadruplicate with comparable results; the data shown in Figure 3b were reflective of two experiments. Serial dilutions of these cDNAs demonstrated that this analysis was carried out in the exponential phase of PCR amplification.
10. 11. 12. 13. 14. 15. 16.
17. 18.
19. 20.
Acknowledgements The first three authors contributed equally to this work. We thank Henk Roelink for the rat frizzled-1 cDNA, Sergei Sokol for the Xenopus dishevelled cDNA, William Busa for the 5HTR cDNA, Rebecca Bates for assistance in cDNA construction, Minh Vo Sum for assistance in preparing figures, Stefan Hoppler, L. Lynn McGrew and the reviewers for comments on the manuscript, and the Keck Center for Advanced Studies of Neural Signaling for use of the confocal microscope. J.Y-S., and J.R.M. are Associates, and R.T.M an investigator, of the Howard Hughes Medical Institute, which supported this research. J.D.B. and C.J.L. were supported by Public Health Service Awards from the NIH.
References 1. Nusse R, Varmus HE: Wnt genes. Cell 1992, 69:1073–87. 2. Parr BA, McMahon AP: Wnt genes and vertebrate development. Curr Opin Genet Dev 1994, 4:523–528. 3. Wang Y, Macke JP, Abella BS, Andreasson K, Worley P, Gilbert DJ, et al.: A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J Biol Chem 1996, 271:4468–4476. 4. Chan SD, Karpf DB, Fowlkes ME, Hooks M, Bradley MS, Vuong V, et al.: Two homologs of the Drosophila polarity gene frizzled (fz) are widely expressed in mammalian tissues. J Biol Chem 1992, 267:25202–25207. 5. Klingensmith J, Nusse R: Signaling by wingless in Drosophila. Dev Biol 1994, 166:396–414. 6. Krasnow RE, Wong LL, Adler PN: dishevelled is a component of the frizzled signaling pathway in Drosophila. Development 1995, 121:4095–4102. 7. Torres MA, Yang-Snyder JA, Purcell SM, DeMarais AA, McGrew LL, Moon RT: Activities of the Wnt-1 class of secreted signaling factors are antagonized by the Wnt-5A class, and by a dominant negative cadherin, in early Xenopus development. J Cell Biol 1996, 133:1123–1137. 8. Du S, Purcell S, Christian J, McGrew L, Moon R: Identification of distinct classes and functional domains of Wnts through expression of wild-type and chimeric proteins in Xenopus embryos. Mol Cell Biol 1995, 15:2625–2634. 9. Ault KT, Durmowicz G, Harger PL, Galione A, Busa WB: Modulation of Xenopus embryo mesoderm-specific gene expression and dorso-anterior patterning by receptors that activate the
21. 22.
23. 24.
phosphatidylinositol cycle signal transduction pathway. Development 1996, 122:2033–2041. Sokol SY, Klingensmith J, Perrimon N, Itoh K: Dorsalizing and neuralizing properties of Xdsh, a maternally expressed Xenopus homolog of dishevelled. Development 1995, 121:1637–1647. Pierce SB, Kimelman D: Regulation of Spemann organizer formation by the intracellular kinase Xgsk-3. Development 1995, 121:755–65. Dominguez I, Itoh K, Sokol SY: Role of glycogen synthase kinase 3beta as a negative regulator of dorsoventral axis formation in Xenopus embryos. Proc Natl Acad Sci USA 1995, 92:8498–8502. DeMarais AA, Moon RT: The armadillo homologs beta-catenin and plakoglobin are differentially expressed during early development of Xenopus laevis. Dev Biol 1992, 153:337–346. Funayama N, Fagotto F, McCrea P, Grumbiner BM: Embryonic axis induction by the armadillo repeat domain of beta-catenin: evidence for intracellular signaling. J Cell Biol 1995, 128:959–968. Yanagawa S, van Leeuwen F, Wodarz A, Klingensmith J, Nusse R: The dishevelled protein is modified by wingless signaling in Drosophila. Genes Dev 1995, 9:1087–1097. Yost C, Torres M, Miller JR, Huang E, Kimelman D, Moon RT: The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev 1996, 10:1443–1454. Smith WC, McKendry R, Ribisi S, Harland RM: A nodal-related gene defines a physical and functional domain within the Spemann organizer. Cell 1995, 82:37–46. Lemaire P, Garrett N, Gurdon JB: Expression cloning of siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell 1995, 81:85–94. Cui Y, Brown JD, Moon RT, Christian JL: Xwnt-8b: a maternally expressed Xenopus Wnt gene with a potential role in establishing the dorsoventral axis. Development 1995, 121:2177–2186. Bhanot P, Brink M, Samos CH, Hsieh J-C, Wang Y, Macke JP, et al.: A new member of the frizzled family from Drosophila functions as a wingless receptor. Nature 1996, 382:225–230. Christian JL, Moon RT: Interactions between Xwnt-8 and Spemann organizer signaling pathways generate dorsoventral pattern in the embryonic mesoderm of Xenopus. Genes Dev 1993, 7:13–28. Moon RT, Campbell RM, Christian JL, McGrew LL, Shih J, Fraser S: Xwnt-5A: a maternal Wnt that affects morphogenetic movements after overexpression in embryos of Xenopus laevis. Development 1993, 119:97–111. Krieg PA, Melton DA: Function messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res 1984, 12:7057–7070. Heim R, Cubitt AB, Tsien RY: Improved green fluorescence. Nature 1995, 373:663–664.