- Email: [email protected]
A fully chimeric IgG antibody for ROR1 suppresses ovarian cancer growth in vitro and in vivo
Biomedicine & Pharmacotherapy 119 (2019) 109420
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
A fully chimeric IgG antibody for ROR1 suppresses ovarian cancer growth in vitro and in vivo Zhengna Yina,b,1, Yuan Maoc,1, Ningzhi Zhanga, Yiping Sub, Jin Zhud, Hua Tongb, Huilin Zhangb,
T
⁎
a
Department of Obstetrics and Gynecology, Fuyang People's Hospital, Fuyang, 236000, China Department of Obstetrics and Gynecology, Women's Hospital of Nanjing Medical University, Nanjing Maternity and Child Health Care Hospital, Nanjing, 210004, China c Department of Hematology and Oncology, Geriatric Hospital of Nanjing Medical University, Jiangsu Province Geriatric Hospital, Nanjing, 210000, China d Huadong Medical Institute of Biotechniques, Nanjing, 210002, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: ROR1 Monoclonal antibody Ovarian cancer Immunotherapy
Background: Over-expression of Receptor-tyrosine-kinase-like Orphan Receptor 1 (ROR1) in cancer cells has been reported in the context of several tumors (including ovarian cancer) and is associated with poor prognosis. The aim of this study was to construct a fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) and investigate its antitumor activity against ovarian cancer cells, bothin vitro and in vivo. Methods: A fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) eukaryotic expression vector was constructed and ROR1-IgG antibody was expressed in CHO cells. The characteristics of ROR1-IgG were investigated by ELISA, SPR, Western blotting, FACS and fluorescence staining analyses. CCK8 and wound healing assays were performed to determine inhibition and migration capacity of ovarian cancer cells after treatment with ROR1IgGin vitro. Further, the antitumor activity of ROR1-IgG was assessed in vivo using tumor-mice xenograft model. Results: The results showed that ROR1-IgG could specifically bind to ROR1-positive cells (HO8910 and A2780) with a high affinity. Functional studies revealed that ROR1-IgG inhibited the malignant behavior of ROR1positive cells (HO8910 and A2780) in a time- and dose-dependent manner. These effects were not observed in ROR1-negative lose386 cells. The tumor inhibition rates following treatment with low, medium, and high concentrations of ROR1-IgG were approximately 47.72%, 53.79%, and 60.51%, respectively. In addition, the expression of Bcl-2 was obviously reduced while that of Bax was distinctly elevated in xenografts. Conclusions: Collectively, our findings suggest that ROR1-IgG may be a novel therapeutic agent for patients with ROR1-positive ovarian cancer.
1. Introduction
antibody-based therapeutic strategy against cancer is well established [9–11] the same is yet to be fully developed in the context of ovarian cancer. Furthermore, understanding the carcinogenic mechanism of ovarian cancer may help identify biomarkers and facilitate development of treatment approaches to enhance the cure and survival rates of these patients. Use of high-affinity cancer prognostic biomarkers can predict the outcomes of different cancer patients. In recent years, ROR1-targeted cancer therapy has emerged as a promising novel therapeutic strategy against cancer [12–15]. Since ROR1 has been reported as an oncogene in different human cancers, its role in ovarian cancer and its application for treatment of this cancer deserves further investigations. Receptor-tyrosine-kinase-like Orphan Receptor 1 (ROR1) is a member of the receptor tyrosine kinase (RTK) family. The structure of
Ovarian cancer is one of the main causes of cancer-related deaths in women [1–4]. Due to asymptomatic characteristics and lack of effective biomarkers at early stage, patients with ovarian cancer are often diagnosed at an advanced stage and have a poor prognosis; short-term recurrence rates have remained stagnant over the last few decades. Platinum, as the first line chemotherapy [5], combined with surgical excision is the mainstay of treatment for patients with ovarian cancer [6]. Although about 90% of patients with ovarian cancer achieve complete clinical remission with this therapy [7], 5-year survival rates of these patients continue to be unsatisfactory owing to development of platinum resistance [8]. Currently, human antibodies are extensively employed for clinical diagnosis and treatment of tumors. Although,
⁎
Corresponding author at: Department of Obstetrics and Gynecology, Women's Hospital of Nanjing Medical University, Nanjing Maternity and Child Health Care Hospital, No.123 Tianfei Lane, Nanjing, Jiangsu, China. E-mail address: [email protected] (H. Zhang). 1 Zhengna Yin and Yuan Mao contributed equally to this work. https://doi.org/10.1016/j.biopha.2019.109420 Received 14 July 2019; Received in revised form 29 August 2019; Accepted 30 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
this transmembrane glycoprotein comprises of an extracellular frizzledlike (FZ) domain, an immunoglobulin-like C2-type domain, a kringle domain, and a protein kinase domain [16]. ROR1 is evolutionarily conserved among various species and regulates embryonic and fetal development; however, it is absent in most mature tissues [17–20]. Although the exact biological functions of ROR1 are not entirely understood, some studies have revealed high expression levels of ROR1 in various human cancers [21–26]; therefore, it may serve as a potential biomarker for cancer therapy [15,27–29]. Studies have shown that ROR1 expression is associated with malignant attributes of lung adenocarcinoma, and may serve as an independent prognostic factor for this cancer [30]. In a previous study, treatment of chronic lymphocytic leukemia (CLL) cells with monoclonal antibodies against ROR1 was shown to induce apoptosis of tumor cells [31,32]. Moreover, recent studies suggest that ROR1 influences tumor cell aggressiveness by regulating gene expression of epithelial-mesenchymal transition (EMT) and leads to poor prognosis in both ovarian and breast cancers [24,33,34]. In our previous study, ROR1 expression in ovarian cancer tissues was significantly higher than that in normal ovarian tissues, and was found to be an independent prognostic factor for ovarian cancer [35]. In the present study, the fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) was constructed and the expression of ROR1 protein in ovarian cancer cells was determined by Western blotting. Further, the binding affinity and specificity of ROR1-IgG for ovarian cancer cell lines was assessed by enzyme-linked immunosorbent assay (ELISA), fluorescence-activated cell sorting (FACS), and fluorescence staining. Subsequently, we evaluated the anticancer effects of ROR1-IgG, both in vitro and in vivo.
Table 1 Primers used for the construction of the ROR1-IgG gene. Primer name DNA sequence Heavy chain variable region forward primer VF1 GCTGCCCAACCAGCCATGGCCCAGGTGCAGCTGGTGCAGTCTGG VF2 GCTGCCCAACCAGCCATGGCCCAGATCACCTTGAAGGAGTCTGG VF3 GCTGCCCAACCAGCCATGGCCGAGGTGCAGCTGGTGSAGTCTGG VF4 GCTGCCCAACCAGCCATGGCCGAGGTGCAGCTGKTGGAGTCTG VF5 GCTGCCCAACCAGCCATGGCCCAGGTGCAGCTGCAGGAGTCGGG VF6 GCTGCCCAACCAGCCATGGCCCAGGTGCAGCTACAGCAGTGGGG Heavy chain variable region reverse primer VR1 CGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTTCC VR2 CGATGGGCCCTTGGTGGAGGCWGRGGAGACGGTGACCAGGGTBCC Light chain variable region forward primer VF1 GGGCCCAGGCGGCCGAGCTCCAGATGACCCAGTCTCC VF2 GGGCCCAGGCGGCCGAGCTCGTGATGACYCAGTCTCC VF3 GGGCCCAGGCGGCCGAGCTCGTGWTGACRCAGTCTCC VF4 GGGCCCAGGCGGCCGAGCTCACACTCACGCAGTCTCC Light chain variable region reverse primer VR1 GAAGACAGATGGTGCAGCCACAGT Heavy chain variable region primer HF TACAGGTGTCCACTCGCTAGAGGTGCAGCTGGTGCAG HR AGGGCCCTTGGTGGATGCGGAGACGGTGACCAGGG Light chain variable region primer LF CTTACAGACGCTCGCTGCGAGCTCGTGATGACCCAGT LR GTGCAGCCACCGTACGTTTTATTTCCAACTTTGTC
cFab in our previous research [36], and amplified with universal primers by PCR (Table 1). Then VL and VH were inserted into the eukaryotic expression plasmids pFUSE-CHIg-hG1 and pFUSE-CLIg-hk, respectively. The recombinant plasmid pFUSE-CHIg-hG1-ROR1H and pFUSE-CLIg-hk-ROR1L containing VH and VL were both transfected into CHO cells which were cultured in OPTI-MEM (GIBCO BRL, Gaithersburg, MD, USA). Transfection parameters were identified as follows: light chain/heavy chain = 1:1, transfection reagent/DNA = 1:1, transfection cells/DNA = 1:2. After cultivating for 48 h, cell culture supernatant was collected and purified using protein A affinity column (GE Healthcare, Piscataway, NJ, USA). The expression of ROR1-IgG was determined using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), following which the gels were stained with Coomassie blue.
2. Materials and methods 2.1. Ethics statement Five-week-old female BALB/c nude mice (weight: 18–20 g each) were acquired from the SLAC Laboratory Animal House (Shanghai, China), and kept under specific pathogen-free conditions. All animal experiments were approved by the Ethics Committee of the Nanjing Medical University (protocol number: SL-007-0). We strictly followed the guiding principles of the animal care and use as set by the Nanjing Medical University. At the end of experiments, the mice were euthanized by CO2 narcosis and none of the animals died before euthanasia.
2.4. Enzyme-linked immunosorbent assay (ELISA) Serial dilutions of ROR1-IgG were seeded in 96-well plates which were pre-coated with 50 ng soluble recombinant ROR1 protein (Sino Biological Inc., Beijing, China) for 1 h. Then, horseradish peroxidase (HRP)-conjugated goat anti-human IgG (Fc specific) (Sigma Chemicals, St. Louis, MO, USA) was added into each well of the 96-well plates. After washing with PBST, the TMB substrate solution was added into the 96-well plates for 10 min at room temperature. 2 M H2SO4 was used to stop the color reaction. The absorbance value was detected at 450 nm by spectrophotometer (Thermo Electron Corporation).
2.2. Cell culture Human ovarian endometroid adenocarcinoma cancer cell line A2780, human ovarian serous cystadenocarcinoma cell line HO8910, and human epithelial ovarian cell line Iose386 were acquired from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). Mouse myeloma cells and chinese hamster ovary cells (CHO cells) were conserved by our laboratory. HO8910 and Iose386 cells were cultured in RPMI-1640 (GIBCO BRL, Gaithersburg, MD, USA), while A2780, mouse myeloma cells and CHO cells were cultured in DMEM (GIBCO BRL, Gaithersburg, MD, USA). All these cell lines were supplemented with 10% FBS (GIBCO BRL), 1% penicillin (100 U/mL) and streptomycin (100 μg/mL) and incubated in a humidified incubator with 5% CO2 at 37 °C.
2.5. Surface plasmon resonance (SPR) analysis Biacore X100 SPR system (GE, Sweden) was used to determine the binding affinity of ROR1-IgG to its antigen, the recombinant ROR1 protein. According to the isoelectric point of the recombinant ROR1 protein, the coupling condition was optimized, sodium acetate was used as the dilution buffer, and 50 mM Gly-HCl (pH = 1.7) was used as the regeneration buffer. The ROR1 protein was diluted to 30 μg/mL and then coupled to the CM5 chip. Further, the system was set at 1,500 RU for coupling level, 180 s for injection time, and 15 min for dissociation time. Finally, ROR1 protein was coupled with serial concentrations of ROR1-IgG to determine the binding affinity of ROR1-IgG.
2.3. Expression and purification of ROR1-IgG antibody FreeStyle 293 Expression Medium, 293 Fectin transfection reagent, and CHOdhfr cell were employed. In our previous study, mouse immunity, cell fusion technologies and sub-clone affinity screening were performed to select positive monoclonal fused cells. Variable regions of heavy chain (VH) and light chain (VL) were originated from the ROR12
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
2.6. Western blotting, fluorescence-activated cell sorting (FACS) and fluorescence staining analyses
2.10. Detection of Bax and Bcl-2 expression The tumor tissues excised from xenografted mice were paraffinembedded at the Department of Pathology, Nanjing Medical University (Jiangsu, China). Then, 4-μm tumor tissue sections were deparaffinized with 100% xylene, and dehydrated in graded ethanol solutions. Endogenous peroxidase activity was blocked by treatment with 3% hydrogen peroxidase in Tris-buffered saline. Further these sections were treated with rabbit anti-ROR1 antibody (Abcam, Cambridge, MA, USA), rabbit anti-Bcl-2 antibody (Sigma Chemicals, St. Louis, MO, USA), and rabbit anti-Bax antibody (Sigma Chemicals, St. Louis, MO, USA), respectively, for 1 h and subsequently incubated with horseradish peroxidase-conjugated anti-rabbit antibody (Sigma Chemicals, St. Louis, MO, USA). Negative controls were treated with PBS instead of primary antibody. Image-Pro Plus system (Media Cybernetics, USA) was employed to calculate the positive area and average optical density. Furthermore, western blotting analysis was employed to investigate the expression of Bax and Bcl-2 in tumors from nude xenograft mice.
Western blotting analysis was performed to detect ROR1 expression in ovarian cancer cell lines. Briefly, total protein was extracted from HO8910, A2780, and Iose386 cell lines and then subjected to SDS-PAGE and transferred to a NC membrane. The membrane was then incubated with a primary anti-ROR1 commercialized antibody (Abcam, 1:100, Cambridge, MA, USA), followed by incubation with the horseradish peroxidase-conjugated secondary antibody. For FACS assay, HO8910, A2780, and Iose386 cell lines were treated with ROR1-IgG (purified antibody) for 2 h. Next these were treated with goat anti-human IgG (Fc specific)-FITC antibody (Abcam) for 1 h in dark at 37 °C. The LSRII flow cytometer (BD Biosciences, San Jose, CA, USA) was used to detect the cell fluorescence intensity. For fluorescence staining analysis, HO8910, A2780, and Iose386 cell lines were cultured in 6-well plates. At 80% confluence, cells were fixed using equal volumes of acetone and methanol and incubated with 50 μg/mL ROR1-IgG followed by incubation with anti-human IgG-FITC antibody in the dark. At the same time, the cells were stained by 4′-6-diamidino-2-phenylindole (DAPI, Biotium, Hayward, CA, USA).
2.11. Statistical analysis Data are presented as mean ± standard deviation. Differences between two single groups were statistically analyzed using Student's ttest. One-way ANOVA with Dunnett's post hoc test was used for statistical comparison of multiple ROR1-IgG groups vs. control treatment group. A P value < 0.05 was deemed as statistically significant.
2.7. Viability assay The CCK8 Kit (Dojindo, Rockville, MD, USA) was used to measure cell viability according to the manufacturer’s protocol. Briefly, 100 μL of cells were seeded into a 96-well cell culture plate in triplicate. After incubation, the cells were treated with serial dilutions of ROR1-IgG for 48 h. The cell viability assay was performed and the percent cell inhibition rate was determined.
3. Results 3.1. Generation of fully chimeric anti-ROR1 IgG (ROR1-IgG) The VL and VH were amplified [length of each amplified chain: approximately 400 bp and then inserted into the eukaryotic expression plasmids pFUSE-CHIg-hG1 and pFUSE-CLIg-hk, respectively. The sequences of VL and VH were illustrated in Fig. 1A. Both inserts were placed in their respective vectors at FspI/BmtI restriction sites without any mutations (Fig. 1B). Thus, the eukaryotic expression vectors carrying anti-ROR1 IgG (pFUSE-CHIg-hG1-ROR1H and pFUSE-CLIg-hkROR1K) were successfully constructed. The recombinant expression vector was transferred to CHO cells and cultured for 48 h. The supernatant of the recombinant CHO cells was collected, purified with protein A affinity column and examined by SDS-PAGE gel with Coomassie brilliant blue staining (Fig. 1C). Due to protein denaturation, the IgG antibodies were observed at about 55 kDa and 27 kDa, respectively. The purification efficiency reached 95% for concentration of ROR1-IgG up to 2.1 mg/mL.
2.8. Wound healing assay Ovarian cancer cell lines HO8910, A2780, and Iose386 were seeded in 24-well plates and grown to 90% confluence. Wound healing assay was performed on serum starved ovarian cancer cell lines as described previously [37]. The monolayer of cells was scratched using a 200 μL pipette tip and the cells were treated with ROR1-IgG for different time intervals (0, 24, and 48 h). The wound closing rate was calculated using Image Pro Plus software using the formula: n h (n hour) migration rate= (the distance from the edge of the 0 h – the distance from the edge of the n h)/ the distance from the edge of the 0 h. 2.9. Establishment of HO8910 xenograft model Five-week-old female BALB/c nude mice (weight: 18–20 g each) were acquired from the SLAC Laboratory Animal House (Shanghai, China) for use in our in vivo experiments. We successfully established HO8910 xenograft models by subcutaneous injection of 0.1 mL solution containing 1 × 107 HO8910 cells into the right chest of the mice. After inoculation, the tumor volume was estimated using the formula: Tumor volume (mm3) = (width) 2 × length/2. When the tumors reached a volume of approximately 80 mm3, the mice were randomly divided into four groups (6 mice per group) and administered different treatments immediately: group I, PBS (negative control); group II, low concentration of ROR1-IgG (2 mg/kg); group III, medium concentration of ROR1IgG (4 mg/kg); and group IV, high concentration of ROR1-IgG (8 mg/ kg). All mice received intravenous treatment on alternate days (a total of 10 injections), and the body weight and tumor size measured on alternate days. Following the last measurement, the mice were euthanized with CO2 narcosis. The tumor tissues were excised, weighed, and measured individually for further analyses. We calculated the inhibition rate of tumor growth using the formula: Inhibition rate (%) = (mean tumor weight in control group – mean tumor weight in experimental group)/ mean tumor weight in control group×100%.
3.2. Confirmation of ROR1-IgG specificity and selectivity ELISA assay was employed to assess the binding ability of ROR1-IgG to human ROR1 protein using gradient concentrations (Fig. 1D). The results showed that ROR1-IgG could specifically bind to ROR1 in a dose-dependent manner. Further, we calculated the affinity constant to evaluate the binding capacity of ROR1-IgG using the following formula: Affinity constant (KD) = dissociation constant (Kd)/binding constant (Ka) [38]. Results obtained from the Biacore X100 SPR analysis showed that the affinity constant of ROR1-IgG was 9.627 × 10−10 (Fig. 1E). These results showed that ROR1-IgG could specifically bind to ROR1 protein. 3.3. Characterization of ROR1-IgG Western blotting analysis was firstly performed to detect ROR1 expression in ovarian cancer cell lines by using a commercial ROR1 antibody. As is shown in Fig. 2A, high ROR1 expression was observed in HO8910 and A2780 cells. Then FCM was performed to detect the 3
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 1. Generation and confirmation of the fully chimeric anti-ROR1 IgG (ROR1-IgG). (A) DNA and amino acid sequences of the variable regions of ROR1-IgG. (B) An agarose gel of the recombinant plasmid pFUSE-CLIg-hk-ROR1K and pFUSE-CHIg-hG1-ROR1H. Lane 1, VL; Lane 2, the plasmid of pFUSE-CLIg-hk; Lane 3, the recombinant plasmid pFUSE-CLIg-hk-ROR1K; Lane 4, VH; Lane 5, the plasmid of pFUSE-CHIg-hG1; Lane 6, the recombinant plasmid pFUSE-CHIg-hG1-ROR1H; M, a DNA marker. (C) Coomassie blue staining. Detection of the purification efficiency of ROR1-IgG. Lane 1, supernatant of untransfected CHO cells, as a negative control; Lane 2, supernatant of CHO cells transfected with recombinant plasmid pFUSE-CLIg-hk-ROR1K and pFUSE-CHIg-hG1-ROR1H after cultivation for 48 h; Lane 3, the flow through the Protein A affinity column; lane 4, ROR1-IgG was purified by the Protein A affinity column; M, a protein marker. (D) ELISA. The recombinant human ROR1 protein was pre-incubated on 96-well plates. ROR1-IgG was used as primary antibody and HRP-conjugated goat anti-human IgG (Fc specific) was used as secondary antibody. Spectrophotometer was employed to detect the absorbance value. (E) Surface plasmon resonance (SPR) analysis. SPR analysis was used to determine the binding affinity of ROR1-IgG. All experiments were repeated at least thrice. Data are presented as mean ± standard deviation (n = 3; NS, not significant; *p < 0.05, **p < 0.01, ***p < 0.001 vs. control). ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
3.4. ROR1-IgG inhibits ovarian cancer cell growth in vitro
binding capacity of ROR1-IgG. Fig. 2B showed that ROR1-IgG could significantly bind to the membrane of HO8910 and A2780 cell lines with positive ROR1 expression, not Iose386 cell line with negative ROR1 expression. Fluorescence staining experiment was further conducted to show that ROR1-IgG stained only ROR1-positive HO8910 and A2780 cells but not Iose386 cell (Fig. 2C). Taken together, these data indicated that HO8910 and A2780 had high expression of ROR1 and ROR1-IgG could effectively bind only to ROR1-positive cells.
CCK8 assay was performed to investigate the role of ROR1-IgG on ovarian cancer cell growth. Results showed that the inhibition efficiency was increased in a concentration-dependent manner in ROR1positive cells, and the difference was statistically significant (approximately 41% at 80 μg/mL in A2780 cells and approximately 35% at 80 μg/mL in HO8910 cells; Fig. 3A). Subsequently, wound healing 4
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 2. Characterization of ROR1-IgG. A. Western blotting analysis showed that high ROR1 expression was witnessed in HO8910 and A2780 cells. B. Flow cytometry. FCM was performed to detect the binding capacity of ROR1-IgG. ROR1-IgG could significantly bind to the membrane of HO8910 and A2780 cell lines with positive ROR1 expression, not Iose386 cell line with negative ROR1 expression. C. Fluorescence staining demonstrated that ROR1-IgG stained only ROR1-positive HO8910 and A2780 cells but not Iose386 cell. All experiments were repeated at least thrice. Data are presented as mean ± standard deviation (*p < 0.05 vs. control). ROR1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
(0.00%, 42.86%, and 66.29%, respectively). Similarly, the A2780 cells showed reduced migration capacity of 0.00%, 8%, and 16.67%, respectively, at 0, 24, and 48 h, as compared to the control A2780 cells (0.00%, 40.7%, and 73.45%, respectively); Iose386 cells showed reduced migration capacity of 0.00%, 30%, and 53.33%, respectively, as
assay was conducted to investigate the effect of ROR1-IgG on ovarian cancer cell lines. Our data suggested that ROR1-IgG blocked tumor cell migration. The migration capacity of in HO8910 cells at 0, 24, and 48 h after treatment with ROR1-IgG was reduced to 0.00%, 16.4%, and 24.34% respectively, as compared to that of control HO8910 cells 5
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 3. ROR1-IgG inhibits ovarian cancer cell growth in vitro. A. Tumor cells were grown and treated with different doses of ROR1-IgG for 48 h and then subjected to CCK8 assay. B. Wound healing assay. Ovarian cancer cells were subjected to ROR1-IgG for up to 48 h. All experiments were repeated at least thrice. Data are presented as mean ± standard deviation (n = 3; NS, not significant; *p < 0.05, **p < 0.01 vs. control). ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
The tumor growth of HO8910 xenograft nude mice models was significantly inhibited by ROR1-IgG in a dose-dependent manner as compared to the control PBS group (p < 0.01). The tumor inhibition rates following different treatments were calculated and were found to be approximately 47.72%, 53.79%, and 60.51% for low, medium, and high concentrations of ROR1-IgG, respectively (Fig. 4F).
compared to the control Iose386 cells (0.00%, 26.67%, and 56.67%, respectively; Fig. 3B). There was no apparent difference between ROR1IgG treated or untreated Iose386 cells in this respect. The results implied that the ROR1-IgG could effectively inhibit tumor cell migration in ROR1 positive cell lines in a time-dependent manner. 3.5. ROR1-IgG inhibits tumor growth in HO8910 xenograft model
3.6. Detection of Bcl-2 and Bax by IHC and western blotting analyses HO8910 xenograft nude mice models were established and ROR1IgG demonstrate significant inhibitory effects of on tumor growth in vivo (Fig. 4A and 4B). The body weights of nude mice were measured to assess the toxicity of ROR1-IgG in vivo. The average post-treatment body weights were 20.4 ± 0.6 g for PBS, 20.3 ± 0.4 g for low concentration of ROR1-IgG (2 mg/kg), 19.8 ± 0.5 g or medium concentration of ROR1-IgG (4 mg/kg), and 19.6 ± 0.4 g for highest concentration of ROR1-IgG (8 mg/kg) (Fig. 4C). The average tumor volumes following different treatments were 1.555 ± 0.174 cm3, 0.856 ± 0.050 cm3, 0.721 ± 0.069 cm3, and 0.656 ± 0.056 cm3 for PBS, low, medium, and high concentrations of ROR1-IgG, respectively (Fig. 4D). Average post-treatment tumor weights were 1.92 ± 0.28 g, 1.00 ± 0.14 g, 0.89 ± 0.12 g, and 0.76 ± 0.11 g, for PBS, low, medium, and high concentrations of ROR1-IgG, respectively (Fig. 4E).
Further, positive expression of ROR1 in HO8910 xenografts was confirmed using IHC (Fig. 5A). H&E staining was used to examine the morphology of tumor tissues. The expressions of Bcl-2 and Bax in HO8910 xenografts were detected using IHC analysis. The results showed that with the increasing dose of ROR1-IgG, the expression of Bcl-2 was reduced, while the expression of Bax was significantly elevated (p < 0.05; Fig. 5B). With increase in the dosage of the ROR1IgG, the level of tumor apoptosis increased, while no tumor apoptosis was observed in the PBS groups. In addition, Western blotting analysis was employed to further prove the expressions of Bcl-2 and Bax in HO8910 xenografts. As shown in Fig. 5C, with the increasing dose of ROR1-IgG, the expression of Bcl-2 was decreased, while the expression of Bax was distinctly increased in nude mice models. 6
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 4. ROR1-IgG inhibits tumor growth in HO8910 xenograft model in vivo. HO8910 xenograft nude mice models were successfully established and randomly divided into four groups. (A) and (B) Tumor-inhibitory effects of ROR1-IgG in xenograft nude mice in vivo. (C) Mean body weight of xenograft nude mice throughout the in vivo experiments. *p < 0.05 vs. control group. (D) Measurement of tumor volume of xenograft tumors. **p < 0.01 vs. control group. (E) Measurement of tumor weight of xenograft tumors. **** p < 0.0001 vs. control group. (F) inhibition rates of different treatment groups. ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
4. Discussion
ARI-1 to suppress the development of Non-Small Cell Lung Cancer [42]. All the above revealed that targeting ROR1 could be a promising strategy for cancer management. In our previous study, we found that ROR1 expression was significantly higher in ovarian cancer tissues, and may serve as an independent prognostic factor for ovarian cancer [35]. Subsequently, we constructed a novel chimeric anti-ROR1 Fab antibody and tested its anti-tumor effectiveness [36]. Compared with Fab antibody fragments [36], fully IgG antibodies exhibit no immunological rejection and higher affinity; these not only retain the characteristics of Fab-specific antigen recognition, but also perform some other biological functions of antibodies, such as immune regulation, activation of complement, and antibody-dependent cellular cytotoxicity (ADCC). Besides, IgG has higher half-life in vivo and shows better stability. It
As a member of the RTK family, ROR1 is believed to have properties of tumor associated antigens (TAAs) and a number of studies reported the relationship between ROR1 expression and human cancers [39]. For now, commercialized ROR1-antibody can only recognize the ROR1 antigen, while can not inhibit or antagonize the ROR1 protein. Recently, Hojjat-Farsangi et al. described KAN0439834 could act as an oral small molecule inhibitor from a library of 110,000 compounds using fresh CLL cells, which can significantly induced apoptosis of CLL cells [40]. Zhang et al. reported a humanized anti-ROR1 monoclonal antibody cirmtuzumab repressed expression of genes associated with breast cancer stemness and reduced activation of Rho-GTPases, HippoYAP/TAZ, or BMI1 [41]. Liu et al. constructed a novel ROR1 inhibitor 7
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 5. Detection of Bcl-2 and Bax by IHC and Western blotting analysis. (A) The expression of ROR1 protein in HO8910 xenografts was determined using IHC. (B) HE staining was employed to assess the pathological changes in tumor tissue specimens. The expression levels of Bcl-2 and Bax in HO8910 xenografts in different treatment groups were determined using IHC. Lane N, PBS; Lane L, low concentration of ROR1-IgG (2 mg/kg); Lane M, medium concentration of ROR1-IgG (4 mg/ kg); Lane H, high concentration of ROR1-IgG (8 mg/kg). (C) The expression level Bcl-2 and Bax in HO8910 xenografts of different treatment groups were determined using Western blotting analysis. Lane N, PBS; Lane L, low concentration of ROR1-IgG (2 mg/kg); Lane M, medium concentration of ROR1-IgG (4 mg/kg); Lane H, high concentration of ROR1-IgG (8 mg/kg). Data are presented as mean ± standard deviation (n = 3; NS, not significant; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control). IHC, immunohistochemistry; ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
8
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
interaction between ROR1 and casein kinase 1 epsilon, which in turn triggered the PI3K/AKT/CREB signaling pathway [22]. In lung adenocarcinomas, the NKX2-1 gene was shown to induce the expression of ROR1, which in turn triggered the phosphorylation of c-SRC and maintained the balance between pro-survival PI3K-AKT signaling and pro-apoptotic p38 signaling. In addition, knockdown of ROR1 was shown to induce apoptosis of lung cancer cells [19,47]. While in this present study the underlying mechanisms responsible for ROR1 action to promote the malignant phenotypes of ovarian cancer are yet to be elucidated. For instance, the mechanism of ROR1-IgG inhibits tumor growth, induces apoptosis and regulates Bcl-2 and Bax proteins. Moreover, there are several other limitations to this study. Firstly, we did not employ isotype IgG as internal control which could strengthen the convincingness and solidity of the data of characteristics of ROR1IgG. Secondly, we only described the phenomenon caused by ROR1-IgG while we did not provide the detailed information of how ROR1-IgG acted on ROR1, for example the ROR1 epitope that ROR1-IgG worked with. Thirdly, we did not perform apoptosis test in xenograft tumor and directly jumped into Bcl-2 and Bax detection. Fourthly, we did not explore the function of ROR1-IgG in blocking kinase signaling as ROR1 is a member of the RTK family. In our future study, we will design the whole experimental protocol more elaborately and ameliorate the experimental details more thoroughly. In conclusion, we successfully constructed a new chimeric antiROR1 IgG antibody (ROR1-IgG), which demonstrated a high affinity and selectivity for binding to ROR1 protein. Moreover, ROR1-IgG showed its ability to inhibit ovarian cancer growth both in vitro and in vivo. These results suggest that ligation of ROR1 with ROR1-IgG may be a potent therapeutic strategy for ROR1-positive ovarian cancer.
has greater application value for subsequent drug development [43]. Therefore, it is rational to presume IgG antibody could demonstrate great advantage compared to Fab antibody and we constructed this fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) in this present study. The expression and purification of ROR1-IgG was verified and evaluated by Coomassie blue staining. Then, ELISA and affinity analysis were employed to confirm the specificity and selectivity of the binding of ROR1-IgG to the recombinant human ROR1 protein. FACS and fluorescence staining assays were performed by using ROR1-IgG as primary antibody to detect the expression level of ROR1 protein in the ovarian cancer cells. The above results illustrated that ROR1-IgG possessed a high specificity and affinity for ROR1 protein. A latest study also reported that protein H bound IgG solely through Fc, but not Fab to affinity to enhance affinity and virulence [44]. Actually, the spatial structure between IgG full-length antibody and Fab antibody fragments was different. In our previous research, a novel human monoclonal Trop2-IgG antibody also demonstrated improved affinity compared with the previous Trop2-Fab antibody [37,45]. Furthermore, the antitumor activity of ROR1-IgG was assessed in ovarian cancer cells-ROR1-positive cell lines and ROR1-negative cell lines. CCK8 assay results showed that the inhibition efficiency of ovarian cancer cell growth was increased in a concentration-dependent manner in ROR1-positive cells, and the difference was statistically significant. Wound healing results revealed that the cell migration rate of ROR1-positive ovarian cancer was significantly inhibited after treatment with ROR1-IgG for 24 or 48 h. However, there was no significant difference between ROR1-IgG -treated and untreated Iose386 cells in this respect. These findings illustrated that ROR1-IgG could selectively and specifically inhibit malignant behavior of ROR1-positive cells. There are considerable differences between the environment inside the body and the external environment. In addition, our in vitro results showed that the inhibitory effect on the growth and migration of A2780 cells was greater than that of HO8910 cells. A2780 was originally collected from endometrioid type while HO8910 was originally acquired from serous type. As the incidence and mortality of serous type of ovarian cancer was significantly higher than other types of ovarian cancer, including endometrioid type, clear cell type and mucinous type, we reckon that serous type of ovarian cancer was more representative [3]. Therefore, we constructed HO8910 cell line to construct xenograft nude mice to further explore whether antibodies can inhibit the malignant behavior of ovarian cancer in vivo. In our previous research, we also followed the similar protocol and enrolled HO8910 cell line to perform in vivo experiment [37]. The tumor inhibition rates following different treatments were observed to be approximately 47.72%, 53.79%, and 60.51% for low, medium, and high concentrations of ROR1-IgG, which indicates a dose-dependent response. Significant inhibitory effect on tumors was found in xenograft nude mice, which may be related to the role of ADCC. In vivo, ROR1-IgG may form a bridge between HO8910 cells and NK cells by binding to the NK cells with its Fc region, and to the HO8910 cells with its Fab region. This is liable to enhance the function of NK cells. This phenomenon is referred to as antibody-dependent cellular cytotoxicity (ADCC). Additional research should be performed to exploit its biological function and to clarify the underlying mechanisms. There are two types of proteins in the Bcl-2 family, i.e., pro-apoptotic proteins (such as Bax, Bak and Bim) and anti-apoptotic proteins (such as Bcl-2, Bcl-xl and Mcl-1) [46], which is crucial checkpoint in apoptosis. IHC and Western blotting analysis were employed to assess the expression levels of Bcl-2 and Bax following different treatments. Our results showed that increasing doses of ROR1-IgG reduced the expression of Bcl-2, while the expression of Bax was significantly elevated. These findings suggest that ROR1-IgG could inhibit tumor growth and promote apoptosis. There are some pertinent questions that require answers. In breast cancer studies, combining Wnt5a with ROR1 was shown to enhance the
Authors' contributions HZ, HT and ZY conceived and designed the study. ZY, YM and NZ performed the experiments. ZY, YM, JZ and YS analyzed the data. ZY drafted the manuscript. HZ and YM reviewed and revised the manuscript. All authors read and approved the final manuscript. Ethics approval and consent to participate All animal experiments were approved by the Ethics Committee of the Nanjing Medical University. We strictly followed the guiding principles of the animal care and use as set by the Nanjing Medical University. At the end of experiments, the mice were euthanized by CO2 narcosis and none of the animals died before euthanasia. Declaration of Competing Interest None. Acknowledgements This study is supported by the grants from the Nanjing Scientific and Technological Development Program (201503049), the Nanjing Medical Science and Technique Development Fund (ZKX13045), the Jiangsu Provincial Medical Youth Talent (QNRC2016104, QNRC2016535) and the Natural Science Foundation of Jiangsu Province (BK20181489). References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global Cancer Statistics, 2012, (2015). [2] A. Chao, C.L. Tsai, S.M. Jung, W.C. Chuang, C. Kao, A. Hsu, S.H. Chen, C.Y. Lin, Y.C. Lee, Y.S. Lee, T.H. Wang, H.S. Wang, C.H. Lai, BAI1-associated protein 2-Like 1 (BAIAP2L1) is a potential biomarker in ovarian cancer, PLoS One 10 (7) (2015) e133081. [3] L.A. Torre, B. Trabert, C.E. DeSantis, K.D. Miller, G. Samimi, C.D. Runowicz,
9
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
[4] [5]
[6] [7] [8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16] [17]
[18] [19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27] A.H. Daneshmanesh, E. Mikaelsson, M. Jeddi-Tehrani, A.A. Bayat, R. Ghods, M. Ostadkarampour, M. Akhondi, S. Lagercrantz, C. Larsson, A. Osterborg, F. Shokri, H. Mellstedt, H. Rabbani, Ror1, a cell surface receptor tyrosine kinase is expressed in chronic lymphocytic leukemia and may serve as a putative target for therapy, Int. J. Cancer 123 (5) (2008) 1190–1195. [28] G. Rebagay, S. Yan, C. Liu, N.K. Cheung, ROR1 and ROR2 in human malignancies: potentials for targeted therapy, Front. Oncol. 2 (2012) 34. [29] M. Hojjat-Farsangi, F. Ghaemimanesh, A.H. Daneshmanesh, A.A. Bayat, J. Mahmoudian, M. Jeddi-Tehrani, H. Rabbani, H. Mellstedt, Inhibition of the receptor tyrosine kinase ROR1 by anti-ROR1 monoclonal antibodies and siRNA induced apoptosis of melanoma cells, PLoS One 8 (4) (2013) e61167. [30] Y.Z. Zheng, R. Ma, J.K. Zhou, C.L. Guo, Y.S. Wang, Z.G. Li, L.X. Liu, Y. Peng, ROR1 is a novel prognostic biomarker in patients with lung adenocarcinoma, Sci. Rep. 6 (2016) 36447. [31] A.H. Daneshmanesh, M. Hojjat-Farsangi, A.S. Khan, M. Jeddi-Tehrani, M.M. Akhondi, A.A. Bayat, R. Ghods, A.R. Mahmoudi, R. Hadavi, A. Osterborg, F. Shokri, H. Rabbani, H. Mellstedt, Monoclonal antibodies against ROR1 induce apoptosis of chronic lymphocytic leukemia (CLL) cells, Leukemia 26 (6) (2012) 1348–1355. [32] M.K. Hasan, L. Rassenti, G.N. Widhopf, J. Yu, T.J. Kipps, Wnt5a causes ROR1 to complex and activate cortactin to enhance migration of chronic lymphocytic leukemia cells, Leukemia (2018). [33] S. Zhang, H. Zhang, E.M. Ghia, J. Huang, L. Wu, J. Zhang, S. Lam, Y. Lei, J. He, B. Cui, G.N. Widhopf, J. Yu, R. Schwab, K. Messer, W. Jiang, B.A. Parker, Inhibition of chemotherapy resistant breast cancer stem cells by a ROR1 specific antibody, Proc. Natl. Acad. Sci. U. S. A. (2019). [34] H. Tan, Q. He, G. Gong, Y. Wang, J. Li, J. Wang, D. Zhu, X. Wu, miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer, Int. J. Oncol. 48 (1) (2016) 181–190. [35] H. Zhang, J. Qiu, C. Ye, D. Yang, L. Gao, Y. Su, X. Tang, N. Xu, D. Zhang, L. Xiong, Y. Mao, F. Li, J. Zhu, ROR1 expression correlated with poor clinical outcome in human ovarian cancer, Sci. Rep. 4 (2014) 5811. [36] Z. Yin, M. Gao, S. Chu, Y. Su, C. Ye, Y. Wang, Z. Pan, Z. Wang, H. Zhang, H. Tong, J. Zhu, Antitumor activity of a newly developed monoclonal antibody against ROR1 in ovarian cancer cells, Oncotarget 8 (55) (2017) 94210–94222. [37] J. Liu, D. Yang, Z. Yin, M. Gao, H. Tong, Y. Su, J. Zhu, C. Ye, H. Zhang, A novel human monoclonal Trop2-IgG antibody inhibits ovarian cancer growth in vitro and in vivo, Biochem. Biophys. Res. Commun. 512 (2) (2019) 276–282. [38] H. Hirai, E. Ogata, N. Kikuchi, T. Kohno, N. Machii, K. Hasegawa, T. Watanabe, H. Satoh, The effects of liraglutide on both hypereosinophilic insulin allergy and the characteristics of anti-insulin antibodies in type 2 diabetes mellitus: a case report, J. Med. Case Rep. 10 (2016) 202. [39] Y. Mao, L. Xu, J. Wang, L. Zhang, N. Hou, J. Xu, L. Wang, S. Yang, Y. Chen, L. Xiong, J. Zhu, W. Fan, J. Xu, ROR1 associates unfavorable prognosis and promotes lymphoma growth in DLBCL by affecting PI3K/Akt/mTOR signaling pathway, Biofactors 45 (3) (2019) 416–426. [40] M. Hojjat-Farsangi, A.H. Daneshmanesh, A.S. Khan, J. Shetye, F. Mozaffari, P. Kharaziha, L.S. Rathje, P. Kokhaei, L. Hansson, J. Vagberg, S. Bystrom, E. Olsson, C. Lofberg, C. Norstrom, J. Schultz, M. Norin, First-in-class oral small molecule inhibitor of the tyrosine kinase ROR1 (KAN0439834) induced significant apoptosis of chronic lymphocytic leukemia cells, Leukemia 32 (10) (2018) 2291–2295. [41] S. Zhang, H. Zhang, E.M. Ghia, J. Huang, L. Wu, J. Zhang, S. Lam, Y. Lei, J. He, B. Cui, G.N. Widhopf, J. Yu, R. Schwab, K. Messer, W. Jiang, B.A. Parker, Inhibition of chemotherapy resistant breast cancer stem cells by a ROR1 specific antibody, Proc. Natl. Acad. Sci. U. S. A. 116 (4) (2019) 1370–1377. [42] X. Liu, W. Pu, H. He, X. Fan, Y. Zheng, J.K. Zhou, R. Ma, J. He, Y. Zheng, K. Wu, Y. Zhao, S.Y. Yang, C. Wang, Y.Q. Wei, X.W. Wei, Y. Peng, Novel ROR1 inhibitor ARI-1 suppresses the development of non-small cell lung cancer, Cancer Lett. (2019). [43] G. Winter, A.D. Griffiths, R.E. Hawkins, H.R. Hoogenboom, Making antibodies by phage display technology, Annu. Rev. Immunol. 12 (1994) 433–455. [44] D. Ermert, M. Laabei, A. Weckel, M. Morgelin, M. Lundqvist, L. Bjorck, S. Ram, S. Linse, A.M. Blom, The molecular basis of human IgG-Mediated enhancement of C4b-Binding protein recruitment to group a Streptococcus, Front. Immunol. 10 (2019) 1230. [45] H. Lin, H. Zhang, J. Wang, M. Lu, F. Zheng, C. Wang, X. Tang, N. Xu, R. Chen, D. Zhang, P. Zhao, J. Zhu, Y. Mao, Z. Feng, A novel human Fab antibody for Trop2 inhibits breast cancer growth in vitro and in vivo, Int. J. Cancer 134 (5) (2014) 1239–1249. [46] F. Faiao-Flores, P.R. Coelho, A.J. Toledo, S.S. Maria-Engler, M. Tiago, V.L. Capelozzi, R.R. Giorgi, D.A. Maria, Apoptosis through Bcl-2/Bax and cleaved caspase up-regulation in melanoma treated by boron neutron capture therapy, PLoS One 8 (3) (2013) e59639. [47] Y. Liu, H. Yang, T. Chen, Y. Luo, Z. Xu, Y. Li, J. Yang, Silencing of receptor tyrosine kinase ROR1 inhibits tumor-cell proliferation via PI3K/AKT/mTOR signaling pathway in lung adenocarcinoma, PLoS One 10 (5) (2015) e127092.
M.M. Gaudet, A. Jemal, R.L. Siegel, Ovarian cancer statistics, 2018, CA Cancer J. Clin. 68 (4) (2018) 284–296. Y. Yoshida, C.L. Schmaltz, J. Jackson-Thompson, E.J. Simoes, Ovarian Cancer survival in Missouri, 1996-2014, Mol. Med. 115 (6) (2018) 542–547. Z. Zhang, Z. Xie, G. Sun, P. Yang, J. Li, H. Yang, S. Xiao, Y. Liu, H. Qiu, L. Qin, C. Zhang, F. Zhang, B. Shan, Reversing drug resistance of cisplatin by hsp90 inhibitors in human ovarian cancer cells, Int. J. Clin. Exp. Med. 8 (5) (2015) 6687–6701. E. Dean, L. El-Helw, J. Hasan, Targeted therapies in epithelial ovarian cancer, Cancers (Basel) 2 (1) (2010) 88–113. R.J. Bast, B. Hennessy, G.B. Mills, The biology of ovarian cancer: new opportunities for translation, Nat. Rev. Cancer 9 (6) (2009) 415–428. R.E. Meyn, L.C. Stephens, N.R. Hunter, L. Milas, Kinetics of cisplatin-induced apoptosis in murine mammary and ovarian adenocarcinomas, Int. J. Cancer 60 (5) (1995) 725–729. R. Chen, D. Zhang, Y. Mao, J. Zhu, H. Ming, J. Wen, J. Ma, Q. Cao, H. Lin, Q. Tang, J. Liang, Z. Feng, A human Fab-based immunoconjugate specific for the LMP1 extracellular domain inhibits nasopharyngeal carcinoma growth in vitro and in vivo, Mol. Cancer Ther. 11 (3) (2012) 594–603. D.A. Yardley, L. Hart, L. Bosserman, M.N. Salleh, D.M. Waterhouse, M.K. Hagan, P. Richards, M.L. DeSilvio, J.M. Mahoney, Y. Nagarwala, Phase II study evaluating lapatinib in combination with nab-paclitaxel in HER2-overexpressing metastatic breast cancer patients who have received no more than one prior chemotherapeutic regimen, Breast Cancer Res. Treat. 137 (2) (2013) 457–464. A.M. Jubb, K.D. Miller, H.S. Rugo, A.L. Harris, D. Chen, J.D. Reimann, M.A. Cobleigh, M. Schmidt, V.K. Langmuir, K.J. Hillan, D.S. Chen, H. Koeppen, Impact of exploratory biomarkers on the treatment effect of bevacizumab in metastatic breast cancer, Clin. Cancer Res. 17 (2) (2011) 372–381. C.H. Chang, P. Gupta, R. Michel, M. Loo, Y. Wang, T.M. Cardillo, D.M. Goldenberg, Ranpirnase (frog RNase) targeted with a humanized, internalizing, anti-Trop-2 antibody has potent cytotoxicity against diverse epithelial cancer cells, Mol. Cancer Ther. 9 (8) (2010) 2276–2286. J. Yu, L. Che, B. Cui, G.N. Widhopf, Z. Shen, R. Wu, L. Zhang, S. Zhang, S.P. Briggs, T.J. Kipps, Wnt5a induces ROR1/ROR2 heterooligomerization to enhance leukemia chemotaxis and proliferation, J. Clin. Invest. 126 (2) (2016) 585–598. S.H. Gohil, S.R. Paredes-Moscosso, M. Harrasser, M. Vezzalini, A. Scarpa, E. Morris, A.M. Davidoff, C. Sorio, A.C. Nathwani, P.M. Della, An ROR1 bi-specific T-cell engager provides effective targeting and cytotoxicity against a range of solid tumors, Oncoimmunology 6 (7) (2017) e1326437. J. Heliste, A. Jokilammi, I. Paatero, D. Chakroborty, C. Stark, T. Savunen, M. Laaksonen, K. Elenius, Receptor tyrosine kinase profiling of ischemic heart identifies ROR1 as a potential therapeutic target, BMC Cardiovasc. Disord. 18 (1) (2018) 196. J.L. Green, S.G. Kuntz, P.W. Sternberg, Ror receptor tyrosine kinases: orphans no more, Trends Cell Biol. 18 (11) (2008) 536–544. M. Endo, R. Doi, M. Nishita, Y. Minami, Ror family receptor tyrosine kinases regulate the maintenance of neural progenitor cells in the developing neocortex, J. Cell. Sci. 125 (Pt 8) (2012) 2017–2029. S. Paganoni, A. Ferreira, Neurite extension in central neurons: a novel role for the receptor tyrosine kinases Ror1 and Ror2, J. Cell. Sci. 118 (Pt 2) (2005) 433–446. T. Yamaguchi, K. Yanagisawa, R. Sugiyama, Y. Hosono, Y. Shimada, C. Arima, S. Kato, S. Tomida, M. Suzuki, H. Osada, T. Takahashi, NKX2-1/TITF1/TTF-1Induced ROR1 is required to sustain EGFR survival signaling in lung adenocarcinoma, Cancer Cell 21 (3) (2012) 348–361. M. Hojjat-Farsangi, A. Moshfegh, A.H. Daneshmanesh, A.S. Khan, E. Mikaelsson, A. Osterborg, H. Mellstedt, The receptor tyrosine kinase ROR1–an oncofetal antigen for targeted cancer therapy, Semin. Cancer Biol. 29 (2014) 21–31. A.H. Daneshmanesh, A. Porwit, M. Hojjat-Farsangi, M. Jeddi-Tehrani, K.P. Tamm, D. Grander, S. Lehmann, S. Norin, F. Shokri, H. Rabbani, H. Mellstedt, A. Osterborg, Orphan receptor tyrosine kinases ROR1 and ROR2 in hematological malignancies, Leuk. Lymphoma 54 (4) (2013) 843–850. S. Zhang, L. Chen, B. Cui, H.Y. Chuang, J. Yu, J. Wang-Rodriguez, L. Tang, G. Chen, G.W. Basak, T.J. Kipps, ROR1 is expressed in human breast cancer and associated with enhanced tumor-cell growth, PLoS One 7 (3) (2012) e31127. S. Zhang, L. Chen, J. Wang-Rodriguez, L. Zhang, B. Cui, W. Frankel, R. Wu, T.J. Kipps, The onco-embryonic antigen ROR1 is expressed by a variety of human cancers, Am. J. Pathol. 181 (6) (2012) 1903–1910. B. Cui, S. Zhang, L. Chen, J. Yu, G.N. Widhopf, J.F. Fecteau, L.Z. Rassenti, T.J. Kipps, Targeting ROR1 inhibits epithelial-mesenchymal transition and metastasis, Cancer Res. 73 (12) (2013) 3649–3660. A. Gentile, L. Lazzari, S. Benvenuti, L. Trusolino, P.M. Comoglio, Ror1 is a pseudokinase that is crucial for Met-driven tumorigenesis, Cancer Res. 71 (8) (2011) 3132–3141. G.L. Xu, J. Shen, Y.H. Xu, W.S. Wang, C.F. Ni, ROR1 is highly expressed in circulating tumor cells and promotes invasion of pancreatic cancer, Mol. Med. Rep. 18 (6) (2018) 5087–5094.
10
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
A fully chimeric IgG antibody for ROR1 suppresses ovarian cancer growth in vitro and in vivo Zhengna Yina,b,1, Yuan Maoc,1, Ningzhi Zhanga, Yiping Sub, Jin Zhud, Hua Tongb, Huilin Zhangb,
T
⁎
a
Department of Obstetrics and Gynecology, Fuyang People's Hospital, Fuyang, 236000, China Department of Obstetrics and Gynecology, Women's Hospital of Nanjing Medical University, Nanjing Maternity and Child Health Care Hospital, Nanjing, 210004, China c Department of Hematology and Oncology, Geriatric Hospital of Nanjing Medical University, Jiangsu Province Geriatric Hospital, Nanjing, 210000, China d Huadong Medical Institute of Biotechniques, Nanjing, 210002, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: ROR1 Monoclonal antibody Ovarian cancer Immunotherapy
Background: Over-expression of Receptor-tyrosine-kinase-like Orphan Receptor 1 (ROR1) in cancer cells has been reported in the context of several tumors (including ovarian cancer) and is associated with poor prognosis. The aim of this study was to construct a fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) and investigate its antitumor activity against ovarian cancer cells, bothin vitro and in vivo. Methods: A fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) eukaryotic expression vector was constructed and ROR1-IgG antibody was expressed in CHO cells. The characteristics of ROR1-IgG were investigated by ELISA, SPR, Western blotting, FACS and fluorescence staining analyses. CCK8 and wound healing assays were performed to determine inhibition and migration capacity of ovarian cancer cells after treatment with ROR1IgGin vitro. Further, the antitumor activity of ROR1-IgG was assessed in vivo using tumor-mice xenograft model. Results: The results showed that ROR1-IgG could specifically bind to ROR1-positive cells (HO8910 and A2780) with a high affinity. Functional studies revealed that ROR1-IgG inhibited the malignant behavior of ROR1positive cells (HO8910 and A2780) in a time- and dose-dependent manner. These effects were not observed in ROR1-negative lose386 cells. The tumor inhibition rates following treatment with low, medium, and high concentrations of ROR1-IgG were approximately 47.72%, 53.79%, and 60.51%, respectively. In addition, the expression of Bcl-2 was obviously reduced while that of Bax was distinctly elevated in xenografts. Conclusions: Collectively, our findings suggest that ROR1-IgG may be a novel therapeutic agent for patients with ROR1-positive ovarian cancer.
1. Introduction
antibody-based therapeutic strategy against cancer is well established [9–11] the same is yet to be fully developed in the context of ovarian cancer. Furthermore, understanding the carcinogenic mechanism of ovarian cancer may help identify biomarkers and facilitate development of treatment approaches to enhance the cure and survival rates of these patients. Use of high-affinity cancer prognostic biomarkers can predict the outcomes of different cancer patients. In recent years, ROR1-targeted cancer therapy has emerged as a promising novel therapeutic strategy against cancer [12–15]. Since ROR1 has been reported as an oncogene in different human cancers, its role in ovarian cancer and its application for treatment of this cancer deserves further investigations. Receptor-tyrosine-kinase-like Orphan Receptor 1 (ROR1) is a member of the receptor tyrosine kinase (RTK) family. The structure of
Ovarian cancer is one of the main causes of cancer-related deaths in women [1–4]. Due to asymptomatic characteristics and lack of effective biomarkers at early stage, patients with ovarian cancer are often diagnosed at an advanced stage and have a poor prognosis; short-term recurrence rates have remained stagnant over the last few decades. Platinum, as the first line chemotherapy [5], combined with surgical excision is the mainstay of treatment for patients with ovarian cancer [6]. Although about 90% of patients with ovarian cancer achieve complete clinical remission with this therapy [7], 5-year survival rates of these patients continue to be unsatisfactory owing to development of platinum resistance [8]. Currently, human antibodies are extensively employed for clinical diagnosis and treatment of tumors. Although,
⁎
Corresponding author at: Department of Obstetrics and Gynecology, Women's Hospital of Nanjing Medical University, Nanjing Maternity and Child Health Care Hospital, No.123 Tianfei Lane, Nanjing, Jiangsu, China. E-mail address: [email protected] (H. Zhang). 1 Zhengna Yin and Yuan Mao contributed equally to this work. https://doi.org/10.1016/j.biopha.2019.109420 Received 14 July 2019; Received in revised form 29 August 2019; Accepted 30 August 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
this transmembrane glycoprotein comprises of an extracellular frizzledlike (FZ) domain, an immunoglobulin-like C2-type domain, a kringle domain, and a protein kinase domain [16]. ROR1 is evolutionarily conserved among various species and regulates embryonic and fetal development; however, it is absent in most mature tissues [17–20]. Although the exact biological functions of ROR1 are not entirely understood, some studies have revealed high expression levels of ROR1 in various human cancers [21–26]; therefore, it may serve as a potential biomarker for cancer therapy [15,27–29]. Studies have shown that ROR1 expression is associated with malignant attributes of lung adenocarcinoma, and may serve as an independent prognostic factor for this cancer [30]. In a previous study, treatment of chronic lymphocytic leukemia (CLL) cells with monoclonal antibodies against ROR1 was shown to induce apoptosis of tumor cells [31,32]. Moreover, recent studies suggest that ROR1 influences tumor cell aggressiveness by regulating gene expression of epithelial-mesenchymal transition (EMT) and leads to poor prognosis in both ovarian and breast cancers [24,33,34]. In our previous study, ROR1 expression in ovarian cancer tissues was significantly higher than that in normal ovarian tissues, and was found to be an independent prognostic factor for ovarian cancer [35]. In the present study, the fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) was constructed and the expression of ROR1 protein in ovarian cancer cells was determined by Western blotting. Further, the binding affinity and specificity of ROR1-IgG for ovarian cancer cell lines was assessed by enzyme-linked immunosorbent assay (ELISA), fluorescence-activated cell sorting (FACS), and fluorescence staining. Subsequently, we evaluated the anticancer effects of ROR1-IgG, both in vitro and in vivo.
Table 1 Primers used for the construction of the ROR1-IgG gene. Primer name DNA sequence Heavy chain variable region forward primer VF1 GCTGCCCAACCAGCCATGGCCCAGGTGCAGCTGGTGCAGTCTGG VF2 GCTGCCCAACCAGCCATGGCCCAGATCACCTTGAAGGAGTCTGG VF3 GCTGCCCAACCAGCCATGGCCGAGGTGCAGCTGGTGSAGTCTGG VF4 GCTGCCCAACCAGCCATGGCCGAGGTGCAGCTGKTGGAGTCTG VF5 GCTGCCCAACCAGCCATGGCCCAGGTGCAGCTGCAGGAGTCGGG VF6 GCTGCCCAACCAGCCATGGCCCAGGTGCAGCTACAGCAGTGGGG Heavy chain variable region reverse primer VR1 CGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTTCC VR2 CGATGGGCCCTTGGTGGAGGCWGRGGAGACGGTGACCAGGGTBCC Light chain variable region forward primer VF1 GGGCCCAGGCGGCCGAGCTCCAGATGACCCAGTCTCC VF2 GGGCCCAGGCGGCCGAGCTCGTGATGACYCAGTCTCC VF3 GGGCCCAGGCGGCCGAGCTCGTGWTGACRCAGTCTCC VF4 GGGCCCAGGCGGCCGAGCTCACACTCACGCAGTCTCC Light chain variable region reverse primer VR1 GAAGACAGATGGTGCAGCCACAGT Heavy chain variable region primer HF TACAGGTGTCCACTCGCTAGAGGTGCAGCTGGTGCAG HR AGGGCCCTTGGTGGATGCGGAGACGGTGACCAGGG Light chain variable region primer LF CTTACAGACGCTCGCTGCGAGCTCGTGATGACCCAGT LR GTGCAGCCACCGTACGTTTTATTTCCAACTTTGTC
cFab in our previous research [36], and amplified with universal primers by PCR (Table 1). Then VL and VH were inserted into the eukaryotic expression plasmids pFUSE-CHIg-hG1 and pFUSE-CLIg-hk, respectively. The recombinant plasmid pFUSE-CHIg-hG1-ROR1H and pFUSE-CLIg-hk-ROR1L containing VH and VL were both transfected into CHO cells which were cultured in OPTI-MEM (GIBCO BRL, Gaithersburg, MD, USA). Transfection parameters were identified as follows: light chain/heavy chain = 1:1, transfection reagent/DNA = 1:1, transfection cells/DNA = 1:2. After cultivating for 48 h, cell culture supernatant was collected and purified using protein A affinity column (GE Healthcare, Piscataway, NJ, USA). The expression of ROR1-IgG was determined using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), following which the gels were stained with Coomassie blue.
2. Materials and methods 2.1. Ethics statement Five-week-old female BALB/c nude mice (weight: 18–20 g each) were acquired from the SLAC Laboratory Animal House (Shanghai, China), and kept under specific pathogen-free conditions. All animal experiments were approved by the Ethics Committee of the Nanjing Medical University (protocol number: SL-007-0). We strictly followed the guiding principles of the animal care and use as set by the Nanjing Medical University. At the end of experiments, the mice were euthanized by CO2 narcosis and none of the animals died before euthanasia.
2.4. Enzyme-linked immunosorbent assay (ELISA) Serial dilutions of ROR1-IgG were seeded in 96-well plates which were pre-coated with 50 ng soluble recombinant ROR1 protein (Sino Biological Inc., Beijing, China) for 1 h. Then, horseradish peroxidase (HRP)-conjugated goat anti-human IgG (Fc specific) (Sigma Chemicals, St. Louis, MO, USA) was added into each well of the 96-well plates. After washing with PBST, the TMB substrate solution was added into the 96-well plates for 10 min at room temperature. 2 M H2SO4 was used to stop the color reaction. The absorbance value was detected at 450 nm by spectrophotometer (Thermo Electron Corporation).
2.2. Cell culture Human ovarian endometroid adenocarcinoma cancer cell line A2780, human ovarian serous cystadenocarcinoma cell line HO8910, and human epithelial ovarian cell line Iose386 were acquired from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). Mouse myeloma cells and chinese hamster ovary cells (CHO cells) were conserved by our laboratory. HO8910 and Iose386 cells were cultured in RPMI-1640 (GIBCO BRL, Gaithersburg, MD, USA), while A2780, mouse myeloma cells and CHO cells were cultured in DMEM (GIBCO BRL, Gaithersburg, MD, USA). All these cell lines were supplemented with 10% FBS (GIBCO BRL), 1% penicillin (100 U/mL) and streptomycin (100 μg/mL) and incubated in a humidified incubator with 5% CO2 at 37 °C.
2.5. Surface plasmon resonance (SPR) analysis Biacore X100 SPR system (GE, Sweden) was used to determine the binding affinity of ROR1-IgG to its antigen, the recombinant ROR1 protein. According to the isoelectric point of the recombinant ROR1 protein, the coupling condition was optimized, sodium acetate was used as the dilution buffer, and 50 mM Gly-HCl (pH = 1.7) was used as the regeneration buffer. The ROR1 protein was diluted to 30 μg/mL and then coupled to the CM5 chip. Further, the system was set at 1,500 RU for coupling level, 180 s for injection time, and 15 min for dissociation time. Finally, ROR1 protein was coupled with serial concentrations of ROR1-IgG to determine the binding affinity of ROR1-IgG.
2.3. Expression and purification of ROR1-IgG antibody FreeStyle 293 Expression Medium, 293 Fectin transfection reagent, and CHOdhfr cell were employed. In our previous study, mouse immunity, cell fusion technologies and sub-clone affinity screening were performed to select positive monoclonal fused cells. Variable regions of heavy chain (VH) and light chain (VL) were originated from the ROR12
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
2.6. Western blotting, fluorescence-activated cell sorting (FACS) and fluorescence staining analyses
2.10. Detection of Bax and Bcl-2 expression The tumor tissues excised from xenografted mice were paraffinembedded at the Department of Pathology, Nanjing Medical University (Jiangsu, China). Then, 4-μm tumor tissue sections were deparaffinized with 100% xylene, and dehydrated in graded ethanol solutions. Endogenous peroxidase activity was blocked by treatment with 3% hydrogen peroxidase in Tris-buffered saline. Further these sections were treated with rabbit anti-ROR1 antibody (Abcam, Cambridge, MA, USA), rabbit anti-Bcl-2 antibody (Sigma Chemicals, St. Louis, MO, USA), and rabbit anti-Bax antibody (Sigma Chemicals, St. Louis, MO, USA), respectively, for 1 h and subsequently incubated with horseradish peroxidase-conjugated anti-rabbit antibody (Sigma Chemicals, St. Louis, MO, USA). Negative controls were treated with PBS instead of primary antibody. Image-Pro Plus system (Media Cybernetics, USA) was employed to calculate the positive area and average optical density. Furthermore, western blotting analysis was employed to investigate the expression of Bax and Bcl-2 in tumors from nude xenograft mice.
Western blotting analysis was performed to detect ROR1 expression in ovarian cancer cell lines. Briefly, total protein was extracted from HO8910, A2780, and Iose386 cell lines and then subjected to SDS-PAGE and transferred to a NC membrane. The membrane was then incubated with a primary anti-ROR1 commercialized antibody (Abcam, 1:100, Cambridge, MA, USA), followed by incubation with the horseradish peroxidase-conjugated secondary antibody. For FACS assay, HO8910, A2780, and Iose386 cell lines were treated with ROR1-IgG (purified antibody) for 2 h. Next these were treated with goat anti-human IgG (Fc specific)-FITC antibody (Abcam) for 1 h in dark at 37 °C. The LSRII flow cytometer (BD Biosciences, San Jose, CA, USA) was used to detect the cell fluorescence intensity. For fluorescence staining analysis, HO8910, A2780, and Iose386 cell lines were cultured in 6-well plates. At 80% confluence, cells were fixed using equal volumes of acetone and methanol and incubated with 50 μg/mL ROR1-IgG followed by incubation with anti-human IgG-FITC antibody in the dark. At the same time, the cells were stained by 4′-6-diamidino-2-phenylindole (DAPI, Biotium, Hayward, CA, USA).
2.11. Statistical analysis Data are presented as mean ± standard deviation. Differences between two single groups were statistically analyzed using Student's ttest. One-way ANOVA with Dunnett's post hoc test was used for statistical comparison of multiple ROR1-IgG groups vs. control treatment group. A P value < 0.05 was deemed as statistically significant.
2.7. Viability assay The CCK8 Kit (Dojindo, Rockville, MD, USA) was used to measure cell viability according to the manufacturer’s protocol. Briefly, 100 μL of cells were seeded into a 96-well cell culture plate in triplicate. After incubation, the cells were treated with serial dilutions of ROR1-IgG for 48 h. The cell viability assay was performed and the percent cell inhibition rate was determined.
3. Results 3.1. Generation of fully chimeric anti-ROR1 IgG (ROR1-IgG) The VL and VH were amplified [length of each amplified chain: approximately 400 bp and then inserted into the eukaryotic expression plasmids pFUSE-CHIg-hG1 and pFUSE-CLIg-hk, respectively. The sequences of VL and VH were illustrated in Fig. 1A. Both inserts were placed in their respective vectors at FspI/BmtI restriction sites without any mutations (Fig. 1B). Thus, the eukaryotic expression vectors carrying anti-ROR1 IgG (pFUSE-CHIg-hG1-ROR1H and pFUSE-CLIg-hkROR1K) were successfully constructed. The recombinant expression vector was transferred to CHO cells and cultured for 48 h. The supernatant of the recombinant CHO cells was collected, purified with protein A affinity column and examined by SDS-PAGE gel with Coomassie brilliant blue staining (Fig. 1C). Due to protein denaturation, the IgG antibodies were observed at about 55 kDa and 27 kDa, respectively. The purification efficiency reached 95% for concentration of ROR1-IgG up to 2.1 mg/mL.
2.8. Wound healing assay Ovarian cancer cell lines HO8910, A2780, and Iose386 were seeded in 24-well plates and grown to 90% confluence. Wound healing assay was performed on serum starved ovarian cancer cell lines as described previously [37]. The monolayer of cells was scratched using a 200 μL pipette tip and the cells were treated with ROR1-IgG for different time intervals (0, 24, and 48 h). The wound closing rate was calculated using Image Pro Plus software using the formula: n h (n hour) migration rate= (the distance from the edge of the 0 h – the distance from the edge of the n h)/ the distance from the edge of the 0 h. 2.9. Establishment of HO8910 xenograft model Five-week-old female BALB/c nude mice (weight: 18–20 g each) were acquired from the SLAC Laboratory Animal House (Shanghai, China) for use in our in vivo experiments. We successfully established HO8910 xenograft models by subcutaneous injection of 0.1 mL solution containing 1 × 107 HO8910 cells into the right chest of the mice. After inoculation, the tumor volume was estimated using the formula: Tumor volume (mm3) = (width) 2 × length/2. When the tumors reached a volume of approximately 80 mm3, the mice were randomly divided into four groups (6 mice per group) and administered different treatments immediately: group I, PBS (negative control); group II, low concentration of ROR1-IgG (2 mg/kg); group III, medium concentration of ROR1IgG (4 mg/kg); and group IV, high concentration of ROR1-IgG (8 mg/ kg). All mice received intravenous treatment on alternate days (a total of 10 injections), and the body weight and tumor size measured on alternate days. Following the last measurement, the mice were euthanized with CO2 narcosis. The tumor tissues were excised, weighed, and measured individually for further analyses. We calculated the inhibition rate of tumor growth using the formula: Inhibition rate (%) = (mean tumor weight in control group – mean tumor weight in experimental group)/ mean tumor weight in control group×100%.
3.2. Confirmation of ROR1-IgG specificity and selectivity ELISA assay was employed to assess the binding ability of ROR1-IgG to human ROR1 protein using gradient concentrations (Fig. 1D). The results showed that ROR1-IgG could specifically bind to ROR1 in a dose-dependent manner. Further, we calculated the affinity constant to evaluate the binding capacity of ROR1-IgG using the following formula: Affinity constant (KD) = dissociation constant (Kd)/binding constant (Ka) [38]. Results obtained from the Biacore X100 SPR analysis showed that the affinity constant of ROR1-IgG was 9.627 × 10−10 (Fig. 1E). These results showed that ROR1-IgG could specifically bind to ROR1 protein. 3.3. Characterization of ROR1-IgG Western blotting analysis was firstly performed to detect ROR1 expression in ovarian cancer cell lines by using a commercial ROR1 antibody. As is shown in Fig. 2A, high ROR1 expression was observed in HO8910 and A2780 cells. Then FCM was performed to detect the 3
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 1. Generation and confirmation of the fully chimeric anti-ROR1 IgG (ROR1-IgG). (A) DNA and amino acid sequences of the variable regions of ROR1-IgG. (B) An agarose gel of the recombinant plasmid pFUSE-CLIg-hk-ROR1K and pFUSE-CHIg-hG1-ROR1H. Lane 1, VL; Lane 2, the plasmid of pFUSE-CLIg-hk; Lane 3, the recombinant plasmid pFUSE-CLIg-hk-ROR1K; Lane 4, VH; Lane 5, the plasmid of pFUSE-CHIg-hG1; Lane 6, the recombinant plasmid pFUSE-CHIg-hG1-ROR1H; M, a DNA marker. (C) Coomassie blue staining. Detection of the purification efficiency of ROR1-IgG. Lane 1, supernatant of untransfected CHO cells, as a negative control; Lane 2, supernatant of CHO cells transfected with recombinant plasmid pFUSE-CLIg-hk-ROR1K and pFUSE-CHIg-hG1-ROR1H after cultivation for 48 h; Lane 3, the flow through the Protein A affinity column; lane 4, ROR1-IgG was purified by the Protein A affinity column; M, a protein marker. (D) ELISA. The recombinant human ROR1 protein was pre-incubated on 96-well plates. ROR1-IgG was used as primary antibody and HRP-conjugated goat anti-human IgG (Fc specific) was used as secondary antibody. Spectrophotometer was employed to detect the absorbance value. (E) Surface plasmon resonance (SPR) analysis. SPR analysis was used to determine the binding affinity of ROR1-IgG. All experiments were repeated at least thrice. Data are presented as mean ± standard deviation (n = 3; NS, not significant; *p < 0.05, **p < 0.01, ***p < 0.001 vs. control). ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
3.4. ROR1-IgG inhibits ovarian cancer cell growth in vitro
binding capacity of ROR1-IgG. Fig. 2B showed that ROR1-IgG could significantly bind to the membrane of HO8910 and A2780 cell lines with positive ROR1 expression, not Iose386 cell line with negative ROR1 expression. Fluorescence staining experiment was further conducted to show that ROR1-IgG stained only ROR1-positive HO8910 and A2780 cells but not Iose386 cell (Fig. 2C). Taken together, these data indicated that HO8910 and A2780 had high expression of ROR1 and ROR1-IgG could effectively bind only to ROR1-positive cells.
CCK8 assay was performed to investigate the role of ROR1-IgG on ovarian cancer cell growth. Results showed that the inhibition efficiency was increased in a concentration-dependent manner in ROR1positive cells, and the difference was statistically significant (approximately 41% at 80 μg/mL in A2780 cells and approximately 35% at 80 μg/mL in HO8910 cells; Fig. 3A). Subsequently, wound healing 4
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 2. Characterization of ROR1-IgG. A. Western blotting analysis showed that high ROR1 expression was witnessed in HO8910 and A2780 cells. B. Flow cytometry. FCM was performed to detect the binding capacity of ROR1-IgG. ROR1-IgG could significantly bind to the membrane of HO8910 and A2780 cell lines with positive ROR1 expression, not Iose386 cell line with negative ROR1 expression. C. Fluorescence staining demonstrated that ROR1-IgG stained only ROR1-positive HO8910 and A2780 cells but not Iose386 cell. All experiments were repeated at least thrice. Data are presented as mean ± standard deviation (*p < 0.05 vs. control). ROR1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
(0.00%, 42.86%, and 66.29%, respectively). Similarly, the A2780 cells showed reduced migration capacity of 0.00%, 8%, and 16.67%, respectively, at 0, 24, and 48 h, as compared to the control A2780 cells (0.00%, 40.7%, and 73.45%, respectively); Iose386 cells showed reduced migration capacity of 0.00%, 30%, and 53.33%, respectively, as
assay was conducted to investigate the effect of ROR1-IgG on ovarian cancer cell lines. Our data suggested that ROR1-IgG blocked tumor cell migration. The migration capacity of in HO8910 cells at 0, 24, and 48 h after treatment with ROR1-IgG was reduced to 0.00%, 16.4%, and 24.34% respectively, as compared to that of control HO8910 cells 5
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 3. ROR1-IgG inhibits ovarian cancer cell growth in vitro. A. Tumor cells were grown and treated with different doses of ROR1-IgG for 48 h and then subjected to CCK8 assay. B. Wound healing assay. Ovarian cancer cells were subjected to ROR1-IgG for up to 48 h. All experiments were repeated at least thrice. Data are presented as mean ± standard deviation (n = 3; NS, not significant; *p < 0.05, **p < 0.01 vs. control). ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
The tumor growth of HO8910 xenograft nude mice models was significantly inhibited by ROR1-IgG in a dose-dependent manner as compared to the control PBS group (p < 0.01). The tumor inhibition rates following different treatments were calculated and were found to be approximately 47.72%, 53.79%, and 60.51% for low, medium, and high concentrations of ROR1-IgG, respectively (Fig. 4F).
compared to the control Iose386 cells (0.00%, 26.67%, and 56.67%, respectively; Fig. 3B). There was no apparent difference between ROR1IgG treated or untreated Iose386 cells in this respect. The results implied that the ROR1-IgG could effectively inhibit tumor cell migration in ROR1 positive cell lines in a time-dependent manner. 3.5. ROR1-IgG inhibits tumor growth in HO8910 xenograft model
3.6. Detection of Bcl-2 and Bax by IHC and western blotting analyses HO8910 xenograft nude mice models were established and ROR1IgG demonstrate significant inhibitory effects of on tumor growth in vivo (Fig. 4A and 4B). The body weights of nude mice were measured to assess the toxicity of ROR1-IgG in vivo. The average post-treatment body weights were 20.4 ± 0.6 g for PBS, 20.3 ± 0.4 g for low concentration of ROR1-IgG (2 mg/kg), 19.8 ± 0.5 g or medium concentration of ROR1-IgG (4 mg/kg), and 19.6 ± 0.4 g for highest concentration of ROR1-IgG (8 mg/kg) (Fig. 4C). The average tumor volumes following different treatments were 1.555 ± 0.174 cm3, 0.856 ± 0.050 cm3, 0.721 ± 0.069 cm3, and 0.656 ± 0.056 cm3 for PBS, low, medium, and high concentrations of ROR1-IgG, respectively (Fig. 4D). Average post-treatment tumor weights were 1.92 ± 0.28 g, 1.00 ± 0.14 g, 0.89 ± 0.12 g, and 0.76 ± 0.11 g, for PBS, low, medium, and high concentrations of ROR1-IgG, respectively (Fig. 4E).
Further, positive expression of ROR1 in HO8910 xenografts was confirmed using IHC (Fig. 5A). H&E staining was used to examine the morphology of tumor tissues. The expressions of Bcl-2 and Bax in HO8910 xenografts were detected using IHC analysis. The results showed that with the increasing dose of ROR1-IgG, the expression of Bcl-2 was reduced, while the expression of Bax was significantly elevated (p < 0.05; Fig. 5B). With increase in the dosage of the ROR1IgG, the level of tumor apoptosis increased, while no tumor apoptosis was observed in the PBS groups. In addition, Western blotting analysis was employed to further prove the expressions of Bcl-2 and Bax in HO8910 xenografts. As shown in Fig. 5C, with the increasing dose of ROR1-IgG, the expression of Bcl-2 was decreased, while the expression of Bax was distinctly increased in nude mice models. 6
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 4. ROR1-IgG inhibits tumor growth in HO8910 xenograft model in vivo. HO8910 xenograft nude mice models were successfully established and randomly divided into four groups. (A) and (B) Tumor-inhibitory effects of ROR1-IgG in xenograft nude mice in vivo. (C) Mean body weight of xenograft nude mice throughout the in vivo experiments. *p < 0.05 vs. control group. (D) Measurement of tumor volume of xenograft tumors. **p < 0.01 vs. control group. (E) Measurement of tumor weight of xenograft tumors. **** p < 0.0001 vs. control group. (F) inhibition rates of different treatment groups. ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
4. Discussion
ARI-1 to suppress the development of Non-Small Cell Lung Cancer [42]. All the above revealed that targeting ROR1 could be a promising strategy for cancer management. In our previous study, we found that ROR1 expression was significantly higher in ovarian cancer tissues, and may serve as an independent prognostic factor for ovarian cancer [35]. Subsequently, we constructed a novel chimeric anti-ROR1 Fab antibody and tested its anti-tumor effectiveness [36]. Compared with Fab antibody fragments [36], fully IgG antibodies exhibit no immunological rejection and higher affinity; these not only retain the characteristics of Fab-specific antigen recognition, but also perform some other biological functions of antibodies, such as immune regulation, activation of complement, and antibody-dependent cellular cytotoxicity (ADCC). Besides, IgG has higher half-life in vivo and shows better stability. It
As a member of the RTK family, ROR1 is believed to have properties of tumor associated antigens (TAAs) and a number of studies reported the relationship between ROR1 expression and human cancers [39]. For now, commercialized ROR1-antibody can only recognize the ROR1 antigen, while can not inhibit or antagonize the ROR1 protein. Recently, Hojjat-Farsangi et al. described KAN0439834 could act as an oral small molecule inhibitor from a library of 110,000 compounds using fresh CLL cells, which can significantly induced apoptosis of CLL cells [40]. Zhang et al. reported a humanized anti-ROR1 monoclonal antibody cirmtuzumab repressed expression of genes associated with breast cancer stemness and reduced activation of Rho-GTPases, HippoYAP/TAZ, or BMI1 [41]. Liu et al. constructed a novel ROR1 inhibitor 7
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
Fig. 5. Detection of Bcl-2 and Bax by IHC and Western blotting analysis. (A) The expression of ROR1 protein in HO8910 xenografts was determined using IHC. (B) HE staining was employed to assess the pathological changes in tumor tissue specimens. The expression levels of Bcl-2 and Bax in HO8910 xenografts in different treatment groups were determined using IHC. Lane N, PBS; Lane L, low concentration of ROR1-IgG (2 mg/kg); Lane M, medium concentration of ROR1-IgG (4 mg/ kg); Lane H, high concentration of ROR1-IgG (8 mg/kg). (C) The expression level Bcl-2 and Bax in HO8910 xenografts of different treatment groups were determined using Western blotting analysis. Lane N, PBS; Lane L, low concentration of ROR1-IgG (2 mg/kg); Lane M, medium concentration of ROR1-IgG (4 mg/kg); Lane H, high concentration of ROR1-IgG (8 mg/kg). Data are presented as mean ± standard deviation (n = 3; NS, not significant; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. control). IHC, immunohistochemistry; ROR-1, Receptor-tyrosine-kinase-like Orphan Receptor 1; IgG, immunoglobulin G.
8
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
interaction between ROR1 and casein kinase 1 epsilon, which in turn triggered the PI3K/AKT/CREB signaling pathway [22]. In lung adenocarcinomas, the NKX2-1 gene was shown to induce the expression of ROR1, which in turn triggered the phosphorylation of c-SRC and maintained the balance between pro-survival PI3K-AKT signaling and pro-apoptotic p38 signaling. In addition, knockdown of ROR1 was shown to induce apoptosis of lung cancer cells [19,47]. While in this present study the underlying mechanisms responsible for ROR1 action to promote the malignant phenotypes of ovarian cancer are yet to be elucidated. For instance, the mechanism of ROR1-IgG inhibits tumor growth, induces apoptosis and regulates Bcl-2 and Bax proteins. Moreover, there are several other limitations to this study. Firstly, we did not employ isotype IgG as internal control which could strengthen the convincingness and solidity of the data of characteristics of ROR1IgG. Secondly, we only described the phenomenon caused by ROR1-IgG while we did not provide the detailed information of how ROR1-IgG acted on ROR1, for example the ROR1 epitope that ROR1-IgG worked with. Thirdly, we did not perform apoptosis test in xenograft tumor and directly jumped into Bcl-2 and Bax detection. Fourthly, we did not explore the function of ROR1-IgG in blocking kinase signaling as ROR1 is a member of the RTK family. In our future study, we will design the whole experimental protocol more elaborately and ameliorate the experimental details more thoroughly. In conclusion, we successfully constructed a new chimeric antiROR1 IgG antibody (ROR1-IgG), which demonstrated a high affinity and selectivity for binding to ROR1 protein. Moreover, ROR1-IgG showed its ability to inhibit ovarian cancer growth both in vitro and in vivo. These results suggest that ligation of ROR1 with ROR1-IgG may be a potent therapeutic strategy for ROR1-positive ovarian cancer.
has greater application value for subsequent drug development [43]. Therefore, it is rational to presume IgG antibody could demonstrate great advantage compared to Fab antibody and we constructed this fully chimeric anti-ROR1 IgG antibody (ROR1-IgG) in this present study. The expression and purification of ROR1-IgG was verified and evaluated by Coomassie blue staining. Then, ELISA and affinity analysis were employed to confirm the specificity and selectivity of the binding of ROR1-IgG to the recombinant human ROR1 protein. FACS and fluorescence staining assays were performed by using ROR1-IgG as primary antibody to detect the expression level of ROR1 protein in the ovarian cancer cells. The above results illustrated that ROR1-IgG possessed a high specificity and affinity for ROR1 protein. A latest study also reported that protein H bound IgG solely through Fc, but not Fab to affinity to enhance affinity and virulence [44]. Actually, the spatial structure between IgG full-length antibody and Fab antibody fragments was different. In our previous research, a novel human monoclonal Trop2-IgG antibody also demonstrated improved affinity compared with the previous Trop2-Fab antibody [37,45]. Furthermore, the antitumor activity of ROR1-IgG was assessed in ovarian cancer cells-ROR1-positive cell lines and ROR1-negative cell lines. CCK8 assay results showed that the inhibition efficiency of ovarian cancer cell growth was increased in a concentration-dependent manner in ROR1-positive cells, and the difference was statistically significant. Wound healing results revealed that the cell migration rate of ROR1-positive ovarian cancer was significantly inhibited after treatment with ROR1-IgG for 24 or 48 h. However, there was no significant difference between ROR1-IgG -treated and untreated Iose386 cells in this respect. These findings illustrated that ROR1-IgG could selectively and specifically inhibit malignant behavior of ROR1-positive cells. There are considerable differences between the environment inside the body and the external environment. In addition, our in vitro results showed that the inhibitory effect on the growth and migration of A2780 cells was greater than that of HO8910 cells. A2780 was originally collected from endometrioid type while HO8910 was originally acquired from serous type. As the incidence and mortality of serous type of ovarian cancer was significantly higher than other types of ovarian cancer, including endometrioid type, clear cell type and mucinous type, we reckon that serous type of ovarian cancer was more representative [3]. Therefore, we constructed HO8910 cell line to construct xenograft nude mice to further explore whether antibodies can inhibit the malignant behavior of ovarian cancer in vivo. In our previous research, we also followed the similar protocol and enrolled HO8910 cell line to perform in vivo experiment [37]. The tumor inhibition rates following different treatments were observed to be approximately 47.72%, 53.79%, and 60.51% for low, medium, and high concentrations of ROR1-IgG, which indicates a dose-dependent response. Significant inhibitory effect on tumors was found in xenograft nude mice, which may be related to the role of ADCC. In vivo, ROR1-IgG may form a bridge between HO8910 cells and NK cells by binding to the NK cells with its Fc region, and to the HO8910 cells with its Fab region. This is liable to enhance the function of NK cells. This phenomenon is referred to as antibody-dependent cellular cytotoxicity (ADCC). Additional research should be performed to exploit its biological function and to clarify the underlying mechanisms. There are two types of proteins in the Bcl-2 family, i.e., pro-apoptotic proteins (such as Bax, Bak and Bim) and anti-apoptotic proteins (such as Bcl-2, Bcl-xl and Mcl-1) [46], which is crucial checkpoint in apoptosis. IHC and Western blotting analysis were employed to assess the expression levels of Bcl-2 and Bax following different treatments. Our results showed that increasing doses of ROR1-IgG reduced the expression of Bcl-2, while the expression of Bax was significantly elevated. These findings suggest that ROR1-IgG could inhibit tumor growth and promote apoptosis. There are some pertinent questions that require answers. In breast cancer studies, combining Wnt5a with ROR1 was shown to enhance the
Authors' contributions HZ, HT and ZY conceived and designed the study. ZY, YM and NZ performed the experiments. ZY, YM, JZ and YS analyzed the data. ZY drafted the manuscript. HZ and YM reviewed and revised the manuscript. All authors read and approved the final manuscript. Ethics approval and consent to participate All animal experiments were approved by the Ethics Committee of the Nanjing Medical University. We strictly followed the guiding principles of the animal care and use as set by the Nanjing Medical University. At the end of experiments, the mice were euthanized by CO2 narcosis and none of the animals died before euthanasia. Declaration of Competing Interest None. Acknowledgements This study is supported by the grants from the Nanjing Scientific and Technological Development Program (201503049), the Nanjing Medical Science and Technique Development Fund (ZKX13045), the Jiangsu Provincial Medical Youth Talent (QNRC2016104, QNRC2016535) and the Natural Science Foundation of Jiangsu Province (BK20181489). References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global Cancer Statistics, 2012, (2015). [2] A. Chao, C.L. Tsai, S.M. Jung, W.C. Chuang, C. Kao, A. Hsu, S.H. Chen, C.Y. Lin, Y.C. Lee, Y.S. Lee, T.H. Wang, H.S. Wang, C.H. Lai, BAI1-associated protein 2-Like 1 (BAIAP2L1) is a potential biomarker in ovarian cancer, PLoS One 10 (7) (2015) e133081. [3] L.A. Torre, B. Trabert, C.E. DeSantis, K.D. Miller, G. Samimi, C.D. Runowicz,
9
Biomedicine & Pharmacotherapy 119 (2019) 109420
Z. Yin, et al.
[4] [5]
[6] [7] [8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16] [17]
[18] [19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27] A.H. Daneshmanesh, E. Mikaelsson, M. Jeddi-Tehrani, A.A. Bayat, R. Ghods, M. Ostadkarampour, M. Akhondi, S. Lagercrantz, C. Larsson, A. Osterborg, F. Shokri, H. Mellstedt, H. Rabbani, Ror1, a cell surface receptor tyrosine kinase is expressed in chronic lymphocytic leukemia and may serve as a putative target for therapy, Int. J. Cancer 123 (5) (2008) 1190–1195. [28] G. Rebagay, S. Yan, C. Liu, N.K. Cheung, ROR1 and ROR2 in human malignancies: potentials for targeted therapy, Front. Oncol. 2 (2012) 34. [29] M. Hojjat-Farsangi, F. Ghaemimanesh, A.H. Daneshmanesh, A.A. Bayat, J. Mahmoudian, M. Jeddi-Tehrani, H. Rabbani, H. Mellstedt, Inhibition of the receptor tyrosine kinase ROR1 by anti-ROR1 monoclonal antibodies and siRNA induced apoptosis of melanoma cells, PLoS One 8 (4) (2013) e61167. [30] Y.Z. Zheng, R. Ma, J.K. Zhou, C.L. Guo, Y.S. Wang, Z.G. Li, L.X. Liu, Y. Peng, ROR1 is a novel prognostic biomarker in patients with lung adenocarcinoma, Sci. Rep. 6 (2016) 36447. [31] A.H. Daneshmanesh, M. Hojjat-Farsangi, A.S. Khan, M. Jeddi-Tehrani, M.M. Akhondi, A.A. Bayat, R. Ghods, A.R. Mahmoudi, R. Hadavi, A. Osterborg, F. Shokri, H. Rabbani, H. Mellstedt, Monoclonal antibodies against ROR1 induce apoptosis of chronic lymphocytic leukemia (CLL) cells, Leukemia 26 (6) (2012) 1348–1355. [32] M.K. Hasan, L. Rassenti, G.N. Widhopf, J. Yu, T.J. Kipps, Wnt5a causes ROR1 to complex and activate cortactin to enhance migration of chronic lymphocytic leukemia cells, Leukemia (2018). [33] S. Zhang, H. Zhang, E.M. Ghia, J. Huang, L. Wu, J. Zhang, S. Lam, Y. Lei, J. He, B. Cui, G.N. Widhopf, J. Yu, R. Schwab, K. Messer, W. Jiang, B.A. Parker, Inhibition of chemotherapy resistant breast cancer stem cells by a ROR1 specific antibody, Proc. Natl. Acad. Sci. U. S. A. (2019). [34] H. Tan, Q. He, G. Gong, Y. Wang, J. Li, J. Wang, D. Zhu, X. Wu, miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer, Int. J. Oncol. 48 (1) (2016) 181–190. [35] H. Zhang, J. Qiu, C. Ye, D. Yang, L. Gao, Y. Su, X. Tang, N. Xu, D. Zhang, L. Xiong, Y. Mao, F. Li, J. Zhu, ROR1 expression correlated with poor clinical outcome in human ovarian cancer, Sci. Rep. 4 (2014) 5811. [36] Z. Yin, M. Gao, S. Chu, Y. Su, C. Ye, Y. Wang, Z. Pan, Z. Wang, H. Zhang, H. Tong, J. Zhu, Antitumor activity of a newly developed monoclonal antibody against ROR1 in ovarian cancer cells, Oncotarget 8 (55) (2017) 94210–94222. [37] J. Liu, D. Yang, Z. Yin, M. Gao, H. Tong, Y. Su, J. Zhu, C. Ye, H. Zhang, A novel human monoclonal Trop2-IgG antibody inhibits ovarian cancer growth in vitro and in vivo, Biochem. Biophys. Res. Commun. 512 (2) (2019) 276–282. [38] H. Hirai, E. Ogata, N. Kikuchi, T. Kohno, N. Machii, K. Hasegawa, T. Watanabe, H. Satoh, The effects of liraglutide on both hypereosinophilic insulin allergy and the characteristics of anti-insulin antibodies in type 2 diabetes mellitus: a case report, J. Med. Case Rep. 10 (2016) 202. [39] Y. Mao, L. Xu, J. Wang, L. Zhang, N. Hou, J. Xu, L. Wang, S. Yang, Y. Chen, L. Xiong, J. Zhu, W. Fan, J. Xu, ROR1 associates unfavorable prognosis and promotes lymphoma growth in DLBCL by affecting PI3K/Akt/mTOR signaling pathway, Biofactors 45 (3) (2019) 416–426. [40] M. Hojjat-Farsangi, A.H. Daneshmanesh, A.S. Khan, J. Shetye, F. Mozaffari, P. Kharaziha, L.S. Rathje, P. Kokhaei, L. Hansson, J. Vagberg, S. Bystrom, E. Olsson, C. Lofberg, C. Norstrom, J. Schultz, M. Norin, First-in-class oral small molecule inhibitor of the tyrosine kinase ROR1 (KAN0439834) induced significant apoptosis of chronic lymphocytic leukemia cells, Leukemia 32 (10) (2018) 2291–2295. [41] S. Zhang, H. Zhang, E.M. Ghia, J. Huang, L. Wu, J. Zhang, S. Lam, Y. Lei, J. He, B. Cui, G.N. Widhopf, J. Yu, R. Schwab, K. Messer, W. Jiang, B.A. Parker, Inhibition of chemotherapy resistant breast cancer stem cells by a ROR1 specific antibody, Proc. Natl. Acad. Sci. U. S. A. 116 (4) (2019) 1370–1377. [42] X. Liu, W. Pu, H. He, X. Fan, Y. Zheng, J.K. Zhou, R. Ma, J. He, Y. Zheng, K. Wu, Y. Zhao, S.Y. Yang, C. Wang, Y.Q. Wei, X.W. Wei, Y. Peng, Novel ROR1 inhibitor ARI-1 suppresses the development of non-small cell lung cancer, Cancer Lett. (2019). [43] G. Winter, A.D. Griffiths, R.E. Hawkins, H.R. Hoogenboom, Making antibodies by phage display technology, Annu. Rev. Immunol. 12 (1994) 433–455. [44] D. Ermert, M. Laabei, A. Weckel, M. Morgelin, M. Lundqvist, L. Bjorck, S. Ram, S. Linse, A.M. Blom, The molecular basis of human IgG-Mediated enhancement of C4b-Binding protein recruitment to group a Streptococcus, Front. Immunol. 10 (2019) 1230. [45] H. Lin, H. Zhang, J. Wang, M. Lu, F. Zheng, C. Wang, X. Tang, N. Xu, R. Chen, D. Zhang, P. Zhao, J. Zhu, Y. Mao, Z. Feng, A novel human Fab antibody for Trop2 inhibits breast cancer growth in vitro and in vivo, Int. J. Cancer 134 (5) (2014) 1239–1249. [46] F. Faiao-Flores, P.R. Coelho, A.J. Toledo, S.S. Maria-Engler, M. Tiago, V.L. Capelozzi, R.R. Giorgi, D.A. Maria, Apoptosis through Bcl-2/Bax and cleaved caspase up-regulation in melanoma treated by boron neutron capture therapy, PLoS One 8 (3) (2013) e59639. [47] Y. Liu, H. Yang, T. Chen, Y. Luo, Z. Xu, Y. Li, J. Yang, Silencing of receptor tyrosine kinase ROR1 inhibits tumor-cell proliferation via PI3K/AKT/mTOR signaling pathway in lung adenocarcinoma, PLoS One 10 (5) (2015) e127092.
M.M. Gaudet, A. Jemal, R.L. Siegel, Ovarian cancer statistics, 2018, CA Cancer J. Clin. 68 (4) (2018) 284–296. Y. Yoshida, C.L. Schmaltz, J. Jackson-Thompson, E.J. Simoes, Ovarian Cancer survival in Missouri, 1996-2014, Mol. Med. 115 (6) (2018) 542–547. Z. Zhang, Z. Xie, G. Sun, P. Yang, J. Li, H. Yang, S. Xiao, Y. Liu, H. Qiu, L. Qin, C. Zhang, F. Zhang, B. Shan, Reversing drug resistance of cisplatin by hsp90 inhibitors in human ovarian cancer cells, Int. J. Clin. Exp. Med. 8 (5) (2015) 6687–6701. E. Dean, L. El-Helw, J. Hasan, Targeted therapies in epithelial ovarian cancer, Cancers (Basel) 2 (1) (2010) 88–113. R.J. Bast, B. Hennessy, G.B. Mills, The biology of ovarian cancer: new opportunities for translation, Nat. Rev. Cancer 9 (6) (2009) 415–428. R.E. Meyn, L.C. Stephens, N.R. Hunter, L. Milas, Kinetics of cisplatin-induced apoptosis in murine mammary and ovarian adenocarcinomas, Int. J. Cancer 60 (5) (1995) 725–729. R. Chen, D. Zhang, Y. Mao, J. Zhu, H. Ming, J. Wen, J. Ma, Q. Cao, H. Lin, Q. Tang, J. Liang, Z. Feng, A human Fab-based immunoconjugate specific for the LMP1 extracellular domain inhibits nasopharyngeal carcinoma growth in vitro and in vivo, Mol. Cancer Ther. 11 (3) (2012) 594–603. D.A. Yardley, L. Hart, L. Bosserman, M.N. Salleh, D.M. Waterhouse, M.K. Hagan, P. Richards, M.L. DeSilvio, J.M. Mahoney, Y. Nagarwala, Phase II study evaluating lapatinib in combination with nab-paclitaxel in HER2-overexpressing metastatic breast cancer patients who have received no more than one prior chemotherapeutic regimen, Breast Cancer Res. Treat. 137 (2) (2013) 457–464. A.M. Jubb, K.D. Miller, H.S. Rugo, A.L. Harris, D. Chen, J.D. Reimann, M.A. Cobleigh, M. Schmidt, V.K. Langmuir, K.J. Hillan, D.S. Chen, H. Koeppen, Impact of exploratory biomarkers on the treatment effect of bevacizumab in metastatic breast cancer, Clin. Cancer Res. 17 (2) (2011) 372–381. C.H. Chang, P. Gupta, R. Michel, M. Loo, Y. Wang, T.M. Cardillo, D.M. Goldenberg, Ranpirnase (frog RNase) targeted with a humanized, internalizing, anti-Trop-2 antibody has potent cytotoxicity against diverse epithelial cancer cells, Mol. Cancer Ther. 9 (8) (2010) 2276–2286. J. Yu, L. Che, B. Cui, G.N. Widhopf, Z. Shen, R. Wu, L. Zhang, S. Zhang, S.P. Briggs, T.J. Kipps, Wnt5a induces ROR1/ROR2 heterooligomerization to enhance leukemia chemotaxis and proliferation, J. Clin. Invest. 126 (2) (2016) 585–598. S.H. Gohil, S.R. Paredes-Moscosso, M. Harrasser, M. Vezzalini, A. Scarpa, E. Morris, A.M. Davidoff, C. Sorio, A.C. Nathwani, P.M. Della, An ROR1 bi-specific T-cell engager provides effective targeting and cytotoxicity against a range of solid tumors, Oncoimmunology 6 (7) (2017) e1326437. J. Heliste, A. Jokilammi, I. Paatero, D. Chakroborty, C. Stark, T. Savunen, M. Laaksonen, K. Elenius, Receptor tyrosine kinase profiling of ischemic heart identifies ROR1 as a potential therapeutic target, BMC Cardiovasc. Disord. 18 (1) (2018) 196. J.L. Green, S.G. Kuntz, P.W. Sternberg, Ror receptor tyrosine kinases: orphans no more, Trends Cell Biol. 18 (11) (2008) 536–544. M. Endo, R. Doi, M. Nishita, Y. Minami, Ror family receptor tyrosine kinases regulate the maintenance of neural progenitor cells in the developing neocortex, J. Cell. Sci. 125 (Pt 8) (2012) 2017–2029. S. Paganoni, A. Ferreira, Neurite extension in central neurons: a novel role for the receptor tyrosine kinases Ror1 and Ror2, J. Cell. Sci. 118 (Pt 2) (2005) 433–446. T. Yamaguchi, K. Yanagisawa, R. Sugiyama, Y. Hosono, Y. Shimada, C. Arima, S. Kato, S. Tomida, M. Suzuki, H. Osada, T. Takahashi, NKX2-1/TITF1/TTF-1Induced ROR1 is required to sustain EGFR survival signaling in lung adenocarcinoma, Cancer Cell 21 (3) (2012) 348–361. M. Hojjat-Farsangi, A. Moshfegh, A.H. Daneshmanesh, A.S. Khan, E. Mikaelsson, A. Osterborg, H. Mellstedt, The receptor tyrosine kinase ROR1–an oncofetal antigen for targeted cancer therapy, Semin. Cancer Biol. 29 (2014) 21–31. A.H. Daneshmanesh, A. Porwit, M. Hojjat-Farsangi, M. Jeddi-Tehrani, K.P. Tamm, D. Grander, S. Lehmann, S. Norin, F. Shokri, H. Rabbani, H. Mellstedt, A. Osterborg, Orphan receptor tyrosine kinases ROR1 and ROR2 in hematological malignancies, Leuk. Lymphoma 54 (4) (2013) 843–850. S. Zhang, L. Chen, B. Cui, H.Y. Chuang, J. Yu, J. Wang-Rodriguez, L. Tang, G. Chen, G.W. Basak, T.J. Kipps, ROR1 is expressed in human breast cancer and associated with enhanced tumor-cell growth, PLoS One 7 (3) (2012) e31127. S. Zhang, L. Chen, J. Wang-Rodriguez, L. Zhang, B. Cui, W. Frankel, R. Wu, T.J. Kipps, The onco-embryonic antigen ROR1 is expressed by a variety of human cancers, Am. J. Pathol. 181 (6) (2012) 1903–1910. B. Cui, S. Zhang, L. Chen, J. Yu, G.N. Widhopf, J.F. Fecteau, L.Z. Rassenti, T.J. Kipps, Targeting ROR1 inhibits epithelial-mesenchymal transition and metastasis, Cancer Res. 73 (12) (2013) 3649–3660. A. Gentile, L. Lazzari, S. Benvenuti, L. Trusolino, P.M. Comoglio, Ror1 is a pseudokinase that is crucial for Met-driven tumorigenesis, Cancer Res. 71 (8) (2011) 3132–3141. G.L. Xu, J. Shen, Y.H. Xu, W.S. Wang, C.F. Ni, ROR1 is highly expressed in circulating tumor cells and promotes invasion of pancreatic cancer, Mol. Med. Rep. 18 (6) (2018) 5087–5094.
10