- Email: [email protected]
A hammerhead ribozyme inhibits ADE1 gene expression in yeast
Gene, 155 (1995) 45 50 ©1995 Elsevier Science B.V. All rights reserved. 0378-1119/95/$09.50
45
GENE 08680
A hammerhead ribozyme inhibits ADE1 gene expression in yeast (RNA catalysis; in vivo activity; Saccharomyces; PCR; mRNA cleavage)
Gerardo Ferbeyre*, John Bratty, Hui Chen and Robert Cedergren Dkpartement de biochimie, Universi@ de Montr4al, Montr4al, Qukbec H3C 3J7, Canada
Received by M. Belfort: 10 December 1993; Revised/Accepted: 31 August/13 October 1994; Received at publishers: 2 December 1994
SUMMARY
To study factors that affect in vivo ribozyme (Rz) activity, a model system has been deviSed in Saccharomyces cerevisiae based on the inhibition of A D E I gene expression. This gene was chosen because Rz action can be evaluated visually by the Red phenotype produced when the activity of the gene product is inhibited. Different plasmid constructs allowed the expression of the Rz either in cis or in trans with respect to ADEI. Rz-related inhibition of A D E I expression was correlated with a Red phenotype and a diminution of ADE1 mRNA levels only when the Rz gene was linked 5' to ADE1. The presence of the expected 3' cleavage fragment was demonstrated using a technique combining RNA ligation and PCR. This yeast system and detection technique are suited to the investigation of general factors affecting Rz-catalyzed inhibition of gene expression under in vivo conditions.
INTRODUCTION
Studies of gene expression inhibition, first using antisense nucleic acids (Izant and Weintraub, 1984) have now turned toward the use of catalytic RNAs, ribozymes (Rz), with the hope of producing greater and more specific effects (Rossi, 1992). Among Rz, the catalytic hammerhead RNA domain (Hh) has been a favourite tool for gene inhibition (Cotten and Birnstiel, 1989; Sarver et al., Correspondence to: Dr. R. Cedergren, D6partement de biochimie, Universit6 de Montr6al, Montr6al, Quebec H3C 3J7, Canada. Tel. (1-514) 343-6320; Fax (1-514) 343-2210; e-mail: [email protected] *Permanent address: Centro de Ingenieria Gen6tica y Biotecnologia, La Habana, Cuba. Tel. (53-7) 201-401.
Abbreviations: A, absorbance (1 cm); ADEI, gene involved in purine biosynthesis encoding SAICAR (N-succinyl-5-aminoimidazole-4carbox-amide ribotide) synthetase; bp, base pair(s); BSA, bovine serum albumin; CAIR, 4-carboxy-5-aminoimidazole ribotide; G5C and G8C, guanosine in position 5 or 8 replaced by cytidine; Hh, hammerhead RNA domain; kb, kilobase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PAGE, polyacrylamide-gel electrophoresis; PCR, polymerase chain reaction; Rz, ribozyme(s); Rz, gene (DNA) encoding Rz; TCA, trichloroacetic acid; u, unit(s); wt, wild type. SSDI 0378-1119(94)00891-4
1990; Sioud and Drlica, 1991; Koizumi et al., 1992; Steinecke et al., 1992). The only sequence requirement for cleavage of a target RNA by the Hh Rz is the presence of one of the following triplets: GUC, CUA, GUU, UUC, or CUC (Haseloff and Gerlach, 1988; Perriman et al., 1992). However, the fact that the Rz is less efficient in vivo than in vitro demonstrates that other (cellular) factors influence cleavage in vivo. In order to create a simple model in yeast to study in vivo factors, we have devised a system based on the effect of a Hh Rz on the expression of the A D E I gene. This gene codes for the enzyme N-succinyl-5-aminoimidazole4-carboxamide ribotide (SAICAR) synthetase (EC 6.3.2.6) which is required for de novo purine biosynthesis (Myasnikov et al., 1991). Yeast strains lacking this gene product develop a Red phenotype (Mortimer and Hawthorne, 1969), whose intensity can be correlated to gene expression levels (Hieter et al., 1985). We report here that Rz designed to cleave the ADE1 mRNA in cis can reproduce the Red phenotype of yeast adel mutants and bring about a reduction in the levels of ADE1 mRNA. Furthermore, the 3' product of Rz cleavage in vivo can be detected by RNA ligation-dependent PCR.
46 RESULTS AND DISCUSSION
Ai
Substrate
~f
5 ' - A A C G A U A A , ~ ' U C AAUUACG - 3 ' - UUACA UUAAU A C o, A GS . ~ , C (m.~Y) G A
Ribozyme
GCAGSO C (mxx)
AU CG A
G
GU
B. YEpGA
YEpGADE ~
ADE1 ( TADH,[
Fig. 1. The Hh Rz designed to cleave the ADE1 mRNA. (A) Secondary structure of the Hh Rz. The Rz structure as described by Haseloff and Gerlach (1988) containing two 5-bp flanking helices. The positions are indicated where G8C and G5C transversions were made. The AUG triplet is underlined. (B) Expression vectors, ADE1, SAICAR synthetase-encoding gene; P6~AL1,GALl promoter; TADM1, ADHI terminator; Hh, Hhx and Hhy, wt Rz, the GSC and the G5C mutant Rz, respectively. Methods: Constructions were made as described by Sambrook et al. (1989). The Klenow fragment of DNA polymerase I, as well as T7 DNA polymerase were obtained from Pharmacia. All other enzymes were from New England Biolabs. Except as otherwise noted, all buffers were those recommended by the manufacturers of the enzymes. The ADE1 gene was amplified from total yeast DNA by PCR, using the following primers designed according to the sequence published by Myasnikov et al. (1991): oligo X, 5'-CCATCGATTTTATCTTTTGCAGTTGGTA, oligo Y, 5'-GGAATTCAAAGATATCGATAAAA and oligo Z 5'CACGTTAGTGAGACCATTATG and cloned into the ClaI site of pBluescript SK- to give pKSADE, (oligos X and Y) and pNADE (oligos X and Z). Rz were obtained by cloning a single-stranded oligo (oligo R, 5'-TCGATAATGTTTCGTCCTCACGGACTCATCAGAATTAGGCC) in which nt 27 (corresponding to Rz position 8 (Hertel et al., 1992)) was made as a mixture ofC (wt) and G (mutant) into pBluescript SK-digested with ApaI +XhoI (Mounts et al., 1989) to give pGF3 (wt) and pGF3x (G8C mutant). The sequences were confirmed by sequencing. The ADEI gene was then subcloned downstream from the EcoRV site, and the resulting plasmids were named phhADE and phhxADE. 3' fused Rz were obtained by subcloning the Rz from pGF3 and pGF3x, produced from KpnI-ClaI fragments whose termini were blunted, downstream from the ADE1 gene into the EcoRV site of pNADE. The resulting plasmids were named pADEhh and pADEhhx. The G5C control was constructed by PCR mutagenesis using as 5' primer the oligo 5'-GGGCCTAATTCTC_ATGAGTCCGTC and oligo Y as the 3' primer. The template was the Rz ADEI fusion in phhADE. The amplified band was subcloned into pUCI9 digested with BamHI and
(a) Targeting the yeast ADE1 gene The design of the R z gene sequences to inhibit SAICAR synthetase production in vivo involved consideration of the potential nucleotide (nt) triplet targets present in the ADE1 gene. The triplet _GGUC starting at the third nt of the AUG_ start codon was finally chosen because it is contained in a region thought to be accessible to transacting factors, i.e., antisense nucleic acids (Goodchild et al., 1988). In addition, many yeast genes have the consensus sequence A U G U C at the start codon (Cavener and Ray, 1991), so results from the use of this region as a target could be more easily generalized to other genes. Rz contained five nt complementary to the ADE1 mRNA on either side of the targeted G U C triplet (Fig. 1A). In order to establish that an eventual inhibition provoked by the Rz was due to a mechanism involving cleavage of the target mRNA, catalytically inactive mutants containing disabling G---,C transversions at nt position 5 (G5C) or 8 (G8C) of the catalytic core were used as controls (Ruffner et al., 1990). Rz activity was first studied in vitro by inserting R z and Rz-control sequences both upstream and downstream from the ADE1 gene carried by the pBluescript SK-derivatives pKSADE and pNADE. The ability to cleave the ADE1 mRNA was assessed by linearization of the plasmid and in vitro transcription with T7 RNA polymerase followed by analysis of the transcriptional products by PAGE. In these experiments, R z in both 5' and 3' orientations with respect to the ADE1 gene cleaved the target as expected (see section d); no cleavage was observed with the disabled mutants. (b) Inhibition of A D E I gene expression by Rz can be correlated with a Red phenotype Following demonstration of in vitro activity, both trans and cis-acting R z constructs were prepared for in vivo
Mung Bean nuclease to mimic the flanking regions of the previous constructions. The resulting plasmid was phhyADE. YEpGA, the parent plasmid of all the constructions used to express Rz in yeast, was made by cloning a 1.2-kb EcoRI-SalI fragment containing the GALl promoter fused to the ADHI terminator into the polylinker of YEplacl81, a LEU2-selectable 2g-based yeast-E, coli shuttle vector (Gietz and Sugino, 1988). A unique BamHI site found at the fusion junction of the promoter and terminator served to insert all test constructs after filling in the ends with the Klenow fragment of DNA polymerase I. Thus, YEpGADE contains the ADE1 gene from pKSADE, while YEphhADE, YEphhxADE (G8C mutant) and YEphhyADE (G5C mutant) harbour Rz-ADE1 fusions from phhADE, phhxADE and phhyADE. YEpADEhh, YEpADEhhx, YEpGALhh and YEpGALhhx were constructed as above but from pADEhh, pADEhhx, pGF3 and pGF3x respectively, pVTADE was obtained by cloning the ADEI gene into pVT100U, (Vernet et al., 1987).
47 experiments. For the trans arrangement, we introduced plasmids encoding Rz targeted against the ADE1 mRNA transcribed from the chromosomal gene into strain DG920 (a, leu2, ura3, trpl, his3). For the cis model, the adel mutation carried by strain SC252 (a, ura3, adel, leu2) was complemented by transformation with a derivative of the 2g vector harbouring the wt ADE1 gene under the control of a galactose-inducible promoter (YEpGADE). Colonies of the SC252 mutant strain transformed with Y E p G A D E were red in adenine-limiting medium when glucose was the carbon source, but turned white when grown in the presence of galactose. We observed, however, that the adenine auxotrophy can be complemented even when the cells are grown on glucose, indicating that the small number of transcripts made even under repression are sufficient to cope with minimal cellular requirements. The Hh constructs from in vitro tests were subcloned into plasmid YEpGA under the control of the GALl promoter (see Fig. 1B) and were tested for inhibition of ADE1 gene expression in vivo by the observation of colony colour. When the active Rz was placed 5' to the ADE1 gene, complementation of the adel mutation was greatly reduced, since the colonies were red in galactosecontaining medium. However, the pink colour of cells harbouring either Rz mutant indicated partial inhibition of ADE1 gene expression. Nevertheless, an additional degree of inhibition is evident in the presence of the catalytically active Rz. This effect is not related to the A U G triplet present in the wt Rz because both mutants G5C and G8C showed the same partial phenotype even though G5C contains the A U G and G8C does not. Although the colony colour was a useful indication of Rz activity and for screening large numbers of clones, it did not provide a quantitative measure of the effect. To address this shortcoming, we developed an assay for the in vivo accumulation of the biosynthetic precursor 4-carboxy-5-aminoimidazole ribotide (CAIR), based on a modification of an in vitro method (Lukens and Flaks, 1963). The results of this assay confirm the increased accumulation of CAIR in cells containing the 5'-cis Rz relative to those carrying control Rz G5C and G8C (Fig. 2). The active 5'-cis Rz showed a n A S l S n m of 0.544--+0.072, the G8C control Rz 0.373-+0.074 and the G5C control Rz 0.388_+0.090 in this assay, compared to the values for the YEpGA and YEpGADE-containing strains of 0.651 and 0.104-+ 0.084, respectively. Thus, the active Rz-containing strain accumulates 80% as much excess CAIR as the strain containing no functional ADEI gene when both are compared to the strain bearing a fully functional ADE1 allele, while the G5C and G8C mutant Rz-containing strains accumulated 52 and 49% as much, respectively. Neither the Rz placed at the 3' end
ore"
0,6"
E_ 00
0,4"
0,2"
0~0" ~v
-lkTM
~v
~k*~
~v
,KP"
~v
kCO~"
Plasmid Fig. 2. Assay for CAIR accumulation in strains carrying plasmids YEpGA, YEpGADE, YEphhADE, YEphhxADE and YEphhyADE. Data are presented as average±S.D., n = 4 independent experiments except YEpGA, n = 1. The margins of error largely represent systematic variation between plates; measurement error is much lower (< +0.010) in this assay. Methods: Yeast strains bearing the above plasmids were grown up on a synthetic minimal medium plate containing 2% galactose/5 rtg adenine/20 ~tg uracil per ml. After incubation for 5-6 days, cells were scraped up off the plates and resuspended in water to a n A 6 o 0 nrn of 10. A sample of 700 ~tl of this solution was vortexed four times for 1 min in the presence of glass beads and 200 ~tl of chloroform. From the resulting supernatant 600 lal were transferred to new tubes and 100 Ixl of 30% TCA added to each. After a 10-min centrifugation, 600 ~tl of supernatant were recovered and mixed with 225 ~tl 0.2 M HC1. Immediately, 75 pl 0.1% NaNO2 was added and the tubes incubated for 5 min at room temperature. Then, 75 ~tl 0.5% ammonium sulfamate (NH4SO3NH2) was added and the incubation continued for 3 min. Finally, 75 pl 0.1% N-l-naphthyl)ethylene diamine dihydrochloride was added. After a further 10-min incubation, the As18 nm of the solutions were measured.
of the gene (see Fig. 1B) nor the Hh targeted to the chromosomal gene as a trans-acting Rz in a wt strain for purine biosynthesis was able to produce the colour phenotype. The trans Rz was also ineffective when expressed in the adel mutant strain complemented with pVTADE, an ARSl-based plasmid that allowed expression of the ADE1 gene under the control of the alcohol dehydrogenase promoter. Quantitative dot blot hybridization indicated that the trans Hh Rz was expressed to a level of about 0.05% of the total yeast RNA, which represents a level of expression comparable in molar terms to the levels achieved previously for the ADEI gene, as well as for other mRNAs expressed under GALl promoter control (St. John and Davis, 1981). Several explanations are plausible for the failure of the trans-acting catalytic RNAs: (i) The level of Rz may be insufficient (Sioud and Drlica, 1991; Steinecke et al., 1992), since mRNA destruction may need to be considerable before a phenotypic effect can be observed. (ii) Differences in RNA metabolism between yeast and higher
48 eukaryotes where active trans-acting Rz have been found (Cotten and Birnstiel, 1989; Sarver et al., 1990; Koizumi et al., 1992; Steinecke et al., 1992) may be responsible for lower efficiencies in yeast. (iii) RNA-binding proteins (Dreyfuss et al. 1986), strong secondary structures or different intracellular locations may affect the ability of the Rz to find its target more in yeast than in other cell types. In particular, the accessibility of the 5' region of the ADE1 gene used as a target in our experiments is unknown. It is even conceivable that cleavage can only occur during transcription. In this case, the 5' Hh would be active only as long as the target was free of proteins and cleavage would be completely inhibited in the case of either the 3' Hh construction or the trans-acting Rz.
(c) Evidence of Rz-mediated mRNA cleavage in vivo If the reduction in ADE1 gene expression observed in our colony colour assay is due to RNA cleavage, then the levels of ADE1 mRNA should be correspondingly reduced. Fig. 3 shows that only the strain expressing the Hh Rz 5' to the ADE1 gene had an important reduction in mRNA levels, (twofold according to densitometric
analysis). could be the rapid trans nor
No evidence of the specific cleavage products observed however, which may be indicative of metabolism of mRNA fragments. Neither the the 3' linked Rz reduced ADE1 mRNA levels.
(d) Detection of cleavage products by RNA-ligationdependent PCR Since cleavage products could not be directly observed in the previous experiments, additional evidence of Rz action was desirable. To that end, a technique was adapted that makes use of PCR to amplify selectively the 3' cleavage product of Rz action (see Fig. 4). In the first step of the procedure 5'-phosphorylation is performed on
intactmRNA GpppG degradedRNA HO. . . . . specificcleavageproduct HO . . . . . . . Phosphorylate1 GpppG
1
2
3
4 l
AddRNAlinker~ V
ADE 1
GpppG
wW
MakecDNAcopy / PCR
ACTIN
GpppG Fig. 3. Northern analysis of ADE1 mRNA from cells expressing Rz in cis directed against the ADE1 mRNA. Lanes: 1, YEpGADE, 2, YEphhADE, 3, YEphhxADE, 4, YEphhyADE. Each lane contains 5 p.g of total RNA purified from cells. Upper: hybridization with ADE1 probe. Lower: re-hybridization of the membrane shown above with actin probe to establish relative amounts of RNA in each lane. Yeast expression vectors were introduced into the cells by electroporation (Becker and Guarente, 1991) and transformants were selected on medium lacking leucine for the YEpGA-derived plasmids or uracil for pVTADE (Sherman et al., 1986). Yeast cells were cultured first in glucose-containing medium, harvested by centrifugation and recultured in galactose-containing medium for induction. RNA was isolated according to Sherman et al. (1986) and separated on 2.2 M formaldehyde-l% agarose gels (Sambrook et al., 1989). After transfer to Hybond-N nylon membranes (Amersham), the RNA was hybridized overnight at 65"C to 3~P-labelled probes in 7% SDS/0.25 M NazHPO 4 pH 7.4/1% BSA. The membranes were washed twice at 6Y'C in 2 × SSC/0.1% SDS for 20 min, and once at 65cC in 0.2×SSC/0.1% SDS, ( S S C - 0 . 1 5 M NaCI/0.05 M Na3"citrate pH 7.6). Probes were prepared using the T7 Quickprime kit (Pharmacia) from the PCR-amplified 1.1-kb ADEI gene or from a l.l-kb PCR-amplified fragment from exon 2 of the yeast actin gene (nt 1024-2109, GenBank) or by labelling oligo R with [y-3ZP]ATP and polynucleotide kinase.
Methods:
lUlUnnllllllll
-
14 bp
5bp
onlythisspeciescan be amplified
I Key:
mRNA DNAoligo RNAoligo
1
Fig. 4. RNA-ligation-dependent PCR technique. In vitro transcripts or yeast total RNA were phosphorylated, ligated to an oligoribonucleotide 14-mer with RNA ligase and then reverse transcribed using an appropriate primer, cDNAs were amplified using PCR with the above primer and a second that hybridized specifically to the sequence generated after ligation of the oligoribonucleotide to the 3' cleavage product of Rz action.
49 bulk cellular RNA. The RNA is then incubated with T4 RNA ligase and a 14-nt oligoribonucleotide. The resulting RNA is reverse transcribed using a primer which hybridizes to the 3' region of the ADE1 mRNA. Finally, a second primer that corresponds to the ligated 14-mer oligoribonucleotide plus the first five nt of the presumed product of ADE1 mRNA cleavage is added and amplification by PCR is carried out. To minimize the possibility of Rz action during in vitro manipulation, the initial phosphorylation reaction was carried out for 3 min. It should be noted that degradation or cleavage of RNA resulting from incubations at subsequent steps in the procedure will not affect the result of this test because such RNAs would not contain the 5'-phosphate group needed for ligation to the oligoribonucleotide, and therefore would escape amplification. In Fig. 5A we show an example of the use of this technique with RNAs transcribed in vitro from the constructions used above. Only those RNAs having active Rz domains gave the expected band of 337 nt. Fig. 5B shows the results of analyzing RNA extracted from the yeast strains expressing R z in vivo. The expected amplification product of 337 nt could be found only in the case of the presumably active 5' Rz. Note that 3' R z which was active in vitro is not active in vivo. Presumably, interaction of ADE1 RNA with proteins prevents the formation of the active Hh structure in vivo. The fact that cleavage did not occur in the case of the 3' R z supports our conclusion that specific degradation of the RNA during isolation is not the origin of product formation in the case of the 5' Rz.
(e) Conclusions We have devised the first functional R z expression system in yeast, where up to now it has been difficult to document both antisense and Rz action (Parker et al., 1992). This system will help to identify potential host factors which could improve or inhibit Hh Rz action in vivo. The main conclusions from this work are: (1) Hh Rz can be catalytically active in yeast and can reduce gene expression only when the target is in cis and very close as evidenced by the comparisons of the effects of 5' cis (close to the target site), 3' cis (far from the target site) and trans Rz in the CAIR assay, the Northern blot and the RNA ligation PCR data. (2) Comparison of the effect of the active Rz with that of the disabled Rz placed at the 5' end of A D E 1 show that all Rz inhibit A D E I gene expression to some extent. Similar results have been obtained in both bacteria and higher eukaryotes (Sioud and Drlica, 1991; Scanlon et al., 1991; Sioud et al., 1992), indicating that factors other than catalytic activity play a role in the inhibitory effect of the Rz.
A MW 1
B 2
3
4
1
2
3
4
5
6
7
8 MW
Fig. 5. RNA ligation-dependent PCR. (A) In vitro transcribed RNAs from: Lanes: 1, phhADE; 2, phhxADE; 3, pADEhh and 4, pADEhhx. (B) Results with RNA from yeast strains harbouring: 1, YEpGADE; 2, YEphhADE; 3, YEphhxADE; 4, YEphhyADE; 5, YEpADEhh; 6, YEpADEhhx, 7, YEpGALhh and 8, YEpGALhhx. The M W marker in lane 9 is the 123-bp ladder from GIBCO BRL. Methods: Total yeast RNA (Sherman et al., 1986) was phosphorylated in polynucleotide kinase buffer (New England Biolabs) supplemented with 1 mM ATP, 20 u placental RNase inhibitor, (Pharmacia) and 8 u of polynucleotide kinase in 20 ~tl at 37°C for 3 min. The phosphorylated RNA was extracted with phenol and recovered by ethanol precipitation. A sample of 500 ng of in vitro transcribed RNA or 5 ~tg of yeast total RNA were ligated to 100ng of the single-stranded oligoribonucleotide 5 ' - A C G G U C U C A C G A G C in 5 0 m M HEPES pH 7.5/10mM MgCI2/1 m M ATP/20 mM dithiothreitol/1 ~tg RNAse free BSA/10% dimethyl sulfoxide/6 u of T4 RNA ligase in 20 pl. The reaction was incubated overnight at 15°C, stopped by heating, and the products were recovered by ethanol precipitation. Ligated RNA was annealed to 50 pmoles of oligo A (5'-GAACCAAATAGAGAGCGGTC), which is complementary to a region 328 nt downstream from the start codon, in Vent DNA polymerase buffer (NEB), supplemented with 2.5 m M MgC12/1 m M of each d N T P in 20 ~tl. After 45 min at 30°C, 12 u of Moloney Murine Leukaemia Virus reverse transcriptase were added and the reaction was incubated for 1 h at 37°C. Reverse transcription was stopped by boiling. Amplification of the cDNAs was then continued by adding a further 50pmol of oligo A and 50pmol of oligo B (5'-ACGGTCTCACGAGCAATTA) whose sequence corresponded to that of the RNA linker plus the first 5 nt of the presumed cleavage product. The reaction volume was adjusted to 100 pl with Vent DNA polymerase buffer, and 3 u of Vent DNA polymerase were added. PCR was carried out for 30 cycles of 30 s at each of 94, 57 and 72°C. The amplified DNA was recovered by ethanol precipitation and resolved in 6% polyacrylamide or 1.8% agarose gels.
(3) The RNA ligation-dependent PCR technique used in this work to amplify selectively the 3' cleavage product could be very useful to analyze Rz action in vivo, since cleavage products have proven to be highly elusive in conventional Northern blots, presumably due to their rapid degradation (Sioud and Drlica, 1991). A similar technique has been developed independently to analyze RNA/protein interactions (Bertrand et al., 1993).
ACKNOWLEDGEMENTS
This work was supported by the Medical Research Council of Canada. J.B. holds a predoctoral fellowship
50 from the Natural Science and Engineering Research Council and R.C. is fellow of the Canadian Institute of Advanced Research. Yeast strain SC252 was a kind gift of D. Thomas, and DG920 of J. Boeke.
REFERENCES Becker, D.M. and Guarente, L.: High efficiency transformation of yeast by electroporation. Methods Enzymol. 194 (1991) 182 187. Bertrand, E., Fromont-Racine, M., Pictet, R. and Grange, T.: Visualization of the interaction of a regulatory protein with RNA in vivo. Proc. Natl. Acad. Sci. USA 90 (1993) 3496 3500. Cavener, D.R. and Ray, S.C.: Eukaryotic start and stop translation sites. Nucleic Acids Res. 19 (1991) 3185 3192. Cotten, M and Birnstiel, M.: Ribozyme mediated destruction of RNA in vivo. EMBO J. 8 (1989) 3861-3866. Dreyfuss, G., Matunis, M.J., Pifiol-Roma, S. and Burd, C.G.: hnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 62 (1993) 289-3321. Gietz, R.D. and Sugino, A.: New yeast-E.coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74 (1988) 527 534. Goodchild, J., Carroll, E. and Greenberg, J.R.: Inhibition of rabbit ~-globin synthesis by complementary oligonucleotides: identification of mRNA sites sensitive to inhibition. Arch. Biochem. Biophys. 263 (1988) 401 409. Haseloff, J. and Gerlach, W.L.: Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature 334 (1988) 585-591. Hertel, K.J., Pardi, A., Uhlenbeck, O.C., Koizumi, M., Ohtsuka, E., Uesugi, S., Cedergren, R., Eckstein, F., Gerlach, W.L., Hodgson, R. and Symons, R.H.: Numbering system for the hammerhead. Nucleic Acids Res. 20 (1992) 3252. Hieter, P., Mann, C., Snyder, M. and Davis, R.: Mitotic stability of yeast chromosomes: a colony color assay that measures non disjunction and chromosomes loss. Cell 40 (1985) 381-392. Izant, J.G. and Weintraub, H.: Inhibition of thymidine kinase gene expression by antisense RNA: a molecular approach to genetic analysis. Cell 36 (1984) 1007-1015. Koizumi, M., Kamiya, H. and Ohtsuka, E.: Ribozymes designed to inhibit transformation of NIH3T3 cells by the activated c-Ha-ras gene. Gene 117 (1992) 179 184. Law, R.H. and Devenish, R.J.: Expression in yeast of antisense RNA to ADEI mRNA. Biochem. Int. 17 (1988) 673 679. Lukens, L. and Flaks, J.: Intermediates in purine nucleotide synthesis. Methods Enzymol. 6 (1963) 671 702.
Mortimer, R.K. and Hawthorne, D. In: Rose, A.H. and Harrison, J.S. (Eds.), The Yeasts, Vol. 1. Academic Press, New York, NY, 1969, pp. 386-460. Mounts, P., Wu, T. and Peden, K.: Method for cloning single stranded oligonucleotides in a plasmid vector. Biotechniques 7 (1989) 356 359. Myasnikov, A.N., Sasnauskas, K.V., Janulaitis, A.A, and Smirnov, M.N.:The Saccharomyces cerevisiae ADEI gene: structure, overexpression and possible regulation by general amino acid control. Gene 109(1991} 143 147, Parker, R., Muhlrad, D., Deshler, J.O., Taylor, N. and Rossi, J.J.: Ribozymes: principles and designs for their use as antisense and therapeutic agents. In: Erickson, R.P. and Izant, J.G. (Eds.), Gene Regulation: Biology of Antisense RNA and DNA. Raven Press, New York, NY, 1992, pp. 183-195. Perriman, R., Delves, A. and Gerlach, W.L,: Extended target-site specificity for a hammerhead ribozyme. Gene 113 (1992) 157-163. Rossi, J.J.: Ribozymes. Curr. Opin. Biotechnol. 3 (1992) 3 7. Ruffner, D.E., Stormo, G.D. and Uhlenbeck, O.C.: Sequence requirements for the hammerhead RNA self-cleavage reaction. Biochemistry 29 (1990) 10695 10702. Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Sarver, N., Cantin, E.M., Chang, P.S., Zaia, J.A., Ladne, P.A., Stephens, D.A. and Rossi, J.J.: Ribozymes as potential anti-HIV therapeutic agents. Science 247 (1990) 1222 1225. Scanlon, K.J., Jiao, L., Funato, T., Wang, W., Tone, T., Rossi, J.J. and Kashani-Sabet, M.: Ribozyme-mediated cleavage of c:fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein. Proc Natl. Acad. Sci. USA 88 (1991) 10591 10595. Sherman, F., Fink, G.R. and Hicks, J.B.: Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1986. Sioud, M. and Drlica, K.: Prevention of HIV type l integrase expression in E. coli by a ribozyme. Proc. Natl. Acad. Sci. USA 88 (1991) 7303 7307. Sioud, M., Natriz, J.B. and Forre, O.: Preformed ribozyme destroys turnout necrosis factor mRNA in human cells. J. Mol. Biol. 223 (1992) 831 835. Steinecke, P., Herget, T. and Schreier, P.H.: Expression of a chimeric ribozyme gene results in endonucleolytic cleavage of target mRNA and a concomitant reduction of gene expression in vivo. EMBO J. 11 (1992) 1525 1530. St. John, T.P. and Davis, R.W.: The organization and transcription of the galactose gene cluster of Saccharomyces. J. Mol. Biol. 152 (1981) 285 315. Vernet, T., Dignard, D. and Thomas, D.T.: A family of yeast expression vectors containing the phage fl intergenic region. Gene 52 (1987) 225 233.
45
GENE 08680
A hammerhead ribozyme inhibits ADE1 gene expression in yeast (RNA catalysis; in vivo activity; Saccharomyces; PCR; mRNA cleavage)
Gerardo Ferbeyre*, John Bratty, Hui Chen and Robert Cedergren Dkpartement de biochimie, Universi@ de Montr4al, Montr4al, Qukbec H3C 3J7, Canada
Received by M. Belfort: 10 December 1993; Revised/Accepted: 31 August/13 October 1994; Received at publishers: 2 December 1994
SUMMARY
To study factors that affect in vivo ribozyme (Rz) activity, a model system has been deviSed in Saccharomyces cerevisiae based on the inhibition of A D E I gene expression. This gene was chosen because Rz action can be evaluated visually by the Red phenotype produced when the activity of the gene product is inhibited. Different plasmid constructs allowed the expression of the Rz either in cis or in trans with respect to ADEI. Rz-related inhibition of A D E I expression was correlated with a Red phenotype and a diminution of ADE1 mRNA levels only when the Rz gene was linked 5' to ADE1. The presence of the expected 3' cleavage fragment was demonstrated using a technique combining RNA ligation and PCR. This yeast system and detection technique are suited to the investigation of general factors affecting Rz-catalyzed inhibition of gene expression under in vivo conditions.
INTRODUCTION
Studies of gene expression inhibition, first using antisense nucleic acids (Izant and Weintraub, 1984) have now turned toward the use of catalytic RNAs, ribozymes (Rz), with the hope of producing greater and more specific effects (Rossi, 1992). Among Rz, the catalytic hammerhead RNA domain (Hh) has been a favourite tool for gene inhibition (Cotten and Birnstiel, 1989; Sarver et al., Correspondence to: Dr. R. Cedergren, D6partement de biochimie, Universit6 de Montr6al, Montr6al, Quebec H3C 3J7, Canada. Tel. (1-514) 343-6320; Fax (1-514) 343-2210; e-mail: [email protected] *Permanent address: Centro de Ingenieria Gen6tica y Biotecnologia, La Habana, Cuba. Tel. (53-7) 201-401.
Abbreviations: A, absorbance (1 cm); ADEI, gene involved in purine biosynthesis encoding SAICAR (N-succinyl-5-aminoimidazole-4carbox-amide ribotide) synthetase; bp, base pair(s); BSA, bovine serum albumin; CAIR, 4-carboxy-5-aminoimidazole ribotide; G5C and G8C, guanosine in position 5 or 8 replaced by cytidine; Hh, hammerhead RNA domain; kb, kilobase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PAGE, polyacrylamide-gel electrophoresis; PCR, polymerase chain reaction; Rz, ribozyme(s); Rz, gene (DNA) encoding Rz; TCA, trichloroacetic acid; u, unit(s); wt, wild type. SSDI 0378-1119(94)00891-4
1990; Sioud and Drlica, 1991; Koizumi et al., 1992; Steinecke et al., 1992). The only sequence requirement for cleavage of a target RNA by the Hh Rz is the presence of one of the following triplets: GUC, CUA, GUU, UUC, or CUC (Haseloff and Gerlach, 1988; Perriman et al., 1992). However, the fact that the Rz is less efficient in vivo than in vitro demonstrates that other (cellular) factors influence cleavage in vivo. In order to create a simple model in yeast to study in vivo factors, we have devised a system based on the effect of a Hh Rz on the expression of the A D E I gene. This gene codes for the enzyme N-succinyl-5-aminoimidazole4-carboxamide ribotide (SAICAR) synthetase (EC 6.3.2.6) which is required for de novo purine biosynthesis (Myasnikov et al., 1991). Yeast strains lacking this gene product develop a Red phenotype (Mortimer and Hawthorne, 1969), whose intensity can be correlated to gene expression levels (Hieter et al., 1985). We report here that Rz designed to cleave the ADE1 mRNA in cis can reproduce the Red phenotype of yeast adel mutants and bring about a reduction in the levels of ADE1 mRNA. Furthermore, the 3' product of Rz cleavage in vivo can be detected by RNA ligation-dependent PCR.
46 RESULTS AND DISCUSSION
Ai
Substrate
~f
5 ' - A A C G A U A A , ~ ' U C AAUUACG - 3 ' - UUACA UUAAU A C o, A GS . ~ , C (m.~Y) G A
Ribozyme
GCAGSO C (mxx)
AU CG A
G
GU
B. YEpGA
YEpGADE ~
ADE1 ( TADH,[
Fig. 1. The Hh Rz designed to cleave the ADE1 mRNA. (A) Secondary structure of the Hh Rz. The Rz structure as described by Haseloff and Gerlach (1988) containing two 5-bp flanking helices. The positions are indicated where G8C and G5C transversions were made. The AUG triplet is underlined. (B) Expression vectors, ADE1, SAICAR synthetase-encoding gene; P6~AL1,GALl promoter; TADM1, ADHI terminator; Hh, Hhx and Hhy, wt Rz, the GSC and the G5C mutant Rz, respectively. Methods: Constructions were made as described by Sambrook et al. (1989). The Klenow fragment of DNA polymerase I, as well as T7 DNA polymerase were obtained from Pharmacia. All other enzymes were from New England Biolabs. Except as otherwise noted, all buffers were those recommended by the manufacturers of the enzymes. The ADE1 gene was amplified from total yeast DNA by PCR, using the following primers designed according to the sequence published by Myasnikov et al. (1991): oligo X, 5'-CCATCGATTTTATCTTTTGCAGTTGGTA, oligo Y, 5'-GGAATTCAAAGATATCGATAAAA and oligo Z 5'CACGTTAGTGAGACCATTATG and cloned into the ClaI site of pBluescript SK- to give pKSADE, (oligos X and Y) and pNADE (oligos X and Z). Rz were obtained by cloning a single-stranded oligo (oligo R, 5'-TCGATAATGTTTCGTCCTCACGGACTCATCAGAATTAGGCC) in which nt 27 (corresponding to Rz position 8 (Hertel et al., 1992)) was made as a mixture ofC (wt) and G (mutant) into pBluescript SK-digested with ApaI +XhoI (Mounts et al., 1989) to give pGF3 (wt) and pGF3x (G8C mutant). The sequences were confirmed by sequencing. The ADEI gene was then subcloned downstream from the EcoRV site, and the resulting plasmids were named phhADE and phhxADE. 3' fused Rz were obtained by subcloning the Rz from pGF3 and pGF3x, produced from KpnI-ClaI fragments whose termini were blunted, downstream from the ADE1 gene into the EcoRV site of pNADE. The resulting plasmids were named pADEhh and pADEhhx. The G5C control was constructed by PCR mutagenesis using as 5' primer the oligo 5'-GGGCCTAATTCTC_ATGAGTCCGTC and oligo Y as the 3' primer. The template was the Rz ADEI fusion in phhADE. The amplified band was subcloned into pUCI9 digested with BamHI and
(a) Targeting the yeast ADE1 gene The design of the R z gene sequences to inhibit SAICAR synthetase production in vivo involved consideration of the potential nucleotide (nt) triplet targets present in the ADE1 gene. The triplet _GGUC starting at the third nt of the AUG_ start codon was finally chosen because it is contained in a region thought to be accessible to transacting factors, i.e., antisense nucleic acids (Goodchild et al., 1988). In addition, many yeast genes have the consensus sequence A U G U C at the start codon (Cavener and Ray, 1991), so results from the use of this region as a target could be more easily generalized to other genes. Rz contained five nt complementary to the ADE1 mRNA on either side of the targeted G U C triplet (Fig. 1A). In order to establish that an eventual inhibition provoked by the Rz was due to a mechanism involving cleavage of the target mRNA, catalytically inactive mutants containing disabling G---,C transversions at nt position 5 (G5C) or 8 (G8C) of the catalytic core were used as controls (Ruffner et al., 1990). Rz activity was first studied in vitro by inserting R z and Rz-control sequences both upstream and downstream from the ADE1 gene carried by the pBluescript SK-derivatives pKSADE and pNADE. The ability to cleave the ADE1 mRNA was assessed by linearization of the plasmid and in vitro transcription with T7 RNA polymerase followed by analysis of the transcriptional products by PAGE. In these experiments, R z in both 5' and 3' orientations with respect to the ADE1 gene cleaved the target as expected (see section d); no cleavage was observed with the disabled mutants. (b) Inhibition of A D E I gene expression by Rz can be correlated with a Red phenotype Following demonstration of in vitro activity, both trans and cis-acting R z constructs were prepared for in vivo
Mung Bean nuclease to mimic the flanking regions of the previous constructions. The resulting plasmid was phhyADE. YEpGA, the parent plasmid of all the constructions used to express Rz in yeast, was made by cloning a 1.2-kb EcoRI-SalI fragment containing the GALl promoter fused to the ADHI terminator into the polylinker of YEplacl81, a LEU2-selectable 2g-based yeast-E, coli shuttle vector (Gietz and Sugino, 1988). A unique BamHI site found at the fusion junction of the promoter and terminator served to insert all test constructs after filling in the ends with the Klenow fragment of DNA polymerase I. Thus, YEpGADE contains the ADE1 gene from pKSADE, while YEphhADE, YEphhxADE (G8C mutant) and YEphhyADE (G5C mutant) harbour Rz-ADE1 fusions from phhADE, phhxADE and phhyADE. YEpADEhh, YEpADEhhx, YEpGALhh and YEpGALhhx were constructed as above but from pADEhh, pADEhhx, pGF3 and pGF3x respectively, pVTADE was obtained by cloning the ADEI gene into pVT100U, (Vernet et al., 1987).
47 experiments. For the trans arrangement, we introduced plasmids encoding Rz targeted against the ADE1 mRNA transcribed from the chromosomal gene into strain DG920 (a, leu2, ura3, trpl, his3). For the cis model, the adel mutation carried by strain SC252 (a, ura3, adel, leu2) was complemented by transformation with a derivative of the 2g vector harbouring the wt ADE1 gene under the control of a galactose-inducible promoter (YEpGADE). Colonies of the SC252 mutant strain transformed with Y E p G A D E were red in adenine-limiting medium when glucose was the carbon source, but turned white when grown in the presence of galactose. We observed, however, that the adenine auxotrophy can be complemented even when the cells are grown on glucose, indicating that the small number of transcripts made even under repression are sufficient to cope with minimal cellular requirements. The Hh constructs from in vitro tests were subcloned into plasmid YEpGA under the control of the GALl promoter (see Fig. 1B) and were tested for inhibition of ADE1 gene expression in vivo by the observation of colony colour. When the active Rz was placed 5' to the ADE1 gene, complementation of the adel mutation was greatly reduced, since the colonies were red in galactosecontaining medium. However, the pink colour of cells harbouring either Rz mutant indicated partial inhibition of ADE1 gene expression. Nevertheless, an additional degree of inhibition is evident in the presence of the catalytically active Rz. This effect is not related to the A U G triplet present in the wt Rz because both mutants G5C and G8C showed the same partial phenotype even though G5C contains the A U G and G8C does not. Although the colony colour was a useful indication of Rz activity and for screening large numbers of clones, it did not provide a quantitative measure of the effect. To address this shortcoming, we developed an assay for the in vivo accumulation of the biosynthetic precursor 4-carboxy-5-aminoimidazole ribotide (CAIR), based on a modification of an in vitro method (Lukens and Flaks, 1963). The results of this assay confirm the increased accumulation of CAIR in cells containing the 5'-cis Rz relative to those carrying control Rz G5C and G8C (Fig. 2). The active 5'-cis Rz showed a n A S l S n m of 0.544--+0.072, the G8C control Rz 0.373-+0.074 and the G5C control Rz 0.388_+0.090 in this assay, compared to the values for the YEpGA and YEpGADE-containing strains of 0.651 and 0.104-+ 0.084, respectively. Thus, the active Rz-containing strain accumulates 80% as much excess CAIR as the strain containing no functional ADEI gene when both are compared to the strain bearing a fully functional ADE1 allele, while the G5C and G8C mutant Rz-containing strains accumulated 52 and 49% as much, respectively. Neither the Rz placed at the 3' end
ore"
0,6"
E_ 00
0,4"
0,2"
0~0" ~v
-lkTM
~v
~k*~
~v
,KP"
~v
kCO~"
Plasmid Fig. 2. Assay for CAIR accumulation in strains carrying plasmids YEpGA, YEpGADE, YEphhADE, YEphhxADE and YEphhyADE. Data are presented as average±S.D., n = 4 independent experiments except YEpGA, n = 1. The margins of error largely represent systematic variation between plates; measurement error is much lower (< +0.010) in this assay. Methods: Yeast strains bearing the above plasmids were grown up on a synthetic minimal medium plate containing 2% galactose/5 rtg adenine/20 ~tg uracil per ml. After incubation for 5-6 days, cells were scraped up off the plates and resuspended in water to a n A 6 o 0 nrn of 10. A sample of 700 ~tl of this solution was vortexed four times for 1 min in the presence of glass beads and 200 ~tl of chloroform. From the resulting supernatant 600 lal were transferred to new tubes and 100 Ixl of 30% TCA added to each. After a 10-min centrifugation, 600 ~tl of supernatant were recovered and mixed with 225 ~tl 0.2 M HC1. Immediately, 75 pl 0.1% NaNO2 was added and the tubes incubated for 5 min at room temperature. Then, 75 ~tl 0.5% ammonium sulfamate (NH4SO3NH2) was added and the incubation continued for 3 min. Finally, 75 pl 0.1% N-l-naphthyl)ethylene diamine dihydrochloride was added. After a further 10-min incubation, the As18 nm of the solutions were measured.
of the gene (see Fig. 1B) nor the Hh targeted to the chromosomal gene as a trans-acting Rz in a wt strain for purine biosynthesis was able to produce the colour phenotype. The trans Rz was also ineffective when expressed in the adel mutant strain complemented with pVTADE, an ARSl-based plasmid that allowed expression of the ADE1 gene under the control of the alcohol dehydrogenase promoter. Quantitative dot blot hybridization indicated that the trans Hh Rz was expressed to a level of about 0.05% of the total yeast RNA, which represents a level of expression comparable in molar terms to the levels achieved previously for the ADEI gene, as well as for other mRNAs expressed under GALl promoter control (St. John and Davis, 1981). Several explanations are plausible for the failure of the trans-acting catalytic RNAs: (i) The level of Rz may be insufficient (Sioud and Drlica, 1991; Steinecke et al., 1992), since mRNA destruction may need to be considerable before a phenotypic effect can be observed. (ii) Differences in RNA metabolism between yeast and higher
48 eukaryotes where active trans-acting Rz have been found (Cotten and Birnstiel, 1989; Sarver et al., 1990; Koizumi et al., 1992; Steinecke et al., 1992) may be responsible for lower efficiencies in yeast. (iii) RNA-binding proteins (Dreyfuss et al. 1986), strong secondary structures or different intracellular locations may affect the ability of the Rz to find its target more in yeast than in other cell types. In particular, the accessibility of the 5' region of the ADE1 gene used as a target in our experiments is unknown. It is even conceivable that cleavage can only occur during transcription. In this case, the 5' Hh would be active only as long as the target was free of proteins and cleavage would be completely inhibited in the case of either the 3' Hh construction or the trans-acting Rz.
(c) Evidence of Rz-mediated mRNA cleavage in vivo If the reduction in ADE1 gene expression observed in our colony colour assay is due to RNA cleavage, then the levels of ADE1 mRNA should be correspondingly reduced. Fig. 3 shows that only the strain expressing the Hh Rz 5' to the ADE1 gene had an important reduction in mRNA levels, (twofold according to densitometric
analysis). could be the rapid trans nor
No evidence of the specific cleavage products observed however, which may be indicative of metabolism of mRNA fragments. Neither the the 3' linked Rz reduced ADE1 mRNA levels.
(d) Detection of cleavage products by RNA-ligationdependent PCR Since cleavage products could not be directly observed in the previous experiments, additional evidence of Rz action was desirable. To that end, a technique was adapted that makes use of PCR to amplify selectively the 3' cleavage product of Rz action (see Fig. 4). In the first step of the procedure 5'-phosphorylation is performed on
intactmRNA GpppG degradedRNA HO. . . . . specificcleavageproduct HO . . . . . . . Phosphorylate1 GpppG
1
2
3
4 l
AddRNAlinker~ V
ADE 1
GpppG
wW
MakecDNAcopy / PCR
ACTIN
GpppG Fig. 3. Northern analysis of ADE1 mRNA from cells expressing Rz in cis directed against the ADE1 mRNA. Lanes: 1, YEpGADE, 2, YEphhADE, 3, YEphhxADE, 4, YEphhyADE. Each lane contains 5 p.g of total RNA purified from cells. Upper: hybridization with ADE1 probe. Lower: re-hybridization of the membrane shown above with actin probe to establish relative amounts of RNA in each lane. Yeast expression vectors were introduced into the cells by electroporation (Becker and Guarente, 1991) and transformants were selected on medium lacking leucine for the YEpGA-derived plasmids or uracil for pVTADE (Sherman et al., 1986). Yeast cells were cultured first in glucose-containing medium, harvested by centrifugation and recultured in galactose-containing medium for induction. RNA was isolated according to Sherman et al. (1986) and separated on 2.2 M formaldehyde-l% agarose gels (Sambrook et al., 1989). After transfer to Hybond-N nylon membranes (Amersham), the RNA was hybridized overnight at 65"C to 3~P-labelled probes in 7% SDS/0.25 M NazHPO 4 pH 7.4/1% BSA. The membranes were washed twice at 6Y'C in 2 × SSC/0.1% SDS for 20 min, and once at 65cC in 0.2×SSC/0.1% SDS, ( S S C - 0 . 1 5 M NaCI/0.05 M Na3"citrate pH 7.6). Probes were prepared using the T7 Quickprime kit (Pharmacia) from the PCR-amplified 1.1-kb ADEI gene or from a l.l-kb PCR-amplified fragment from exon 2 of the yeast actin gene (nt 1024-2109, GenBank) or by labelling oligo R with [y-3ZP]ATP and polynucleotide kinase.
Methods:
lUlUnnllllllll
-
14 bp
5bp
onlythisspeciescan be amplified
I Key:
mRNA DNAoligo RNAoligo
1
Fig. 4. RNA-ligation-dependent PCR technique. In vitro transcripts or yeast total RNA were phosphorylated, ligated to an oligoribonucleotide 14-mer with RNA ligase and then reverse transcribed using an appropriate primer, cDNAs were amplified using PCR with the above primer and a second that hybridized specifically to the sequence generated after ligation of the oligoribonucleotide to the 3' cleavage product of Rz action.
49 bulk cellular RNA. The RNA is then incubated with T4 RNA ligase and a 14-nt oligoribonucleotide. The resulting RNA is reverse transcribed using a primer which hybridizes to the 3' region of the ADE1 mRNA. Finally, a second primer that corresponds to the ligated 14-mer oligoribonucleotide plus the first five nt of the presumed product of ADE1 mRNA cleavage is added and amplification by PCR is carried out. To minimize the possibility of Rz action during in vitro manipulation, the initial phosphorylation reaction was carried out for 3 min. It should be noted that degradation or cleavage of RNA resulting from incubations at subsequent steps in the procedure will not affect the result of this test because such RNAs would not contain the 5'-phosphate group needed for ligation to the oligoribonucleotide, and therefore would escape amplification. In Fig. 5A we show an example of the use of this technique with RNAs transcribed in vitro from the constructions used above. Only those RNAs having active Rz domains gave the expected band of 337 nt. Fig. 5B shows the results of analyzing RNA extracted from the yeast strains expressing R z in vivo. The expected amplification product of 337 nt could be found only in the case of the presumably active 5' Rz. Note that 3' R z which was active in vitro is not active in vivo. Presumably, interaction of ADE1 RNA with proteins prevents the formation of the active Hh structure in vivo. The fact that cleavage did not occur in the case of the 3' R z supports our conclusion that specific degradation of the RNA during isolation is not the origin of product formation in the case of the 5' Rz.
(e) Conclusions We have devised the first functional R z expression system in yeast, where up to now it has been difficult to document both antisense and Rz action (Parker et al., 1992). This system will help to identify potential host factors which could improve or inhibit Hh Rz action in vivo. The main conclusions from this work are: (1) Hh Rz can be catalytically active in yeast and can reduce gene expression only when the target is in cis and very close as evidenced by the comparisons of the effects of 5' cis (close to the target site), 3' cis (far from the target site) and trans Rz in the CAIR assay, the Northern blot and the RNA ligation PCR data. (2) Comparison of the effect of the active Rz with that of the disabled Rz placed at the 5' end of A D E 1 show that all Rz inhibit A D E I gene expression to some extent. Similar results have been obtained in both bacteria and higher eukaryotes (Sioud and Drlica, 1991; Scanlon et al., 1991; Sioud et al., 1992), indicating that factors other than catalytic activity play a role in the inhibitory effect of the Rz.
A MW 1
B 2
3
4
1
2
3
4
5
6
7
8 MW
Fig. 5. RNA ligation-dependent PCR. (A) In vitro transcribed RNAs from: Lanes: 1, phhADE; 2, phhxADE; 3, pADEhh and 4, pADEhhx. (B) Results with RNA from yeast strains harbouring: 1, YEpGADE; 2, YEphhADE; 3, YEphhxADE; 4, YEphhyADE; 5, YEpADEhh; 6, YEpADEhhx, 7, YEpGALhh and 8, YEpGALhhx. The M W marker in lane 9 is the 123-bp ladder from GIBCO BRL. Methods: Total yeast RNA (Sherman et al., 1986) was phosphorylated in polynucleotide kinase buffer (New England Biolabs) supplemented with 1 mM ATP, 20 u placental RNase inhibitor, (Pharmacia) and 8 u of polynucleotide kinase in 20 ~tl at 37°C for 3 min. The phosphorylated RNA was extracted with phenol and recovered by ethanol precipitation. A sample of 500 ng of in vitro transcribed RNA or 5 ~tg of yeast total RNA were ligated to 100ng of the single-stranded oligoribonucleotide 5 ' - A C G G U C U C A C G A G C in 5 0 m M HEPES pH 7.5/10mM MgCI2/1 m M ATP/20 mM dithiothreitol/1 ~tg RNAse free BSA/10% dimethyl sulfoxide/6 u of T4 RNA ligase in 20 pl. The reaction was incubated overnight at 15°C, stopped by heating, and the products were recovered by ethanol precipitation. Ligated RNA was annealed to 50 pmoles of oligo A (5'-GAACCAAATAGAGAGCGGTC), which is complementary to a region 328 nt downstream from the start codon, in Vent DNA polymerase buffer (NEB), supplemented with 2.5 m M MgC12/1 m M of each d N T P in 20 ~tl. After 45 min at 30°C, 12 u of Moloney Murine Leukaemia Virus reverse transcriptase were added and the reaction was incubated for 1 h at 37°C. Reverse transcription was stopped by boiling. Amplification of the cDNAs was then continued by adding a further 50pmol of oligo A and 50pmol of oligo B (5'-ACGGTCTCACGAGCAATTA) whose sequence corresponded to that of the RNA linker plus the first 5 nt of the presumed cleavage product. The reaction volume was adjusted to 100 pl with Vent DNA polymerase buffer, and 3 u of Vent DNA polymerase were added. PCR was carried out for 30 cycles of 30 s at each of 94, 57 and 72°C. The amplified DNA was recovered by ethanol precipitation and resolved in 6% polyacrylamide or 1.8% agarose gels.
(3) The RNA ligation-dependent PCR technique used in this work to amplify selectively the 3' cleavage product could be very useful to analyze Rz action in vivo, since cleavage products have proven to be highly elusive in conventional Northern blots, presumably due to their rapid degradation (Sioud and Drlica, 1991). A similar technique has been developed independently to analyze RNA/protein interactions (Bertrand et al., 1993).
ACKNOWLEDGEMENTS
This work was supported by the Medical Research Council of Canada. J.B. holds a predoctoral fellowship
50 from the Natural Science and Engineering Research Council and R.C. is fellow of the Canadian Institute of Advanced Research. Yeast strain SC252 was a kind gift of D. Thomas, and DG920 of J. Boeke.
REFERENCES Becker, D.M. and Guarente, L.: High efficiency transformation of yeast by electroporation. Methods Enzymol. 194 (1991) 182 187. Bertrand, E., Fromont-Racine, M., Pictet, R. and Grange, T.: Visualization of the interaction of a regulatory protein with RNA in vivo. Proc. Natl. Acad. Sci. USA 90 (1993) 3496 3500. Cavener, D.R. and Ray, S.C.: Eukaryotic start and stop translation sites. Nucleic Acids Res. 19 (1991) 3185 3192. Cotten, M and Birnstiel, M.: Ribozyme mediated destruction of RNA in vivo. EMBO J. 8 (1989) 3861-3866. Dreyfuss, G., Matunis, M.J., Pifiol-Roma, S. and Burd, C.G.: hnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 62 (1993) 289-3321. Gietz, R.D. and Sugino, A.: New yeast-E.coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74 (1988) 527 534. Goodchild, J., Carroll, E. and Greenberg, J.R.: Inhibition of rabbit ~-globin synthesis by complementary oligonucleotides: identification of mRNA sites sensitive to inhibition. Arch. Biochem. Biophys. 263 (1988) 401 409. Haseloff, J. and Gerlach, W.L.: Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature 334 (1988) 585-591. Hertel, K.J., Pardi, A., Uhlenbeck, O.C., Koizumi, M., Ohtsuka, E., Uesugi, S., Cedergren, R., Eckstein, F., Gerlach, W.L., Hodgson, R. and Symons, R.H.: Numbering system for the hammerhead. Nucleic Acids Res. 20 (1992) 3252. Hieter, P., Mann, C., Snyder, M. and Davis, R.: Mitotic stability of yeast chromosomes: a colony color assay that measures non disjunction and chromosomes loss. Cell 40 (1985) 381-392. Izant, J.G. and Weintraub, H.: Inhibition of thymidine kinase gene expression by antisense RNA: a molecular approach to genetic analysis. Cell 36 (1984) 1007-1015. Koizumi, M., Kamiya, H. and Ohtsuka, E.: Ribozymes designed to inhibit transformation of NIH3T3 cells by the activated c-Ha-ras gene. Gene 117 (1992) 179 184. Law, R.H. and Devenish, R.J.: Expression in yeast of antisense RNA to ADEI mRNA. Biochem. Int. 17 (1988) 673 679. Lukens, L. and Flaks, J.: Intermediates in purine nucleotide synthesis. Methods Enzymol. 6 (1963) 671 702.
Mortimer, R.K. and Hawthorne, D. In: Rose, A.H. and Harrison, J.S. (Eds.), The Yeasts, Vol. 1. Academic Press, New York, NY, 1969, pp. 386-460. Mounts, P., Wu, T. and Peden, K.: Method for cloning single stranded oligonucleotides in a plasmid vector. Biotechniques 7 (1989) 356 359. Myasnikov, A.N., Sasnauskas, K.V., Janulaitis, A.A, and Smirnov, M.N.:The Saccharomyces cerevisiae ADEI gene: structure, overexpression and possible regulation by general amino acid control. Gene 109(1991} 143 147, Parker, R., Muhlrad, D., Deshler, J.O., Taylor, N. and Rossi, J.J.: Ribozymes: principles and designs for their use as antisense and therapeutic agents. In: Erickson, R.P. and Izant, J.G. (Eds.), Gene Regulation: Biology of Antisense RNA and DNA. Raven Press, New York, NY, 1992, pp. 183-195. Perriman, R., Delves, A. and Gerlach, W.L,: Extended target-site specificity for a hammerhead ribozyme. Gene 113 (1992) 157-163. Rossi, J.J.: Ribozymes. Curr. Opin. Biotechnol. 3 (1992) 3 7. Ruffner, D.E., Stormo, G.D. and Uhlenbeck, O.C.: Sequence requirements for the hammerhead RNA self-cleavage reaction. Biochemistry 29 (1990) 10695 10702. Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Sarver, N., Cantin, E.M., Chang, P.S., Zaia, J.A., Ladne, P.A., Stephens, D.A. and Rossi, J.J.: Ribozymes as potential anti-HIV therapeutic agents. Science 247 (1990) 1222 1225. Scanlon, K.J., Jiao, L., Funato, T., Wang, W., Tone, T., Rossi, J.J. and Kashani-Sabet, M.: Ribozyme-mediated cleavage of c:fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein. Proc Natl. Acad. Sci. USA 88 (1991) 10591 10595. Sherman, F., Fink, G.R. and Hicks, J.B.: Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1986. Sioud, M. and Drlica, K.: Prevention of HIV type l integrase expression in E. coli by a ribozyme. Proc. Natl. Acad. Sci. USA 88 (1991) 7303 7307. Sioud, M., Natriz, J.B. and Forre, O.: Preformed ribozyme destroys turnout necrosis factor mRNA in human cells. J. Mol. Biol. 223 (1992) 831 835. Steinecke, P., Herget, T. and Schreier, P.H.: Expression of a chimeric ribozyme gene results in endonucleolytic cleavage of target mRNA and a concomitant reduction of gene expression in vivo. EMBO J. 11 (1992) 1525 1530. St. John, T.P. and Davis, R.W.: The organization and transcription of the galactose gene cluster of Saccharomyces. J. Mol. Biol. 152 (1981) 285 315. Vernet, T., Dignard, D. and Thomas, D.T.: A family of yeast expression vectors containing the phage fl intergenic region. Gene 52 (1987) 225 233.