A functional analysis of the inverted repeat of the γδ transposable element

J. MoL BioL (1995) 247, 578-587

JMB A Functional Analysis of the Inverted Repeat of the Transposable Element Earl. W. May and Nigel D. F. Grindley* Department of Molecular Biophysics and Biochemistry Yale University, Bass Center for Molecular and Structural Biology, 266 Whitney Avenue New Haven, CT 06520 U.S.A.

*Corresponding author

We have constructed a library of point mutants of the 35 base-pair terminal inverted repeat (IR) of the bacterial transposon 76, a member of the Tn3 family of transposable elements. The effect of the mutant ends, both on the immunity conferred on an IR-containing target plasmid and on the transposition of model transposons, was determined. The region important for immunity was shown to be a 30 base-pair stretch of DNA, running from G8 and A9 to G38; mutations in the outermost seven or eight base-pairs did not significantly affect immunity. Positions at which mutations disrupted immunity chiefly coincided with positions previously determined to constitute three segments of the IR with which 18 tranposase protein interacts via major groove contacts. We conclude that sequence-specific binding contacts between 76 transposase and its cognate IR are limited to a specific subset of positions (those sensitive to mutation in the immunity assay) within this 30 base-pair region. We found that the innermost of the three major groove contact regions was the most susceptible to mutation, while the outermost was the least. Indications of minor groove contacts were also found. Very few point mutations within the 30 base-pair sequencespecific binding region had much effect on transposition when the mutant ends were in the "wild-type" context with the adjacent integration host factor (IHF) binding site. However, deletion of the IHF site, in some cases, revealed a transposition defect, suggesting that for transposition (but not immunity), IHF-transposase cooperation can largely overcome the effects of reduced transposase binding. Although the outer seven base-pairs were not important for immunit)~ mutations in the outer three or four eliminated or reduced transposition activity, suggesting that these positions are involved in a step in transposition that follows transposase binding.

Keywords: ?6 transposon; target immunity; transposase-DNA recognition; IHF

Introduction The 76 transposon (TnlO00) is a member of the Tn3 family of bacterial transposable elements, and thus transposes through a two-step, replicative process (for review, see Sherratt, 1989). The product of the tnpA gene, ?8 transposase, mediates the first step of the process. This protein acts directly at the 35 base-pair inverted repeats (IRs) which delimit the ends of the element. The product of the transposase reaction is a joint molecule which the host replication machinery converts into a cointegrate structure, containing both the donor and target molecules, Present address: Earl W. Ma)4Department of Molecular Biology and Genetics, John Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, MD 21205, U.S.A. Abbreviations used: IR, inverted repeat; IHF,integration host factor; MGCR, major groove contact region.

0022-2836/95/140578-10 $08.00/0

fused by two copies of the transposable element in direct repeat. In the second step, the product of the tnpR gene, resolvase, catalyzes a site-specific recombination event between the two copies of y8 at the res site, regenerating the donor DNA and leaving the other copy of the transposon in the target. Another property of Tn3-type transposable elements that is exhibited by y6 is transposition immunity. A plasmid which already harbors a copy of 78 is "immune" to further insertions of 18. It has been shown that the only DNA sequence element required to confer immunity on the target molecule is a single copy of the terminal inverted repeat, implicating transposase in the mechanism (Goto et al., 1987; Lee et al., 1983). Previous work from our laboratory has demonstrated that the 18 inverted repeat contains two functional domains (Wiater & Grindle}~ 1990b, 1991), similar to domains found in other elements, such ~~ 1995AcademicPress Limited

The Inverted Repeat of the ~,~ Transposon

as Tn3, IS903 and TnlO (Ichikawa et al., 1990; Derbyshire et al., 1987; Huisman et al., 1989). The inner three quarters of the inverted repeat are necessary for the efficient binding of transposase protein, while the outer base-pairs appear to be required only in the subsequent steps of the transposition reaction. Binding studies with purified ?8 transposase indicate that the protein binds to the inverted repeat along one face of the DNA helix, protecting three consecutive major and minor grooves (Wiater & Grindle34 1991). In addition, transposase binds the 8 end, which is proximal to the 3' end of the transposase gene, ten times better than the I end. A protein not encoded by the transposon, integration host factor (IHF), has been shown to bind just inside each IR, and in a cooperative fashion with transposase (Wiater & Grindle34 1988). IHF was originally discovered through its role in bacteriophage lambda integration, but is involved in several other systems (for review, see Friedman, 1988). The functional role of this protein in 15 transposition remains unclear, although it enhances the immunity conferred by a single IR (Wiater & Grindle~ 1990a). In this work, we have generated a library of point mutations across the 78 inverted repeat, and have analyzed the effects of these mutations on the interaction between DNA and the transposase protein in vivo. All mutant IRs were assayed for their ability to confer immunity on a target plasmid. In addition, using a subset of the mutant ends, we reconstituted transposons and measured their transposition efficiencies. The data demonstrate the correlation between transposase binding, immunity and the transposition reactions, and further delimit functional domains in the ?~ inverted repeat.

Results Saturation mutagenesis of the y8 inverted repeat The scheme used to generate a library of point mutations of the ?8 IR is shown in Figure 1A. A pool of mutagenic oligodeoxynucleotides corresponding to the terminal 38 base-pairs of the 8 end of 15 was synthesized (with, on average, slightly more than one mutation per complete oligonucleotide) and cloned into pEM16. This vector, a derivative of pUC119, contains an IHF binding site adjacent to the SphI cloning site, such that the spacing between the cloned 8 end and the IHF binding site is the same as in the wild-type transposon; in addition, the natural Tn3 IR present on pUC119 has been deleted. The final library obtained from DNA sequencing of more than 300 random transformants, consisted of 80 different point mutants spanning the first 38 base-pairs of the 6 end (see Figure 1B), and thus contained 70% of all the possible single point mutations. At only two positions, A20 and A31, have no mutations been isolated. One plasmid, pEM18, which contained the cloned end with no mutations, was retained as a wild-type control.

579

Transposition immunity of target plasmids harboring each mutant IR Each cloned mutant IR was located on a Cm' plasmid, suitable for use as a target in a mating-out assay to measure transposition immunity (see Materials and Methods). The immunity conferred by each mutant end was assayed at least three times, and on average, more than five times. In Figure 2, the frequency of transposition of a 78 transposon into a target containing a mutant 6 end is plotted as a function of the position of the mutation across the inverted repeat. The transposition freqtlency into pEM12, a non-immune target lacking a copy of the inverted repeat, was 3.5 x 10 -3, while the frequency into pEM18, the fully immune target containing a wild-type 8 end and a properly spaced IHF binding site, was 4 x 10-7. Also shown in Figure 2 is the transposition frequency into pEM19, a construct similar to pEM18, but from which the IHF binding site has been deleted. The loss of the IHF recognition site significantly decreased immunity (see Wiater & Grindley 1990a); the transposition frequency increased to 1.4 x 10-5. Every mutant IR with a single base change was tested in this assay and all the data lie within the greater than 1000-fold window delimited by the immune and non-immune controls. Statistical comparison of the very low transposition frequencies into targets that exhibit strong immunity is difficult. For this reason, they are plotted in the stippled area at the bottom of the graph, and are considered equivalent. Any data point above this area represents a significant deviation from the completely immune state. About one third of the 80 point mutations localized to half (19) of the 38 terminal base-pairs significantly reduced immunit~ The specific implications of the distribution of these mutations are deferred until the Discussion. None of the mutations completely abolished immunity: a plasmid harboring the most non-immune IR, C32A, was used as a target ten times less frequently than the non-immune control. In addition, there was no evidence for a mutant IR that made the plasmid an even better target for transposition than the negative control, so-called "negative immunity", as has been reported for some mutant ends in Tn3 (Kans & Casadaban, 1989; Nissley et al., 1991) and in Mu (Darzins et al., 1988). It is clear that the binding of transposase to the inverted repeat is an integral part of the immunity of a target replicono However, the possibility remains that the reduction in transposition into the end-containing target in our assay may have been due to depletion of transposase at the ends of the transposon, resulting from competition from the IRs in the target. Such competition has been noted in "trans inhibition" for Tn7 (Arciszewska et al., 1989) and is a reasonable possibilit34 since the plasmid harboring the transposon and the tnpA gene was low-copy while the pUC119-based target plasmids were high cop~ To address this question, we compared the transposition frequencies into two target plasmids,

The Inverted Repeat of the ?6 Transposon

580

i m m u n e with a transposition frequency similar to w h e n this plasmid was alone in the cell, and pKD56 remained non-immune, being mobilized at the same frequency as w h e n it was alone in the cell. Clear134 in these experiments, the presence of the multi-copy IR-containing target has no effect on the transposition to a second non-immune target. Thus, our assay provided a true measure of target immunit34 and was not influenced by potential competition for limiting transposase.

one with and the other without an IR, present in the cell at the same time. The IR-containing plasmid was pEM18, the fully i m m u n e pUC119-derived control plasmid used in the initial i m m u n i t y assays, while pKD56 (from Keith Derbyshire, Yale University), a pACYC184-derived Tc ~ plasmid (compatible with pEM18), was used as the non-immune control. As can be seen from Table 1, the frequency of transposition into pKD56 was similar to that into pEM12, the pUC119 derivative used as a non-immune control in the initial i m m u n i t y experiments. The transposition frequencies determined into either plasmid alone (4 x 10-~ into pEM12, 1 x 10 -~ into pKD56) were very similar to those obtained w h e n the two plasmids were present in the cell at the same time (6 x 10 -~ into pEM12, 2 x 10 -~ into pKD56). When pEM18 (containing a wild-type 8 IR) and pKD56 were presentin the cell at the same time, pEM18 remained

Transposition efficiency of transposons with mutant ends All the point mutations most detrimental to immunit~ and a sample of additional ones (including some located in the outer seven base-pairs of the IR), were subcloned and mutant transposons constructed

end

A.

Xba I ---

•,4

Sph I

,

TCTAGA~TTTGAGGGCCAATGGAACGAAAACGTACGTTAAGCATG

C- - -

GTACG---

---AGATC

utants ori

~

Cm r

ori

Cm r

Bm

~IGIGIGIT~ITIGaiGIGi~C~C~DTIGIG~CIG~A~IG~CIGiTITIaIalgl

l/l "'

Tn3:

m re®El . . . . . . ', .....~

~

C

I

~.

C

CT

G

-;

I~

~

~ t .......... ~t

~

~ ~

TC

Figure 1. Construction of the library of mutant IRs. A, The bold, underlined sequence is the mutagenic synthetic 47-mer; the 4 bases at the 5' and 3' ends are complementary to the single strand extensions created by XbaI and SphI, respectivel~ The otigonucleotide, synthesized using doped monomers (see Materials and Methods), was cloned as a single strand (as shown) into pEM16 to create pEM18 and mutant derivatives. The black bar adjacent to the cloning site represents the IHF binding site. B, All the single base substitutions obtained from the mutagenesis are shown schematically. The sequence along the top is that of the wild-type ~ end starting with position 1, the 5' terminal G residue. The bases at positions 36 to 38 shown in lower case are identical to the corresponding positions in Tn3, but are replaced by TAT in the 3' end. Underlined bases are those that differ between 78 and Tn3 IRs; in Tn3, these positions are substituted by the bases shown at the bottom of the figure. At each position, the heavily shaded boxes indicate the point mutations obtained; lightly shaded boxes indicate the wild-type residue; white boxes indicate point mutations missing from the library. Note that only positions 20 and 31 lack mutations.

The Inverted Repeat of the ~/~ Transposon

581

~-- p E M 1 2 IR- IHF"

non- 10.3 immune ............. :'" i~:~i ii:~!~' i? :7 ~'i O cO

~.,~:..................................... . . . . . . .

~-

:,rr:

10"4.

............

:~~ ~~.:~:~~ ~

~::! i : T t: -:y-..L~ , .- ~ :: ~: .........

~ ":::':r -

0

:i".:!17" i :: : ":i:':" ..................... . :~ ~':. ~.

~

i: i : . ......... ~um r:.6- :-~:~ •

-

cO

i-~i~'i"

(3

• ...........

L) :):o :.)!L.I~Ii

¢JI 0

pEM19 10-5 ....................

.~.:.: I":~:':.', :~?T'

:" ..........

" ; ~ ",:::~';;" ~,~'~ :'; :" " " "• ........

: r? ~, ...,

IR+IHF -

~;'i :'~" / ...........

I-fully immune

pEM18 IR+IHF + /

i

•

i

-

i

•

i

•

II,I

I

•

II'll

I

.

.

.

.

.

;

I

'

I

"

I';

I

,

'T"2"."':

I

"

I

"

I

"

I

'

I

.

.

.

.

.

I

"

I

"

I

"

I

"

I

Position A c r o s s the Inverted Repeat

Figure 2. Effects of point mutations on target immunity. The cointegration frequencies generated using a target harboring a mutant IR are plotted logarithmically against the position of the mutation across the IR. The cointegration frequency into the positive control (pEM18, containing the 6 IR) and the negative control (pEM12), as well as a control without the [HF binding site (pEM19), are shown to the right of the graph. The symbols indicate the nucleotide identity of each point mutation as shown in the upper right corner; filled symbols indicate the mutations tested in transposition assays (see Figure 3). All of the point mutants isolated in the mutagenesis study were assayed as described in the text. Relative error in the lowest transposition frequencies into immune targets prohibits mutual comparison; these are plotted in the stippled region at the bottom of the graph and should all be considered equivalently immune. Any mutant plotted above this region may be considered to show a significantly reduced immunity. The positions where the protein crosses the major groove of the DNA (major groove contact regions, Wiater & Grindle}~ 1991) are shown as filled bars on the x-axis and as the lightly shaded regions within the graph.

(see Figure 4). A gene for resistance to k a n a m y c i n (Km') was b o u n d e d b y identical m u t a n t IRs w i t h their associated I H F b i n d i n g sites; o t h e r w i s e the replicon w a s identical to the target in the i m m u n i t y assays. The m a t i n g - o u t assay for t r a n s p o s i t i o n w a s essentially the s a m e as for the i m m u n i t y assay, The mobilization of the m a r k e r on the non-transferable replicon w a s assayed, b u t in this case, the direction of t r a n s p o s i t i o n w a s f r o m the m u l t i - c o p y p l a s m i d to the transferable replicon, using t r a n s p o s a s e p r o t e i n p r o v i d e d in trans.

T h e data are s h o w n graphically in Figure 3. All e x p e r i m e n t s w e r e r e p e a t e d at least three times, a n d on average six times. T h e w i l d - t y p e t r a n s p o s o n on pEM171 t r a n s p o s e d at a f r e q u e n c y of 4.9 x 10-', w h i l e a d o n o r p l a s m i d c a r r y i n g a Krn r gene not flanked b y 78 ends, pEM169, w a s m o b i l i z e d at a f r e q u e n c y of o n l y 9.1 x 10-L These t r a n s p o s i t i o n frequencies are m u c h h i g h e r t h a n those r e p o r t e d in the i m m u n i t y assays. We attribute this difference to the location of the t r a n s p o s o n on a m u l t i - c o p y (pUC119-derived) p l a s m i d , rather t h a n the single

Table 1 Transposition frequencies into immune and non-immune target plasmids within the same cell Target replicon pEM12 pEM18 pKD56 pEM12 + pKD56 pEM18 + pKD56 Mobilization of Cm" 4 x 10-3 1 x 10-6 -6 x 10-3 2 x 10"~ Mobilization of Tc" --1 x 10-3 2 x 10-3 2 x 10-3 An E. coli strain containing the transposon donor plasmid, pEM100, and additional target plasmids (singly or in combination) as indicated, was mated with 14R525 and frequencies of transfer of the relevant antibiotic resistances were determined. See Materials and Methods and the text for further details. • Cm' is the target antibiotic resistance marker carried by pEM12 and pEM18. b TC' is the target antibiotic resistance marker carried by pKD56.

The Inverted Repeat of the 76 Transposon

582

10 0

&

&

z~

..

: A

0

" a....

..... 0

a:

[] ~

: . ::

n

a i

o:,

IR+IHF

-

IR+IHF +

a

::*

10.1

-I

a

:

::

.

.

.

.

.

.

r;

O"

LL

t0

10 "2

..............

• .:~:,....:

........

or) 0 Q.. ~

•

10 -3

..............

.........

:..,:.,,..

........

~

i:'

F--

..:

........

i)- .........

i :.: !--: .........

..... []

;

[]

10-4

. :

"I

"

"I

"|'I

'I'I

~

:: . I ' I ' I ' I

I "I

" I ' | ' I

I'I

'I

"I

"I

i

IR- IHF -

Position Across the Inverted Repeat

Figure 3. Effects of mutant IRs on transposition. Frequencies of transposition were determined for transposons with identical mutant ends (plus the correctly spaced IHF binding site). Cointegration frequencies are plotted logarithmically against the position of the mutation across the IR. Only a representative subset of the point mutations isolated were assayed. Symbols indicating the nucleotide identity of each point mutation are shown to the right. The controls also are plotted to the right: the transposon in pEM171 is bounded by 2 8 ends and IHF-binding sites; pEM267 contains 8 ends, but no IHF-bhldhlg sites; pEM169 has neither IRs nor IHF-binding sites. The 4 circled data points indicate transposition frequencies for mutant transposons that have had their IHF-binding sites deleted.

copy derivative of pOX38 used in the immunity assays. As competition for limiting transposase protein is not an issue, all of these transposons have the potential to transpose, increasing the overall transposition frequency; in addition, the plasmid (pEM190) is likely to provide more available target DNA than the pEM16 derivatives. Once again, the assay has a greater than 1000-fold difference between the positive and negative controls. All the data from the mutant ends lie between these two extremes. At only four positions did mutations dramatically affect the transposition efficienc~ Mutations at positions G1, G2 and G3 abolished transposition, indicating a domain important for transposition but not for immunitj¢ A mutation at C32 also drastically reduced transposition efficienc~ A few of the mutants produced a slight drop in transposition frequenc~ A mutation at G4 had a small (6-fold) effect, most likely due to its proximity to the essential G1 to 3 region. Mutations at G l l , A21 and G33 also showed weak effects (4, 6 and 8-fold, respectively). These three mutations are located within major groove contact regions (MGCRs), so were expected to affect the ability of the transposase protein to bind the IR. However, these conclusions are weak due to the uncertainty in these data. We were surprised that mutations that had such strong effects on immunity had such weak (or non-existent) effects on transposition, and wondered whether the cooperative binding between IHF and transposase (Wiater & Grindle34 1990a) might mask the deleterious defect of a single point mutation. To

test this hypothesis, we constructed new transposons, deleting the IHF binding sites from the wild-type and four mutant transposons, and then determined transposition frequencies. One mutant was chosen to represent each of the three MGCRs (G11 C, G19T and G29C), while the innermost minor groove contact was represented by A36C. Each of these mutant IRs with an adjacent IHF binding site failed to confer immunity, yet exhibited at most only a modest effect on transposition. As we have noted before, the wild-type transposon transposed equally well with or without the IHF binding sites (Wiater & Grindle~ 1990a). However, deletion of the IHF binding sites from transposons constructed with G11C, G19T or A36C mutations caused a marked reduction in transposition frequency (Figure 3, circled data points). A transposon containing G29C mutations did not show a significant drop in transposition frequency upon deletion of the IHF site (although three base-pairs awa)4 the C32A mutation caused a drastic effect on transposition frequenc)4 even with the adjacent IHF binding site). Discussion

We have investigated the interactions of y8 transposase with its cognate transposon end by determining the effects of a library of IR mutants on transposition and transposition immunity The immunity data in Figure 1 correlate very well with known information about the binding of ~,~ transposase to the wild-type IR. Wiater & Grindley (1991) demonstrated, through hydroxyl radical foot-

The Inverted Repeat of the ?6 Transposon

printing and methylation interference studies, that transposase lies along one face of the DNA, crossing, and presumably making contacts within, three consecutive major grooves. Nearly all of the mutants exhibiting strongly reduced immunity have point mutations located within these MGCRs. Although no in vitro binding data were obtained using mutant IRs, the methylation data of Wiater & Grindley (1991) may be used to compare and contrast the binding of transposase protein to the wild-type IR with the effects of base changes on immunity. Methylation of each of the guanines at positions 11, 14, 19, 22, 29 and 32 strongly inhibited the binding of transposase. With the exception of position 14, point mutations at these positions greatly decreased the immunity conferred by the IR, suggesting that critical sequence-specific binding contacts are provided by these base-pairs. Although transversions at G29 had a large effect, the G29A transition only mildly affected immunit~ suggesting that the N 7 of guanine, conserved in the transition and the target of methylation, may be contacted by the transposase. Only one mutation was isolated at position 14, the C14T transition which also conserves the position of the purine NL Perhaps transposase contacts the N 7 of position 14, and transversion mutations at this position would be detrimental to immunity Weaker inhibition of binding resulted from guanine-methylation at positions 10, 12, 13 and 18; base substitutions at those positions had minimal effects on immunity Together, these data suggest that any binding contacts provided by these positions are much less critical. This is of some interest, since three of these positions (10, 12 and 13) are included in the seven that must distinguish ~/6 from Tn3 IRs. All the remaining G-C pairs (1 to 4, 8, 22, 28, 33 and 38) were neutral in the methylation interface assa)4 and only one of these (G33) is within an MGCR. Mutations at position 33 (particularly G33A) had a strong effect on immunity. An explanation for this apparent discrepancy is that contact with the G.C pair at position 33 involves the amine group of cytosine or the keto group of guanine, but not the N 7 of the purine. In addition to the major groove contacts, there are indications of minor groove contacts among the other non-immune mutants. The innermost of these potential minor groove contacts, A36, follows the rules for DNA recognition in the minor groove as laid out by Seeman et al. (1976): the transversion mutation, A36T, does not affect immunity, while the other transversion mutation, A36C, does. In addition, methylation of A36 (at position N 3 in the minor groove) inhibited transposase binding (Wiater & GrindleN 1991). The deviation of the other supposed minor groove contacts (i.e. at T17 and A25) from these rules suggests that these base-pairs are not directly recognized by transposase, but rather that these mutations act indirectly by altering the local conformation or flexibility of the DNA. The immunity data shown in Figure 1 exhibit an intriguing and unexpected positional gradient that implies that the inner portion of the IR contains the

583

most critical contacts for establishing immunity Considering each of the three MGCRs, the innermost (base-pairs 29 to 33) contained the highest number of the most deleterious mutations and the smallest number of the neutral mutations (only one). By contrast, more than half the mutations within the outermost MGCR (base-pairs 9 to 14) had no effect on immunit~¢ and the remainder showed less severe effects. The central MGCR lies between these two extremes. One possible explanation is that the majority of the most important binding contacts are clustered within the innermost MGCR. However, the relatively equivalent contributions of the three MGCRs observed in the methylation interference studies (Wiater & Grindle~ 1991) would suggest this may not be the case. Alternativel)4 high occupancy of the IR by transposase protein may not be sufficient to confer immunity on a target plasmid; perhaps contacts with the innermost portion of the DNA binding site are required for formation of an immunity proficient conformation of transposase. Such an additional requirement for immunity is consistent with the phenotype caused by the G29C mutation; this substitution has a strong effect on immunit)~ yet little or no effect on transposition (even when transposition was assayed on ends lacking the adjacent IHF binding site; see below). Comparison of the immunity and transposition data indicates that immunity is far more sensitive to mutation than transposition. Although the mechanism that brings about transposition immunity is not understood, it is apparent from these and previous data that the binding of transposase protein to the inverted repeat is an integral part. It is clear that transposition is also dependent upon the binding of transposase. Wh}~ then, are there so many point mutations that disrupt immunity but have little or no effect on transposition? Regardless of the subsequent steps in immunit)~ occupancy of the transposase binding site on the target (the IR) is expected to be far more critical for immunity than for transposition. If a target is immune for only 50% of the time, then it will not appear to be immune at all. However, 50% occupancy would be expected to have a negligible effect on transposition. Whereas binding of transposase to the IRs during the early stages of transposition may be immediately followed by synapsis of the two IRs and subsequent steps of the reaction, in most models of immunit)~ one would expect the binding of transposase to the IR located on the target to be required at all times to fully effect immunity Alternativel~ binding of transposase may not be rate-limiting for transposition, but may be so for immunity The synapsis of the two IRs of a transposon may cooperatively aid in the formation of the transpososome, masking the minor deficiency of a point mutation that interferes with immunity Taken together, the immunity and transposition data suggest there are at least three classes of positions within the terminal 38 base-pairs of 3'6: those that are spacers between important regions, but at which sequence is unimportant (either for immunity or for transposition), those that are not

584

involved in the stable binding of transposase (i.e. in establishing immunity), but are nevertheless required for transposition, and those important for binding specificity (and therefore for both immunity and transposition). There are at least three positions (5, 6 and 7) for which sequence is unimportant, and perhaps as many as 13. (At positions 10, 12, 23, 24, 26, 27, 28, 34, 35 and 37, the available mutants had a wild-type phenotype, but not all substitutions were obtained, and in many cases transposition was not assayed.) It is, perhaps, surprising that both ends of y8 (identical in sequence for the first 35 base-pairs) maintain sequence identity at all these positions. The second class of positions--those involved in a step in transposition distinct from binding of transposase include the four terminal base-pairs. Their proximity to the reactive site during transposition suggests that these base-pairs are important for identification of the scissile phosphodiester bond, or for catalysis of the subsequent DNA cleavage and target-joining events that accompany transposition. The mild effect of mutations at G4 suggests this position marks the end of this important domain. The remaining 20 or so positions, lying in the region between G8 and G38, presumably play some role, direct or indirect, in sequence-specific recognition by transposase. At each of these positions, one or more mutations affected immunit34 and, as noted at the beginning of the Discussion, these effects parallel the effects of guanine methylation on transposase binding. Unexpectedl3~ mutations at only one position within this region, C32, resulted in a dramatic reduction of transposition. However, for three mutant IRs (G11C, G19T and A36C) of just four tested, a defect in transposition was unmasked by deleting the IHF binding site adjacent to the IR. These data provided the first indication that IHF can enhance transposition in the y8 system. The most likely explanation for this is that cooperative interactions with IHF (Wiater & Grindle~; 1989) help transposase to bind to the mutant IRs sufficiently well to prevent the intrinsic binding deficiency from becoming rate-limiting in the transposition reaction pathwa}~ Alternative134 IHF binding may improve the quality of the transposase-IR interaction, and thus facilitate transposition. Two functional domains in the y8 inverted repeat have been defined by Wiater & Grindley (1990b, 1991), similar to those domains identified in the IRs of other transposons (Ichikawa et al., 1987; Derbyshire et al., 1987; Huisman et al., 1989). Our data confirm and extend these conclusions. The inner base-pairs, from approximately A9 in the outermost MGCR through to G38, represent positions important for initial transposase binding and perhaps subsequent steps in the reaction. The innermost MGCR, from G29 to G33, is the most critical for immunity (and perhaps transposition), and may be labeled an important subdomain. The outer four base-pairs, G1 to G4, constitute a domain not critical for transposase binding, yet essential for the complete transposition process; these four positions

The Inverted Repeat of the 76 Transposon

are conserved in all known members of the Tn3 family of transposable elements. The ends of Tn3 differ from the 8 end of y8 at only seven of 38 positions (see Figure 1B). One or more of these seven base-pairs must determine Tn3 or y8 specificit~ We have in our library five of the exact point mutations that mutate the y8 end toward the Tn3 sequence, and at the two remaining positions, we have other mutations. None of the T6C, G10C, G12C and C13T point mutations exhibited any effect of y8 immunit~ even though positions 10, 12 and 13 are located in the outermost MGCR. Thus, none of these four positions appears to play a major role in determining y8 identit~ The other change towards Tn3, G29T, has one of the strongest effects on y8 immunit34 suggesting that G29 is an important determinant of y8 identity The remaining two positions (16 and 30) are more ambiguous. The only point mutation isolated at position A16 has very little effect on y8 immunit~ suggesting that this position is not very important; however, it remains possible that a G (the Tn3 nucleotide) at position 16 would have a stronger effect. Position 30 is more likely to play an identifying role, since it is within the important inner MGCR and the mutation T30G has quite a strong effect on immunity; however, another mutation, T30A, has no effect, and we failed to isolate the informative mutation, T30C, with the change towards Tn3. Overall, it seems likely that G29 and T30 play a dominant role in enabling y6 transposase to distinguish y6 ends from those of Tn3. It would be interesting to see if y8 transposase could mobilize Tn3 ends with the T29G and C30T mutations. Comparison of our data with those from several studies of the Tn3 IR suggest that there may be significant differences in the way in which the homologous y8 and Tn3 transposases interact with their cognate IRs. Ohtsubo and his colleagues (Ichikawa et al., 1990; Amemura et al., 1990; Amemura-Maekawa et al., 1991) made double substitutions (G-C ~ T- A transversions) at adjacent base-pairs at ten evenly spaced locations (this leaves half the positions untouched, and does not allow one to determine the effects of single changes or different changes). Their data and conclusions are generally in agreement with ours. Substitutions at the extreme terminus of Tn3 (positions 1 and 2) eliminated transposition but left immunity unaffected. By contrast, mutations spanning the region between positions 13 and 38 generally had a strong effect on immunity (Amemura et al., 1990) but most caused only a modest reduction (two to threefold) in transposition frequency (reminiscent of our results). The single exception to this pattern was the mutation at positions 13 and 14, which caused a dramatic (>100-fold) reduction in transposition (AmemuraMaekawa et al., 1991). These data suggest that the binding contacts between Tn3 transposase and its cognate IR that are most critical for transposition lie within the outermost MGCR. Additional experiments looking at the effect of mutations that altered the Tn3 IR sequence towards that of y5 implicated base-pairs 12 and 13 as being particularly important

The Inverted Repeat of the ~,& Transposon

for specifying Tn3 identity (Ichikawa et al., 1990). As discussed above, the analogous regions in the y8 IR appears to play a much less critical role. Our data (Figure 1) suggest that position 11 is the only one within the outermost MGCR of the y8 IR that is of much importance in y8 transposase recognition. Fennewald and his colleagues also examined the effects of mutations within the Tn3 IR, and their data also s u p p o r t the idea that the Tn3 transposase recognizes its cognate IR, with rather different priorities (Nissley et al., 1990, 1991). These authors limited their s t u d y to the region b e t w e e n positions 18 and 38, characterizing single base substitutions at 11 of these positions. Thus, the importance of the outermost MGCR of Tn3 was not addressed. However, within the innermost MGCR, the mutation at position C32 (perhaps the most important position for ~/5 i m m u n i t y and transposition) had almost no effect on transposition, while the change at T34 (just b e y o n d this MGCR) ranked as one of the most deleterious to both i m m u n i t y and transposition (whereas the same mutation in ~/8 was without effect). Mutations at positions 29 and 30 (positions we suggest specify y8 identity but were not represented among the Ohtsubo collection of mutations) caused different phenotypes: T29G had very little effect (approximately threefold) on either transposition or immunit~ suggesting it does not play an important role in Tn3 identity (the reciprocal G29T mutation in the y8 IR had a severe effect on immunity). However, the C30T mutation showed more substantial effects, and, together with the A31G and G33A mutations, established the overall relevance of the innermost MGCR to the binding of Tn3 transposase. During the divergent evolution of Tn3 and ~/8 transposases and their cognate ends, it seems probable that as each transposase has lost a significant contact with its IR, it has compensated by establishing a new contact (or strengthening a weak contact) at a distinct site, resulting in a different but

585

overlapping hierarchy of contacts for the two transposases.

Materials and Methods Strains and plasmids Strains and plasmids are listed in Table 2. The conjugative plasmid used as the 78 transposon donor in the immunity assays was pEM100. It was constructed by selecting for transposition of a marked 18 derivative (IR-tnpA-res-tnpRa-Km'-IR) from pLAW45 (L. Wiater, Yale University) into a transposon-less derivative of the F factor, pOX38 (Guyer, 1981). pEM100 retains the tra ÷functions of pOX38; it was transferred by mating into NG135 (F- recA56 Str r) to create EMS21. The plasmid used to provide y5 transposase and conjugative functions in the transposition assay was pEM190. It was made by transposition onto pOX38 of a transposon that consists of the termini of IS903 flanking the y5 tnpA gene and the tetracycline resistance gene of pBR322 (the transposon contains neither the IS903 transposase gene nor y8 ends), pEM190 retains the full conjugational proficiency of pOX38, and was mated into NG135 to create EMS35. Vectors derived from pBR322, including pUC119 (Vieira & Messing, 1987), contain a Tn3 IR adjacent to the Apr gene. Although ?8 transposase does not appear to interact with Tn3 ends, we created derivatives of pUC119 with deletions of the Tn3 IR to avoid any unforeseen complications in our assays, pEM12 (see Table 2) is a derivative of pUC119, with the Ap ~ gene and accompanying Tn3 end replaced with a Cm' gene. It was constructed by ligating the large AhoNI-ScaI backbone fragment of pUC119 (blunt ends generated with $1 nuclease) with the Cm r gene-containing HincII fragment of pKD6 (from Keith Derbyshire, Yale University). pEM16 (Figures 1 and 4) is a derivative of pEM12 with an IHF binding site cloned into the polylinker region, and was constructed as follows: an oligodeoxynucleotide containing the IHF-binding site (from the 8 end of yS) flanked by HindIII and SphI overhangs was synthesized (5'- AGCTTCTGCAGTAA ATTTAAATATAAACAACGAATTGCATG-3'), and ligated as a single strand between the

Table 2

Strains and A Strahls 14R525 EMS21 EMS35

plasmids ~/pe Nalr prototroph Strr recA- harboring pEM100 Strr recA- harboring pEM190

B

Plasmid Origin Resistance Notes pEM12 pUC119 Cm Negative control for immunity assays pEM16 pUC119 Cm Contains an IHF binding site pEM18 pUC119 Cm Contains an IHF binding site and a 5 end pEM19 pUC119 Cm Contains a 5 end pEM100 pOX38 (Kin) F-derivative, tra ~, contains a mini-75: (Km', tnpA ÷, tnpR-) pEM169 pUC119 Cm, Km Negative control for transposition assays pEM171 pUC119 Cm, (Km) Km' bounded by IHF binding sites and 5 ends pEM190 pOX38 Tc F-derivative, tra*, tnpA" pEM267 pUC119 Cm, (Km) pEM171 with IHF binding sites deleted pKD56 pACYC184 Tc Second target for transposase titration experiments Strains used are derivatives of Escherichia coli K12. See Materials and Methods for details. Cm and Tc indicate plasmid-encoded resistance to chloramphenicoland tetracycline,respectively;(Kin)indicates transposon-encoded resistance to kanamycin. Plasmids with mutant ends used as targets in the immunity assays are isostructural to pEM18. Mutant transposons with IHF binding sites are isostructural to pEM171, while those without IHF sites are isostructural to pEM267.

The Inverted Repeat of the 76 Transposon

586

A

HinII/Scay I ~

S p h

I ~Hind III

Cm'l pEM171 J HinII/AIwNI

ori C

~Sphl

,(

I -r

Cm~ S p h

I

oH Figure 4. Structures of relevant plasmids. Heavy lines, segments derived from the vector pUC119; ori, plasmid replication origin; CmS gene for resistance to chloramphenicol; KInD gene for resistance to kanamycin. Restriction enzyme cleavage sites used for plasmid construction are as shown. Arrowhead, 8 end synthetic sequence; black bar, IHF binding site. For further details see Materials and Methods.

SphI and HindIIl sites of pEM12. To generate pEM19 (see Table 2), a plasmid with a wild-type 8 end but no IHF-binding site, the IR-containing SphI-NcoI fragment of pEM18 (see Results) was ligated to the origin-containing SphI-Ncol fragment of pEM12.

Construction of the mutant library Following the method developed by Derbyshire et al. (1986), a pool of oligodeoxynucleotides, consisting of the sequence of the 8 IR flanked by XbaI and SphI 5' and 3' overhangs (see Figure 1A), was generated by doping each of the deoxynucleotide reservoirs of an 8600 DNA synthesizer (Biosearch) with a mix of all four deoxynucleotides (to 3% of the total nucleotide concentration in each well). This concentration was designed to maximize single base substitutions and slightly favor double mutations over zero mutations. The oligodeoxynucleotide pool was phosphorylated, then ligated (still as a single strand) between the XbaI and SphI sites of pEM16. The ligation mixture was electroporated into JM101. Individual Cm' colonies were re-streaked to reduce the chance of doubly transformed cells. Single-stranded DNA was prepared and sequenced by the dideoxy method (Sanger et al., 1977) to generate the library of point mutations. About one third of the sequences were wild-type (equivalent to pEM18).

Construction of mutant transposons The mutant ends were excised from the polylinker as

BamHI-PstI and HindlII-XbaI fragments. In a four-way ligation (see pEM171 in Figure 4), these IR-containing fragments were combined with the Km' gene of IS903 on a dephosphorylated PstI-HindlII fragment from pKD44 (from Keith Derbyshire) and the origin-containing dephosphorylated XbaI-BamHI fragment of pEM12. Both ends of each new transposon were verified by doublestranded sequencing using the Sequenase TM protocol of

United States Biochemical Corp. To construct transposons without IHF binding sites, the backbone SphI fragment of the parental transposon-containing plasmid was ligated to a fragment containing the Kin' gene on SphI linkers (see pEM267 in Figure 4 and legend).

Transposition assays A mating-out assay was used to determine transposition frequencies in vivo. For the immunity assay; EMS21 was transformed with a target plasmid harboring a wild type, mutant, or no IR. Three colonies from each transformation were grown overnight at 37°C in L Broth containing chloramphenicol. Dilutions (1/20) of these cultures were grown to mid-log, in the presence of chloramphenicol. A 0.9 1111sample of recipient strain 14R525 (grown to mid-log from a fresh overnight culture) was mixed with 0.1 ml of donor cells and incubated without agitation at 37°C for two to three hours. The cells were vortexed for 15 seconds to disrupt the mating complexes. Serial dilutions of each mating mixture was plated onto selective media selecting for donor cells (streptomycin), recipient cells (nalidixic acid), transconjugants (kanamycin/nalidixic acid), and transposition events (chloramphenicol/nalidixic acid). The Str' colonies were replica plated onto chloramphenicol to assay for target plasmid maintenance. This ratio was used as a correction factor (c) in the calculation of transposition frequency: Tn frequency

Total transposition events = Total transconjugants x 1/c"

The relationship between the calculated transposition frequency and immunity is reciprocal: the higher the transposition frequency; the higher the usage of the target plasmid by the transposon on pEM100, and thus the lower the immunity conferred by the IR present on the target. Transposition assays of mutant transposons w e r e conducted in a similar fashion. EMS35 was transformed with each transposon-containing plasmid (pEM171 and its mutant relatives). Transformants were grown and matings with 14R525 were conducted as with EMS21. Direction of transposition is opposite to that of the immunity assay: into the transferable plasmid, pEM190. Platings were done as in the immunity assay; but transconjugants were selected on tetracycline/nalidixic acid and transposition events were scored on kanamycin/nalidixic acid. Transposition frequencies were calculated as above. There was as much as a fivefold variation in the calculated transposition frequencies into any specific target. Experiments of this type inherently contain a twoto threefold error, and we attribute the still higher error to the relative instability of the target plasmid in EMS21. Presumably; if a cointegration event occurs, the target plasmid will be stabilized in the cell by the origin of the F-derivative plasmid. Thus, in a chloramphenicol-containing environment, the harboring cell will outgrow other cells in which the target plasmid may have been lost. An additional source of error was encountered when measuring the transposition frequency into highly immune plasmids. These comput~qtions involved a small number of colonies on the selective plates, and often a zero had to be incorporated into the calculations. Although the error in these numbers is relatively large, as high as fiveto tenfold, the conclusions drawn from the data are based on logarithmic differences in transposition frequencies, and are thus reliable.

The Inverted Repeat of the 1,5 Transposon Other methods and reagents

Unless otherwise noted, all molecular and genetic protocols were from Maniatis et al. (1982). Restriction enzymes, polynucleotide kinase, and calf alkaline phosphatase were purchased from either New England Biolabs or Boehringer-Mannheim, and were used as recommended.

Acknowledgements We are most grateful to Drs Keith Derbyshire and Graham Hatfull for their help in the development of the experimental techniques used in this work. We thank Drs Keith Derbyshire, Vicky Derbyshire, Joan Mazzarelli, Bob Hughes, Cathy Joyce and Xaiojun Sun for helpful discussions and suggestions. Thanks to Kate Tatham for help in preparation of the manuscript. This work was supported by a grant from the National Institutes of Health (USPHS GM28470).

References Amemura, J., Ichikawa, H. & Ohtsubo, E. (1990). Tn3 transposition immunity is conferred by the transposase-binding domain in the terminal inverted repeat sequence of Tn3. Gene, 88, 21-24. Amemura-Maekawa, J. & Ohtsubo, E. (1991). Functional analysis of the two domains in the terminal inverted repeat sequence required for transposition of Tn3. Gene, 103, 11-16. Arciszewska, L. K., Drake, D. & Craig, N. L. (1989). Transposon Tn7: cis-acting sequences in transposition and transposition immunity. J. Mol. Biol. 207, 35-52. Darzins, A., Kent, N. E., Buckwalter, M. S. & Casadaban, M. J. (1988). Bacteriophage Mu sites required for transposition immunity. Proc. Nat. Acad. Sci., U.S.A. 85, 6826-6830. Derbyshire, K. M., Salvo, J. J. & Grindle~ N. D. F. (1986). A simple and efficient procedure for saturation mutagenesis using mixed oligonucleotides. Gene, 46, 145-152. Derbyshire, K. M., Hwang, L. & Grindle34 N. D. F. (1987). Genetic analysis of the interaction of the insertion sequence IS903 transposase with its terminal inverted repeats. Proc. Nat. Acad. Sci., U.S.A. 84, 8049-8053. Fennewald, M. A., Gerrard, S. P., Chou, J., Casadaban, M. J. & Cozzarelli, N. R. (1981). Purification of the Tn3 transposase and analysis of its binding to DNA. J. Biol. Chem. 256, 4687-4690. Friedman, D. I. (1988). Integration host factor, a protein for all reasons. Call, 55, 545-554. Goto, N., Mochizuki, A., Inagaki, Y., Horiuchi, S., Tanaka, T. & Nakaya, R. (1987). Identification of the DNA

587

sequences required for transposition immunity of the y8 sequence. J. Bacteriol. 169, 4388--4390. Guyer, M. S. (1981). Identification of a sex-factor affinity site in E. coli as 78. Cold Spring Harbor Syrup. Quant. Biol. 45, 135-140. Huisman, O., Errada, P. R., Signon, L. & Kleckner, N. (1989). Mutational analysis of IS10's outside end. EMBO ]. 8, 2101-2109. Ichikawa, H., Ikeda, K., Wishart, W. L. & Ohtsubo, E. (1987). Specific binding of transposase to terminal inverted repeats of transposable element Tn3. Proc. Nat. Acad. Sci., U.S.A. 84, 8220-8224. Ichikawa, H., Ikeda, K., Amemura, J. & Ohtsubo, E. (1990). Two domains in the terminal inverted repeat sequence of transposon Tn3. Gene, 86, 11-17. Kans, J. A. & Casadaban, M. J. (1989). Nucleotide sequence required for Tn3 transposition immunity J. Bacteriol. 171, 1904-1914. Lee, C., Bhagwat, A. & Heffron, F. (1983). Identification of a transposon Tn3 sequence required for transposition immunity. Proc. Nat. Acad. Sci., U.S.A. 80, 6765-6769. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Nissle~ D. V., Lindh, F. G. & Fennewald, M. A. (1990). Mutational analysis of the inverted repeats of Tn3. J. Mol. Biol. 213, 671-676. Nissle}¢ D. V., Lindh, F. G. & Fennewald, M. A. (1991). Mutations in tile inverted repeats of Tn3 affect binding of transposase and transposition immunity. J. Mol. Biol. 218, 335-347. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci., U.S.A. 74, 5463-5467. Seeman, N. C., Rosenberg, J. M. & Rich, A. (1976). Sequence-specific recognition of soluble helical nucleic acids by proteins. Proc. Nat. Acad. Sci., U.S.A. 73, 804-808. Sherratt, D. (1989). Tn3 and related transposable elements, site-specific recombination and transposition. In Mobile DNA (Berg, D. E. & Howe, M. M. eds), pp. 163-184, American Society for Microbiolog3~ Washington, DC. Vieira, J. and Messing, J. (1987). Production of single stranded plasmid DNA. Methods Enzymol. 153, 3-11. Wiater, L. A. & Grindle34 N. D. F. (1988). t8 transposase and integration host factor bind cooperatively at both ends of yS. EMBO J. 7, 1907-1911. Wiater, L. A. & Grindle~; N. D. F. (1990a). Integration host factor increases the transpositional immunity conferred by y8 ends. J. Bacteriol. 172, 4951-4958. Wiater, L. A. & Grindle~ N. D. F. (1990b). Uncoupling transpositional immunity from y8 transposition by a mutation at the end of 78. J. Bacteriol. 172, 4959-4963. Wiater, L. A. & Grindle~ N. D. F. (1991). y8 transposase: purification and analysis of its interaction with a transposon end. J. Biol. Chem. 266, 1841-1849. Edited by Max G o t t e s m a n

(Received 13 July 1994; accepted 16 January 1995)