A humanized anti-human CD154 monoclonal antibody blocks CD154–CD40 mediated human B cell activation

International Immunopharmacology 1 Ž2001. 277–294 www.elsevier.comrlocaterintimp

A humanized anti-human CD154 monoclonal antibody blocks CD154–CD40 mediated human B cell activation q Peter Brams a , Amelia Black a,1, Eduardo A. Padlan b, Kandasamy Hariharan a , John Leonard a , Karen Chambers-Slater a , Randolph J. Noelle c , Roland Newman a,) a

b

IDEC Pharmaceuticals Corporation, 3010 Science Park Road, San Diego, CA 92121, USA Laboratory of Molecular Biology, National Institute of Diabetes and DigestiÕe and Kidney Diseases, National Institutes of Health, Building 5, room 303, Bethesda, MD 20892-0560, USA c Department of Microbiology, Dartmouth Medical School, Lebanon, NH 03756, USA Received 8 May 2000; received in revised form 9 August 2000; accepted 11 August 2000

Abstract Humanized anti-CD154 antibody, IDEC-131, had a slightly, but reproducibly, better binding affinity for CD154 Ž K d s 5.6 nM., compared to the parent antibody 24–31 Ž K d s 8.5 nM.. Otherwise it was indistinguishable from the murine parent antibody in its ability to bind to CD154, block CD154 binding to CD40 and inhibit T cell-dependent B cell differentiation. The latter activity was independent of FcR binding as the Fab’1 fragment of IDEC-131 had an equivalent biological activity to that of the whole antibody. IDEC-131 blocked soluble CD154 from inducing proliferation of purified B cells, and blocked T cell dependent anti-tetanus toxoid specific antibody production by human B cells in vitro. IDEC-131, g 1, k , had strong Fcg RI, Fcg RII and C1q binding, but was unable to induce complement dependent ŽCDC. or antibody dependent cell-cytotoxicity ŽADCC. of activated peripheral blood T cells, which express relatively low levels of CD154. IDEC-131 antibody inhibited both primary and secondary antibody responses to ovalbumin in cynomolgus monkeys at a dose of 5 mgrkg. In non-immunized animals, treatment with IDEC-131 at 50 mgrkg weekly for 13 weeks induced no change in any of the measured lymphocyte subsets, including B cells, CD4 q and CD8 q T cells. Similarly, a safety study in chimpanzees showed no discernible safety related issues at 20 mgrkg, including B and T cell subsets. These results show that the humanized anti-CD154 antibody, IDEC-131, has retained the affinity and functional activity of its murine parent

AbbreÕiations: CDR, complementarity determining region; PCR, Polymerase Chain Reaction; IBD, inflammatory bowel disease; EAE, experimental allergic encephalomyelitis; SLE, systemic lupus erythematosus; PBMC, peripheral blood mononuclear cells; TT, tetanus toxoid; CDC, Complement Dependent Cellular Cytotoxicity; ADCC, Antibody Dependent Cellular Cytotoxicity; CHO, Chinese Hamster Ovary; PMA, phorbol-ester; PWM, pokeweed mitogen q For this work we used tissues acquired in part from the Cooperative Human Tissue Network, which is funded by the National Cancer Institute, National Disease Research Interchange. The work was funded in part by National Institutes of Health Grants AI 39326 ŽPB, AB, EAP, KH and RJN., and CA 64034 ŽPB.. ) Corresponding author. E-mail address: [email protected] ŽR. Newman.. 1 Current address: GenPharm International, Inc., San Jose, CA 95131, USA. 1567-5769r01r$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 1 5 6 7 - 5 7 6 9 Ž 0 0 . 0 0 0 2 0 - 5

278

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

antibody, is unlikely to deplete CD154 positive lymphocytes in humans, and is safe and effective in blocking antibody production in monkeys. Based on its safety and efficacy profile, IDEC-131 is being developed for therapy of systemic lupus erythematosus. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Humanized; Monoclonal antibody; Human CD154; Blockade of co-stimulation

1. Introduction The initiation of a cognate immune response induces expression of CD154 Žalso known as gp39 or CD40 ligand., which functions as a pivotal link in the communication between T cells and B cells w1x. Shortly after TCR engagement with MHC on an antigen presenting cell, activated T cells up-regulate CD154 w1,2x, which binds to the constitutively expressed B cell counter receptor, CD40. This interaction induces a series of differentiation events in the B cell, primarily growth w3,4x, and up-regulation of a number of other co-stimulatory antigens, including CD80 and CD86 w5–7x. Activated B cells in germinal centers, when activated solely through CD154 mediated cross-linking of CD40 w8x, predominantly differentiate into memory cells. CD154 engagement of CD40 on B cells in the presence of IL-4, promotes immunoglobulin production w9x and isotype switching to IgG4 and IgE w10x in B cells. The B cell associated co-stimulatory ligands CD80 and CD86 subsequently engage their T cell counter receptors, CD28 and CTLA4, resulting in further T cell differentiation, and lymphokine production w6,11x. The pivotal role that CD154 plays in the immune response has been demonstrated in patients with hyper IgM immunodeficiency syndrome ŽHIM.. These patients express mutated forms of CD154 w12x that are unable to bind CD40, resulting in the absence of T cell dependent B cell activation and isotype switching from IgM to IgG. Furthermore, both CD154- and CD40-knockout mice do not form germinal centers w13,14x, and fail to generate T and B memory cells w13,15,16x. Similar results were obtained after chronic treatment with anti-CD40L-antibody w17x. Based on the above concepts, blockade of the CD154rCD40 interaction has been postulated as a means of treating autoimmune diseases and preventing allograft rejection. Blockade of CD154 with antibody has been effective in animal models of inflammatory bowel disease ŽIBD. w18x, experimental

allergic encephalomyelitis ŽEAE. w19x, collagen induced arthritis w20x and autoimmune diseases w21x. Treatment of autoimmune oophoritis w22x, with antiCD154 antibody, indicates that blockage of CD154 binding to endothelial cell CD40 regulates the expression of the adhesion molecules VCAM, ICAM and E-selectin w23–25x. These data provide strong evidence that CD40–CD154 interactions play a critical role in the pathogenesis of autoimmune diseases. A murine anti-human CD154 antibody, 24–31, was developed and shown to effectively block CD40–CD154 interaction in vitro w26x. Because of the potential immunogenicity of murine antibodies, a humanized form of 24–31, IDEC-131, was generated for clinical development. The studies reported here were conducted to determine whether IDEC-131 had retained the affinity of the parent antibody for CD154 and the ability to block T–B cell costimulation. Studies in primates were conducted to determine efficacy and safety. The results show that the biochemical and biological properties of IDEC-131 were mostly indistinguishable from those of the murine parent antibody. In addition, IDEC-131 did not mediate lysis of activated T cells in Complement Dependent Cell Cytotoxicity ŽCDC. nor did it induce Antibody Dependent Cell Cytotoxicity ŽADCC.. Finally, it was shown that the antibody blocked T cell dependent B cell activation both in vitro and in vivo, and that the antibody was safe and effective in primate testing.

2. Materials and methods 2.1. V region cloning PolyAq mRNA was hybridoma w26x utilizing vitrogen, Carlsbad, CA. turer’s protocol. The V

prepared from the 24–31 a mRNA isolation kit ŽInaccording to the manufacregions were amplified by

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

polymerase chain reaction ŽPCR. using a panel of 5X primers identical to those described by Jones and Bendig w27x, except that the SalI cloning sites were converted to BglII sites in the 5X Vk primers. The 3X Vk and VH primers contained the following sequences, respectively: TGCAGCATCCGTACGTTTGATTCCAGCTT and GGGGGTGTCGTGCTAGCTGŽArC.ŽGrA.GAGACŽGrA.GTGA. The amplified products were gel-purified restricted with the appropriate enzymes and ligated sequentially into an expression vector, N5KG1 ŽIDEC Pharmaceuticals, San Diego, CA.. Plasmid DNA was prepared and the Vk and VH sequences determined. Amplifications, cloning and sequencing were carried out in duplicate to monitor for potential PCR-introduced changes in the sequences. 2.2. Humanization The variable regions of antibody 24–31 were humanized by grafting the complementarity-determining regions ŽCDRs. w28x of the murine antibody onto human framework regions w29,30x. Murine framework residues, critical in preserving the antigen-binding properties of the molecule w31x were retained. Each humanized variable region gene segment was assembled from four pairs of overlapping, complementary synthetic oligonucleotides ŽMidland Certified Reagent ŽHouston, TX.. gel purified prior to use. The Vk and VH 5X oligonucleotides contained BglII and SalI cloning sites and the 3X oligonucleotides possessed BsiWI and NheI cloning sites, respectively. Complementary oligonucleotide pairs were phosphorylated using T4 polynucleotide kinase ŽPromega. according to the manufacturer’s protocol and annealed by heating to 958C and slow cooling to room temperature. The annealed oligo pairs were ligated to one another utilizing T4 DNA ligase ŽNew England Biolabs, Beverly, MA.. After digestion with the appropriate 5X or 3X cloning site restriction endonuclease, the DNA fragments were agarose gel purified and ligated into the N5KG1 mammalian expression vector, upstream of human Ig constant region gene segments. The N5KG1 vector is similar to the NEOSPLA vector described by Barnett et al. w32x. The sequences of the cloned synthetic V region gene segments were confirmed.

279

2.3. Expression of humanized antibodies CHO transfectants expressing IDEC-131 were generated by electroporation of 4 = 10 6 CHO DG44 cells w33x with the linearized DNA construct, followed by selection in G418 Žgeneticin. ŽGibco-BRL. in 96-well plates, as described previously w34x. The highest expressing clones were expanded, and their antibody expression levels increased by gene amplification through selection in methotrexate. Amplified clones expressing the highest amount of the IDEC-131 antibody were expanded into spinner cultures, and the antibodies purified from the cell culture supernatants by protein A affinity chromatography, as described earlier w35x. 2.4. CD154 and CD154–CD8 expressing Chinese Hamster OÕary cell lines A cDNA that encodes the full-length human CD154 protein w36x, was inserted into the expression vector, INPEP4. The construct was electroporated into the CHO DG44 cell line, and a clone was selected in G418, which expressed membrane associate CD154. This clone was expanded and selected sequentially in 5 and 50 nM methotrexate. The highest expressing clone, 50D4, was expanded. A soluble CD154–CD8 fusion protein w36x, consisting of the extracellular domain of murine CD8 at the amino terminus and the extracellular domain of human CD154 at the carboxyl terminus, was also cloned into the INPEP4 expression vector, INPEP4. The construct was electroporated into the CHO DG44 cell line and a clone secreting soluble CD154 selected in G418. This clone was expanded and selected in 5 nM methotrexate. The highest producing clone, 8F11-5C11, was expanded for production and purification of the fusion protein. 2.5. CD154–CD8 fusion protein purification Supernatant from the 8F11–5C11 cell line containing soluble CD154–CD8 was purified by immunoaffinity chromatography on a IDEC-131– CNBr-activated Sepharose 4B column. Coupling of IDEC-131 to the CNBr-activated Sepharose 4B ŽPharmacia, Piscataway, NJ. was done according to the manufacturer’s suggestions. 8F11–5C11 culture

280

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

supernatant was passed through the IDEC-131–Sepharose column, followed by a wash with PBS-0.05% Tween-20, and elution with 0.1 M glycinerHCl, pH 2.8 into a predetermined amount of neutralizing buffer Ž1.0 M Tris–HCl, pH 7.4.. Fractions containing CD154–CD8 were pooled, extensively dialyzed into PBS, and the final concentrate sterilized by filtration through a 0.2 m m filter ŽGelman, Ann Arbor, MI. and stored at y208C. The purity of CD154–CD8, 55 kDa under reducing conditions, was determined by SDS-PAGE and protein content by BCA assay according to the manufacturer’s protocol ŽPierce.. 2.6. Measurement of binding affinity Fifty micrograms of IDEC-131 and murine 24–31 were each labeled with 1 mCi of 125 I ŽICN, Irvine, CA. using IODO-BEADSe according to the manufacturer’s instructions ŽPierce.. Briefly, two IODOBEADSe were pre-incubated for 2 min with 1 mCi 125 I prior to a 6-min incubation with either antibody. IDEC-131 or murine 24–31 bound-125 I was separated from free 125 I by ion exchange chromatography using 5 ml PBS containing 10% gelatinr1% BSAr0.02% sodium azide using a 3 ml column consisting of 1 ml Sephadex-G25 ŽSigma., 1 ml DEAE ŽPharmacia. and 1 ml Amberlite ŽSigma. layered successively in an AEconoColumnB from BioRad ŽHercules, CA.. The 125 I-labeled IDEC-131 antibody was incubated at a concentration equal to half-maximal saturation of 50D4 cells in the presence of unlabeled IDEC-131 and murine 24–31 antibody at concentrations ranging from 1r10- to 100fold of the radiolabeled antibody in PBS. Based on the molar quantities of bound and free antibody, a Scatchard plot was generated for both antibodies w37,38x. The slope was determined by a first order curve fitting subroutine from Sigma Plot version V for Windows ŽSPSS Science, Chicago, IL.. 2.7. IDEC-131 Fab’1 generation IDEC-131 Fab’1 fragments were prepared from whole antibodies using a commercially available kit according to the manufacturer’s recommendations ŽPierce, Cat. a44885.. Fab’1 fragments were sepa-

rated from whole antibody and Fc fragments by passage through a protein A column, followed by extensive dialysis against PBS. 2.8. Generation of cell assay plates Plates for cell binding studies were made as follows: 2 = 10 5 cells per well were attached to 96-well vinyl plates ŽCostar, Cambridge, MA. coated with poly-L-lysine Ž20 m grml. ŽSigma.. The plates were centrifuged for 5 min at 600 = g, after which the cells were fixed to the plate with 50 m l 0.5% glutaraldehyde ŽSigma. in PBS for 15 min. Excess glutaraldehyde was expelled, the plates washed with tap water and then blocked with 200 m lrwell of a buffer consisting of 0.1 M glycine ŽSigma. and 0.1% BSA in PBS for 1 h at room temperature. Plates were used immediately or stored frozen at y208C. 2.9. CompetitiÕe studies with 24–31 and IDEC-131 antibodies The murine anti-CD154 antibody, 24–31, and CD8–CD154 were both biotinylated using a commercial kit according to manufacturer’s instructions ŽAmersham, Arlington Heights, IL, Cat. aRPN 2202.. In competition for binding to membrane associated CD154, a stock solution of 400 ngrml of 24–31-biotin was mixed 1:1 with a serial dilution of unlabeled 24–31 and IDEC-131 antibodies in a concentration range of 0.196 to 400 m grml. The antibody dilutions were added to wells containing 50D4 cells and incubated for 1 h at room temperature. The plate was washed, and 50 m l of 1:2000 dilution of streptavidin HRP ŽSouthern Biotechnology Associates, Birmingham ŽSBA., AL. added to each well. After a 1-h incubation at room temperature, the plate was washed again, and 100 m m of TMB substrate, 3X 5,5X-tetramethyl benzidine ŽKirkegard & Perry Laboratories, Gaithersburg, MD. added to each well. Color was allowed to develop for 20 min at room temperature, before the reaction was stopped with addition of 4 N sulfuric acid, and the absorbance of the color development measured on a plate reader at 450 nm ŽFlow Laboratories, McLean, VA.. The relative inhibition of binding of biotin–24–31 by the unlabeled antibody was then calculated.

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

To block binding of soluble CD154 to CD40, 50 m m of 800 ngrml CD154–CD8–biotin was mixed with 50 m m of a serial dilution of IDEC-131, ranging from 50 to 100 m grml, in 50 m l HBSSq 1% FCS. This was incubated for 1 h on plates coated with WIL2-S cells ŽATCC, Rockville, MD. ŽCD40positive B cells., as described above. The plates were washed and then incubated with a 1:4000 dilution of avidin–HRP ŽPharmingen, San Diego, CA. in HBSSq 1% FCS for 30 min. The plates were developed, read as described above, and the percent inhibition of staining by a given IDEC-131 concentration was calculated. 2.10. Inhibition of soluble CD154 induced proliferation of B cell Lymphocyte preparations from buffy coats were enriched for B cells Ž) 90%. by Lympho-Kwik reagent, according to the manufacturer’s recommendation ŽOne Lambda, Canoga Park, CA, Cat. aLK50B.. Enriched human B cells were incubated with 1000 Urml of IL-4 ŽGenzyme, Cambridge, MA. at 1 = 10 5 cellsrwell in a 96-well plate in media consisting of Iscove’s Modified Dulbecco’s Medium ŽIMDM. ŽIrvine Scientific, Santa Ana, CA., with L-glutamine ŽGibco-BRL., non-essential amino acids, sodium pyruvate Žboth Sigma., and supplemented with 10% FCS ŽGibco-BRL.. CD154–CD8, 10 m grml, was added, together with varying concentrations of IDEC-131 antibody Ž2.5 to 20 m grml., for 4 days. During the final 16 h of incubation, the cultures were pulsed with 1 m Cirwell of 3 H thymidine ŽICN. and the incorporation of radioactivity by proliferating cells was measured on a TOPCOUNTe liquid scintillation counter ŽPackard, Meriden, CT.. 2.11. B cell differentiation assay Human peripheral T and B cells from buffy coats were isolated ŽLympho-Kwik kits., according to the manufacturer’s instructions. The purified T cells, 5 = 10 6rml, were treated with 50 m grml mitomycin C ŽSigma. for 1 h at 378C. These cells, 4 = 10 5 cellsrwell, were then activated in 96-well dishes with a pre-determined amount of plate bound mitogenic anti-CD3 antibody ŽPharmingen, Cat. No. 301100.. Purified B cells, 1 = 10 6 cellsrwell, were

281

incubated with the T cells in normal culture medium supplemented with 10% fetal calf serum and varying concentrations of IDEC-131, IDEC-131 Fab’1, 24– 31 and cRF-2, an irrelevant human IgG1,k antibody specific for respiratory syncytial virus F protein w39x. Supernatants were tested for IgM and IgG content by ELISA Žsee below., after 10 days. 2.12. T cell dependent, antigen-specific B cell actiÕation Human spleens were acquired through AThe Cooperative Human Tissue NetworkB in Columbus, OH, from splenectomized anonymous donors. The spleens were processed to a single cell suspension according to Boerner et al. w35x. The cells were challenged with antigen according to a modified version of our previously published protocol w40x. Briefly, thawed human spleen cells, 3 = 10 6rml, were plated out into the wells of a 48-well plate in culture media, supplemented with 5% macaque serum ŽBioreclamation, East Meadows, NY.. The macaque serum had been depleted for antibodies by protein A chromatography prior to use. The cells were plated out, "1 ngrml tetanus toxoid ŽTT. ŽMassachusetts Public Health Biologic Lab., Boston, MA. and with various concentrations of IDEC-131 antibody. Supernatants were harvested after 10 days and tested for total IgG and anti-TT IgG antibody content by ELISA. 2.13. Fcg RI and Fcg RII receptor binding assays A CHO cells line transfected with human Fcg RI ŽIDEC, FH11., and a murine fibroblast cell line transfected with human Fcg RII ŽATCC, CDW32. were coated on a 96-well plate using poly-L-lysine and fixed with glutaraldehyde. Direct binding of IDEC-131 was determined by incubation the antibody in the presence and absence of CD154–CD8 fusion protein. Binding of IDEC-131 was detected by incubation with goat anti-human antibody conjugated to horseradish peroxidase ŽSBA., as described above. 2.14. Effector function assays The ability of IDEC-131 to bind complement was evaluated in a direct C1q binding assay and in

282

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

Complement Dependent Cytotoxicity ŽCDC. assays. The C1q binding assay was performed essentially as described earlier w34x, using CD154 transfected CHO cells, called 50D4, as target, and by comparing IDEC-131 vs. the Fab’1 fragments of IDEC-131. Dilution series of the antibodies were incubated with 4 = 10 6 cellsrml in suspension for 30 min. The cells were washed, and incubated for 30 min with 10 m grml human C1q ŽChemicon, San Diego, CA. in HBSS containing 1% FCS. Presence of C1q on the cells was detected by incubation with rabbit anti-human C1q-FITC ŽDako, Carpinteria, CA.. Finally the cells were analyzed on a Becton-Dickinson FACScan flow cytometer ŽBecton-Dickinson, San Jose, CA. using Consort 30 software ŽBecton-Dickinson. data acquisition and analysis. The ability to mediate CDC was tested by 51 Chromium ŽNEN, Boston, MA. release from labeled target cells, 50D4, essentially as described earlier w34x, using rabbit complement ŽOrganon Teknika, Durham, NC., and by a flow cytometry assay using activated human CD4 q T cells, isolated from peripheral blood. For the CDC assay 1 = 10 6 50D4 cells were labeled with 51 Chromium. The cells were incubated with various concentrations of IDEC-131 for 45 min at room temperature. A 1:5 dilution of pooled rabbit complement was added to each well and incubated for an additional 90 min. The supernatant from each well was collected and the amount of radioactivity was counted on a gamma counter. The percentage of specific lysis was calculated. For the flow cytometric assay, CD4 q cells were isolated from whole blood using LymphoQwik TH isolation kit ŽOne Lambda.. The isolated cells were activated with 15 ngrml phorbol-ester ŽPMA, Sigma. and 350 ngrml ionomycin ŽSigma. for 5 h. Pooled rabbit complement was added and incubated for an additional hour. Cell lysis was determined by flow cytometry using DNA staining by propidium iodide ŽBoehringer Mannheim, Indianapolis, IN. on a FACscan instrument using FACscan Research software ŽBecton-Dickinson.. Percent specific lysis was determined by subtracting FL2 positive population of samples incubated with IDEC-131 from the FL3 positive population of a sample containing 0 m grml IDEC-131. Evaluation of IDEC-131’s ability to mediate Antibody Dependent Cellular Cytotoxicity ŽADCC. was

tested on human peripheral blood cells. The cells were activated by incubation for 24 h with 10 unitsrml of IL-2 ŽBoeringer Mannheim, Indianapolis, IN.. 50D4 cells, labeled with 51 Chromium, were incubated for 30 min with serially diluted aliquots of IDEC-131. The IL-2 activated effector cells were added to each well containing antibody coated 50D4 cells Ž80:1 ratio. and incubated for an additional 4 h at 378C. Maximal and spontaneous release controls were measured using 1% Triton X-100 and media. The supernatant from each well was collected and the amount of radioactivity was counted on a gamma counter. 2.15. Suppression of humoral responses in monkeys Four groups of cynomolgus monkeys Ž Macaca fascicularis. were used; each group contained two males and one female. The average body weight of these animals was 3 kg. Following sedation with ketamine, 100 m g of ovalbumin in alum was administered intramuscularly to all animals on study days 0 and 42. In addition, the IDEC-131 antibody was administered as four weekly intravenous doses beginning on day 0 followed by four weekly intravenous doses beginning on day 42; the doses given to each monkey in Groups I through IV were 0, 0.2, 1.0 or 5.0 mgrkg, respectively. The anti-ovalbumin response was then measured weekly, beginning on day 7, for 11 weeks; plasma samples were also assessed by ELISA for the IDEC-131 antibody concentration, as well as for anti-immunoglobulin responses. The animals were monitored daily for general health and their body weights recorded weekly throughout the study; serum chemistry, hematology and urinalysis evaluations were also performed periodically throughout the study. 2.16. Effect of IDEC-131 on monkey lymphocyte sub-populations Eight cynomolgus monkeys were divided equally between two groups, with each group comprised of two males and two females. Group A animals received formulation buffer only Ž10 mM sodium citrate, pH 6.5, containing 150 mM sodium chloride and 0.02% Tween 80. while Group B animals received four weekly infusions of 50 mgrkg of IDEC-

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

131 antibody. Blood samples were collected from each animal on study days y7 and y1 Žpre-dose., and on days 1, 8, 15, 22, and 29. Animals were infused with formulation buffer or 20 mgrkg of IDEC-131 antibody on study days 1, 8, 15, and 22. Blood samples were analyzed by flow-cytometry using antibodies ŽBecton-Dickinson. to detect CD3 q , CD4 q , CD8 q and CD20 q cells. Both absolute numbers and relative distribution was determined. Blood samples were collected at prescribed points and the plasma IDEC-131 antibody concentrations determined. 2.17. Pharmacokinetics of IDEC-131 in cynomolgus monkeys Three groups of cynomolgus monkeys were used; each group contained two males and one female. The average body weight of these animals was 3 kg. Following sedation with ketamine, 100 m g of ovalbumin in alum was administered intramuscularly to all animals on study day 0. In addition, the IDEC-131 antibody was administered in one bolus injection on the same day. The doses given to each monkey in Groups I through III were 0.2, 1.0 or 5.0 mgrkg, respectively. The levels of IDEC-131 was measured in plasma drawn at various time points for a total of 6 weeks by ELISA. The animals were monitored daily for general health and their body weights recorded weekly throughout the study; serum chemistry, hematology and urinalysis evaluations were also performed periodically throughout the study. An abbreviated list of the variables in the serum chemistry analysis included glucose, creatinine, urea nitrogen, phospholipids, total protein, electrolytes, alkaline phosphatase, lactate dehydrogenase and total bilirubin. An abbreviated list of the variables in the hematology analysis included red blood cell count, hematocrit, platelet count, white blood cell count, reticulocyte count and blood cell morphology. An abbreviated list of the variables in the urinalysis included pH, protein, specific gravity, glucose, ketones and bilirubin. 2.18. Chimpanzee safety study Seven animals were randomly assigned to one of three study groups. The two animals in Group 1

283

received formulation buffer, while the three animals each in Groups 2 and 3 received 5 and 20 mgrkg IDEC-131, respectively. Each animal received five weekly infusions over a 28-day period. Blood samples for flow-cytometric analysis of lymphocyte subsets were collected three times, at weekly intervals, prior to treatment, and at weekly periods during and following treatment; these continued for 4 weeks following the last infusion. Sera from these samples were analyzed by ELISA for IDEC-131 concentrations and for the presence of anti-immunoglobulins; the lower limits of detection for these assays were 27 and 96 ngrml, respectively. Additional blood samples were collected from all animals on study day 129, and biweekly thereafter from one chimpanzee each in Groups 1 Žcontrol. and 3 Ž20 mgrkg dose group. through day 198. 2.19. ELISAs Levels of total human IgG and of anti-TT IgG in the culture supernatants were determined essentially as described previously w41x. IDEC-131 levels were determined by binding to the CD154-transfected CHO cell line, 50D4. Fifty microliters of serially diluted supernatant or purified antibody were added to 50D4 coated plates for 2 h at room temperature. The presence of antibody was revealed with a secondary antibody conjugated to HRP Žas above., and compared to a known amount of IDEC-131 standard.

3. Results 3.1. Sequences of the 24–31 Vk and VH gene segments The antibody V regions were amplified from the hybridoma cell line 24–31 by PCR utilizing a panel of 5X primers specific for Vk or VH leader sequences in combination with 3X constant region primers w27x. The nucleotide and deduced amino acid sequences of the 24–31 V regions are shown in Fig. 1. The Vk is a member of subgroup V containing a Jk 2 segment, and the VH is a member of subgroup IA and the 36–60 VH family with a JH 2 segment w28x. There are no potential V region N-linked glycosylation sites.

284

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

Fig. 1. The nucleotide and deduced amino sequences of the ŽA. Vk and ŽB. VH of murine anti-human gp39 antibody 24–31. The leader, X framework ŽFR. and CDR regions are labeled. The 5 V region cloning sites Ž BglII for Vk and SalI for VH . are upstream of their ATG X translation initiation signals and the 3 BsiWI cloning sites are located at amino acid positions 108–109 for Vk and 114–115 for VH Žnumbering according to Kabat w28x..

3.2. Humanization and expression of the 24–31 antibody

prolines, were preserved as much as possible in the humanized versions.

Our approach to humanization, described earlier by Padlan w31x, was to graft the murine 24–31 complementarity determining regions ŽCDRs. onto human framework and constant regions, while retaining critical murine framework residues predicted to influence the structure of the combining site. The sequences of the human V region counterparts used as templates for the design of the humanized 24–31 versions are listed in Fig. 2. The templates were selected on the basis of high overall similarity with 24–31, as well as in certain important residues; i.e., those which are predicted to be in the VL :VH interface, in contact with the CDR’s, or inward-pointing. In addition, the electrostatic charge of the Fv and certain amino acid residues, such as glycines and

3.3. Binding of IDEC-131 to CD154 In order to determine if the 24–31 humanized antibody had maintained its binding activity to CD154 relative to the original murine 24–31 antibody, the antibodies were compared in three assays. One, direct binding to 50D4 CHO cell transfectant that expresses cell surface CD154; two, competition with murine 24–31 for binding to 50D4 cells and, three, for affinity to CD154 by Scatchard analysis. In the direct binding assay, binding of dilution series of murine 24–31 and IDEC-131 to 50D4 cells were compared ŽFig. 3A.. The figure shows that half-maximal binding was achieved at around 40 and 20 ngrml for murine 24–31 and IDEC-131, respec-

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

285

Fig. 2. Amino acid sequence comparisons of ŽA. Vk and ŽB. VH domains of the murine and humanized versions of 24–31 and the human V region templates. Humanized VL and VH versions contain CDR regions identical to the murine 24–31 parent. The humanized VL framework region was designed utilizing the germline DPK9 gene sequence w42x and the Jk 2 joining segment w28x; the humanized VH framework region was designed using the human germline DP-71 w43x and the JH 6 joining segment w28x. Stars indicate gaps introduced in the sequences for alignment and dashes denote sequence identity.

tively. In repeat assays, the humanized antibody consistently bound better than the murine parent. In the competition assay, IDEC-131 was as effective a competitor of murine 24–31 for binding to CD154, as the murine antibody itself ŽFig. 3B.. The retention of affinity of IDEC-131 for CD154 was confirmed by Scatchard analysis, Žsee Fig. 4.. The derived K d values were 8.51 and 5.60 nM for the murine 24–31 and IDEC-131 antibodies, respectively. From these results, we concluded that IDEC131 had an equal or better affinity relative to murine 24–31, and is consistent with the observation that the humanized antibody showed half-maximal binding at a lower concentration than the 24–31 murine antibody. The K d values were later confirmed using a system developed by IGEN ŽGaithersburg, MD, ORIGEN w Analyzer. using chemiluminescense. 3.4. IDEC-131 blocks binding of soluble CD154 to CD40 on B cells The ability of IDEC-131 to block the interaction between CD154 and its receptor, CD40, is critical

for the antibody’s potential therapeutic activity. Inhibition of binding of CD154 to CD40 was tested using soluble CD154-CD8 fusion protein w36x and CD40q WIL2-S cells. As shown in Fig. 5, IDEC131, but not control antibody, was effective in inhibiting the CD154–CD40 interaction, yielding a 50% inhibition at 1 m grml and 100% inhibition at 6 m grml. 3.5. Blocking of B cell proliferation and differentiation by IDEC-131 in Õitro 3.5.1. Inhibition of soluble-CD154 induced proliferation To determine whether IDEC-131 has retained its ability to block B cell activation, two in vitro assays were employed, Ža. CD154-induced in vitro B cell proliferation and Žb. T cell dependent B cell differentiation. In the B cell proliferation assay, purified soluble CD154–CD8 induced B cell proliferation in a dose-dependent manner in the presence of IL-4 ŽFig. 6A.. B cells cultured in the absence of CD154–

286

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

Fig. 3. Binding of humanized antibodies to CD154. 50D4 cells were used as targets in a cell based ELISA to determine binding activity of 24–31 Ž-I-. and IDEC-131 Ž-B-.. ŽA. Direct binding of a dilution series of the two antibodies was visualized via HRP-labeled secondary antibodies. ŽB. 200 ngrml, biotin labeled 24–31 was competed for binding to 50D4 cells by the three antibodies in dilution series. Competition was visualized via HRP-labeled avidin. Similar experiments have been repeated thrice, with similar outcome.

CD8 served as controls. In this assay B cell proliferation induced by 10 m grml of CD154–CD8 plus IL-4 was effectively inhibited by IDEC-131 at concentrations 5 m grml ŽFig. 6B.. 3.5.2. Inhibition of B cell differentiation In the second assay, anti-CD3-activated human peripheral blood T cells, mitomycin C-treated, were used to stimulate autologous B cells to produce IgM and IgG in the presence of murine 24–31 and IDEC131. The results show that maximum inhibition of

both IgM ŽFig. 7A. and IgG ŽFig. 7B. production was observed at 1 ngrml IDEC-131. In this assay, the humanized antibody was consistently a more potent inhibitor of the B cell differentiation that the parent antibody 24–31, in line with its higher affinity. IDEC-131 Fab’1 fragments had a similar potency as the whole antibody ŽFig. 8., indicating that IDEC131 inhibits B cell differentiation solely by blocking CD154–CD40 interaction, and is unaffected by cross-linking via Fc receptors found on B cells and activated T cells. Since the test for IgG cannot

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

287

antibodies after 12 days. The levels of anti-TT IgG was undetectable in cultures without TT and were 1.85 m grml in cultures with TT. The results show Žsee Fig. 9. that IDEC-131 at 1 m grml inhibited TT specific antibody production by ; 80%, both in cultures without added lymphokines and in cultures containing IL-4 and IL-10. Under these conditions, total IgG production was inhibited ; 5% Žnot shown.. 3.6. In Õitro effector functions In order to evaluate the ability of IDEC-131, g 1, k , to recruit effector functions, and thus its potential to induce depletionrlysis of CD154q cells, we tested IDEC-131 for Fc-receptor binding and ability

Fig. 4. Determination K d values of 24–31 and IDEC-131 for binding to CD154. Binding of a fixed amount of 125 I labeled antibody with various amount of non-labeled competing antibody, from 1r10 to 100=, was used to generate Scatchard plots Žbound vs. boundrfree., for each of both antibodies, murine 24–31 and IDEC-131. The linear line represents the linear polynomial regression analysis on the data points. The curve formulae are listed together with S.E.M. values. K d , y1rslope, is recorded for each of the antibodies in bold. The K d for both antibodies has been determined three times and by other methods, with similar results.

distinguish between exogenously added IDEC-131 and cell produced IgG, the amount of IgG measured represent the amount of IDEC-131 plus the amount of culture produced IgG. Due to the amount of IgG produced by the cells Ž; 800 ngrml., this has no significant effect on the results obtained from cultures containing 0.1–100 ngrml of IDEC-131. 3.5.3. Inhibition of antigen induced B cell actiÕation The effect of IDEC-131 on B cell responses to TT was tested on human spleen cells cultured in vitro with IDEC-131 and TT in medium containing 5%, IgG depleted, monkey serum. The supernatants were tested for content of total IgG and anti-TT IgG

Fig. 5. Inhibition of CD154 binding to CD40 on WIL2-S cells by IDEC-131. WIL2-S cells were incubated with 800 ngrml CD154–CD8 fusion protein labeled with biotin. The amount of bound CD154 was detected with HRP labeled avidin. Inhibition by IDEC-131 Ž-v- . was determined in comparison with an isotype matched human control antibody, cRF-2 Ž-%-.. Maximum binding was determined in the absence of any added antibody. Maximum inhibition was determined in the presence of 100= non-labeled CD154–CD8 fusion protein. The data shown were calculated from three independent experiments. 800 ngrml CD154–CD8 fusion protein resulted in half maximal binding to the WIL2-S cells. Similar experiments with comparable outcomes have been repeated more than 10 times.

288

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

Fig. 6. Inhibitory effect of IDEC-131 on soluble CD154-induced proliferation of human B cells. Different concentrations of IDEC-131 were incubated with purified B cells cultured with 10 m grml CD154–CD8 in the 4-day proliferation assay. Lymphocyte preparations from buffy coats were enriched for B cells Ž) 98%. and cultured with 1000 Urml IL-4 at 1 = 10 5 cells per well in 96-well dishes. During the final 16 h of incubation, the cultures were pulsed with 1 m Cirwell of 3 H-thymidine and the incorporation of radioactivity by proliferating cells was measured ŽCPM.. The proliferation obtained in B cell cultures without CD154–CD8 was used as the background and subtracted from the test culture stimulated with CD154–CD8. Cells cultured with pokeweed mitogen ŽPWM. plus IL-4 served as positive control for B cell proliferation. Similar experiments with comparable outcomes have been repeated twice.

to mediate lysis of target cells in CDC and ADCC Žsee Table 1.. IDEC-131 bound C1q effectively Žnot shown. and resulted in 80% target-cell lysis in a CDC assay using CD154 transfected CHO cells, 50D4, as targets. However, in a CDC assay using activated T cells as targets, no lysis was observed. Activated T cells express CD154 at a density 20– 50-fold lower than the transfected CHO cells Žnot shown.. IDEC-131 showed strong binding to Fcg RI and Fcg RII as would be expected from a human g 1 construct Žnot shown.. However, in the Fcg RIII mediated functional ADCC assay, the antibody failed to course significant target cell lysis using 50D4 CHO cells. 3.7. Suppression of humoral responses in cynomolgus monkeys To assess to potential clinical utility of IDEC-131 antibody, we analyzed the immunosuppressive effect

of the IDEC-131 antibody in cynomolgus macaques that were simultaneously immunized with ovalbumin. In vitro studies had demonstrated that IDEC-131 antibody bound activated monkey T cells, as well as it bound activated human T cells Ždata not shown., validating the macaque as a test vehicle. The results show that after a booster immunization on study day 42, animals in the 0, 0.2 and 1.0 mgrkg dose groups developed strong and long lasting anti-ovalbumin responses Žsee Fig. 10.. The slightly different responses observed among the three Groups I, II and III, were not statistically significant. However, the animals treated with a dose of 5.0 mgrkg of IDEC131 antibody failed to produce both primary and secondary immune responses to ovalbumin. The responses in this group were statistically different from those by Group I animals Ž p - 0.05.. Thus, the minimally effective dose in cynomolgus macaques should be between 1 and 5 mgrkg.

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

289

Fig. 7. Blocking of in vitro B cell differentiation by IDEC-131. Human T and B cells from a buffy coat were individually isolated. Mitomycin C-treated T cells, 4 = 10 5 cellsrwell, activated with mitogenic anti-CD3 antibody were incubated with B cells, 1 = 10 6 cellsrwell, together with varying amounts of IDEC-131 Ž-B-. or murine 24–31 Ž-v- .. After 12 days, supernatants were tested for ŽA. IgM and ŽB. IgG content by ELISA. The IgG assay does not distinguish between IDEC-131 and IgG produced by the B cells; therefore, the IgG content measured in cultures containing ) 0.1 m grml IDEC-131 reflects the level of IDEC-131 in the culture. B cells alone Ž\. was used as baseline. Similar experiments with comparable outcomes have been repeated more than 10 times. Data represents the mean of samples tested in triplicates.

Infusions of IDEC-131 antibody were well tolerated, and no significant changes in hematology Žwhite

blood cell count and differential determinations. or serum chemistry parameters Žmeasurement of vari-

Fig. 8. Blocking of in vitro B cell differentiation by IDEC-131 Fab’1. The B cell differentiation assay was set up as described under Fig. 7, except that the ability of IDEC-131 Fab’1 fragments ŽPP`PP. to inhibit T cell dependent B cell differentiation were compared to whole antibody Ž-v- .. B cells alone Ž-\-. were used to determine baseline IgG production. IDEC-131 Fab’1 fragments were prepared from whole antibody by digestion with papain bound to a solid phase. Fab’1 fragments were collected from a protein A column effluent, and extensively dialyzed. The purity and the concentration of the IDEC-131 Fab’1 antibody was determined based on analysis of SDS-PAGE and total protein content. Similar experiment with a comparable outcome was repeated once. Data represents the mean of samples tested in triplicates.

Fig. 9. Effect of IDEC-131 on lymphokine supported TT driven B cell responses. Human spleen cells were plated at 3=10 6 cellsrml in 48-well plates"IL-4 and or IL-10. To these cultures, a serial dilution of IDEC-131 was added. An isotype-matched control was used as negative control for minimum inhibition. The B cell responses were measured as TT specific IgG. Supernatant was harvested after a 10-day incubation, and tested in antigen-specific ELISA. Anti-TT IgG production without TT was below detectable levels, -1 ngrml. Anti-TT IgG production was 1.85 m grml Ž-v- ., 1.35 m grml Ž-%-., 0.72 m grml Ž-B-. and 0.35 m grml Ž-e-., respectively. Similar experiments with comparable outcomes were repeated in various forms at least three times. Data represents the mean of samples tested in triplicates.

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

290

Table 1 Summary of in vitro effector function activity of IDEC-131 Target cells

CD154 CHO Cells Activated T Cells

Assay CDC

ADCC

80.7% cell lysis 0% cell lysis

- 20% cell lysis ND

NDs not done.

ous electrolytes, serum enzymes and serum proteins. were noted. Finally, no changes were observed in the general health of the animals Žappetence and body weights.. None of the animals from the study were sacrificed for necropsy and histopathology. Results similar to the ones described here were noted in a separate pharmacokinetic study using the same monkey species. 3.8. Pharmacokinetics of IDEC-131 in cynomolgus monkeys In this study, the macaques received single intravenous injections of either 0.2, 1.0 or 5.0 mgrkg of IDEC-131 antibody. Detectable levels of IDEC-131 were present in all animals through day 14 and in Group III animals through day 28 Žsee Fig. 11.. The

Fig. 11. Clearance of IDEC-131 from cynomolgus monkeys. Levels of IDEC-131 was measured for each bleed of the animals that received 0.2 mg IDEC-131 per kilo Ž-I-.; 1.0 mg IDEC-131 per kilo Ž-e-.; and 5 mg IDEC-131 per kilo Ž-`-., throughout 42 days after injection of IDEC-131. The average levels and the standard deviations were calculated for each group.

calculated Cmax values for all animals ranged between 14.3 ŽGroup I. and 144.2 m grml ŽGroup III. and increased proportionally with dose between the 1.0 and 5.0 mgrkg doses Žnot shown.. Using data from a two-compartment analysis, the beta half-life values, calculated for the three dose groups, were similar and ranged from 4.7 to 6.0 days. Similarly, pharmacokinetic data from a subsequent study in

Fig. 10. Anti-ovalbumin IgG response in cynomolgus macaques. Two males and one female were placed in each of four dose groups. All animals received intramuscular injections of ovalbumin and alum on days 0 and 42. Group I Ž-I-. received just buffer, whereas groups II Ž-e-., III Ž-`-., and IV Ž-^-. animals received intravenous infusions of 0.2, 1.0 or 5.0 mgrkg, respectively, of IDEC-131 antibody, on days 0, 7, 14, 21, 42, 49, 56 and 70. Endpoint titer for each monkey determined as the highest reciprocal dilution at which a positive absorbance value obtained after subtracting the absorbance of pre-study control sera. Only absorbance values above 0.05 were considered as positive. Data represents the mean of samples tested in triplicates.

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

which cynomolgus monkeys were treated weekly for 4 weeks with 20 mgrkg of IDEC-131 antibody indicated half-life values of between 5.5 and 6.4 days Žnot shown.. 3.9. Effect of IDEC-131 on lymphocyte subsets in cynomolgus monkeys In a study to assess the effects of the IDEC-131 antibody on lymphocyte populations, four cynomolgus monkeys were treated weekly for 13 weeks with 50 mgrkg of IDEC-131 antibody. FACS analysis of PBL lymphocyte subsets of antibody treated monkeys demonstrated no changes from baseline for any T- or B-cell values Žnot shown.. Also, there were no changes observed in general health of the animals as measured by appetence, body weights, body temperature and blood pressure. Hematology, clinical chemistry and urinalysis data also indicated the absence of IDEC-131 antibody-related effects. At sacrifice, no test-article effects were noted following histopathologic analysis of various tissues except for the expected reduction in germinal centers w17x. 3.10. Effects of IDEC-131 antibody in chimpanzees Finally, IDEC-131 was further evaluated in a study using chimpanzees. Seven animals received five weekly infusions of either formulation buffer ŽGroup 1., 5 mgrkg ŽGroup 2. or 20 mgrkg ŽGroup 3. of IDEC-131. Flow cytometric data supported results obtained from antibody treated cynomolgus macaques and demonstrated that no treatment-related effects on the absolute values or relative percentages of T and B lymphocyte subsets were noted. Also, no treatment related effects were observed on the general health of the chimpanzees, as noted by the absence of effects on body weights, appetence, blood pressure, body temperature and respiration rate. Similarly, no effects were noted in the various serum chemistry and hematology parameters evaluated. In addition, pharmacokinetic data indicated that the Cmax and AUC values increased proportionally with the dose, and that the T1r2 values for the 5 and 20 mgrkg dose groups were comparable at 13.4 and 13.8 days, respectively. No anti-immunoglobulin responses were detected in any chimpanzee.

291

4. Discussion The CD40–CD154 interaction plays a central role in establishment of cognate immune responses. It is also an interaction that appears to exhibit little redundancy, unlike many other receptor-ligand pairs involved in intercellular interactions. Blocking of CD154 engagement with its receptor, therefore, provides an effective method of controlling and modulating immune responses associated with T cell activation. Inhibition of the CD40–CD154 interaction has been extensively investigated, particularly in murine autoimmune models using the hamster antiCD154 antibody MR1 Že.g., Refs. w19,20x.. These studies have shown the significant potential of applying CD40–CD154 blocking antibodies in treatment of autoimmune diseases. In most autoimmune indications chronic treatment may be required; therefore, non-immunogenic antibodies are necessary to maintain clinical efficacy. For this purpose, humanization of the murine 24–31 antibody was carried out and the lead IDEC-131 antibody identified. The studies presented here were undertaken in order to determine that humanization did not result in significant loss of affinity, specificity or functional activity of the murine 24–31 anti-CD154 antibody. In addition, we wanted to determine that the humanized antibody would block T cell dependent humoral responses in a pre-clinical primate model, and would not exhibit any obvious safety concerns. The humanized antibody performed essentially as expected in biochemical and biological assays. The functional tests showed that the humanized antibody, IDEC-131, effectively blocked co-stimulation in vitro. This notion was supported by the primate studies, where an antibody dose of 5.0 mgrkg completely inhibited primary and secondary responses to ovalbumin in cynomolgus monkeys. One of the unexpected findings was that IDEC-131 had a slight but reproducibly higher affinity than the parent antibody, which was reflected in the ability to compete for binding to CD154. Humanizations of antibodies commonly lead to a loss of affinity in the range of 2to 3-fold. Such a loss may have resulted in an antibody with reduced practical application, if this was reflected in the need for a significantly higher clinically effective dose.

292

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

Although the antibody did bind C1q and Fcg receptors, meaningful effector function levels did not appear to be recruited by the levels of antibody bound to activated peripheral blood derived T cells. Only IDEC-131 bound to CHO cell transfectants, expressing CD154 at levels around two orders of magnitude higher than the activated T cells, were able to recruit CDC. These results support in vivo data in primates, which showed no T cell depletion after multiple injections of high doses of IDEC-131. In addition, there are no data that indicate Fc receptor binding is required for the functional activity, as the Fab1 fragments of the antibody performed essentially as the whole antibody. This conclusion was further supported by data showing that an IgG4 version of the antibody performed indistinguishably from IDEC-131 in inhibition of T cell dependent B cell differentiation Žnot shown.. The primate data indicated that the IDEC-131 antibody is safe in cynomolgus macaques and chimpanzees when infused weekly for 5 or more weeks at doses of at least 20 mgrkg. No toxic effects were noted in any parameter evaluated, and no changes in B and T cell subsets were observed. In fact, in a cynomolgus macaque study where the animals were injected weekly for 13 weeks with IDEC-131 at 50 mgrkg, which is at least 10 times the pharmacologically effective dose, no changes in B or T cell subsets in the blood were observed relative to baseline Žnot shown.. However, monkeys treated with this dose of antibody did experience a reduction in germinal centers. This is to be expected from an antibody that blocks CD40–CD154 interaction, as studies in mice w14,17,44x and histology in Hyper IgM syndrome patients w45x show that engagement of CD40 by CD154 is essential for germinal center formation and maintenance. In mice, removal of CD40–CD154 blocking antibodies fully restores ability to respond to novel antigens with a primary ŽIgM. followed by a secondary ŽIgG. response, indicating reconstitution of germinal centers w46x. A further argument for the notion that germinal centers will regenerate after removal of the CD40–CD154 blocking antibody comes from the work by Van Essen, who showed that germinal centers, which are absent in CD40 knock-outs, are formed in these mice after treatment with CD40-Ig w14x, albeit in a somewhat rudimentary form. The regeneration issue is

currently being studied in a cynomolgus macaque model. Finally, the half-life of all tested doses in cynomolgus monkeys G 1 mgrkg of the IDEC-131 antibody was the same, ranging between 141 and 153 h, whereas the half-life in chimpanzees ranged between 329 and 332 h. It is expected that the half-life of IDEC-131 in humans would be close to that observed in chimpanzees. In conclusion, these results show that the humanized antibody IDEC-131 retained the affinity and specificity of the parent 24–31 antibody. It blocked CD154–CD40 interaction resulting in inhibition of T–B cell interactions, and prevention of antigen driven T and B cell activation. Earlier studies with rodent specific CD154 antibodies, showed that antibodies, which effectively blocked CD154–CD40 interactions in vitro, also effectively inhibited in vivo autoimmune conditions and allograft rejection in experimental animal models. Based on this finding and its safety profile, IDEC-131 is being developed for treatment of autoimmune diseases. The activities of the humanized anti-CD154 antibody IDEC-131 described in this manuscript emphasize the potential utility of this antibody in therapy of autoimmune diseases.

Acknowledgements We wish to thank Noralee Morris for her excellent help in the preparation of this manuscript.

References w1x Noelle RJ, Ledbetter JA, Arruffo A. CD40 and its ligand, an essential ligand–receptor pair for thymus-dependent B-cell activation. Immunol Today 1992a;13:431–3. w2x Noelle RJ, Roy M, Shepherd DM, Stamenkovic I, Ledbeter JA, Aruffo A. A novel ligand on activated T helper cells binds CD40 and transduces the signal for the cognate activation of B cells. Proc Natl Acad Sci 1992b;89:6550–4. w3x Banchereau J, de Paoli P, Valle A, Garcia E, Rousset F. Long-term human B cell lines dependent on interleukin-4 and antibody to CD40. Science 1991;251:70–2. w4x Jacquot S, Kobata T, Iwata S, Morimoto C, Schlossman SF. CD154rCD40 and CD70rCD27 interactions have different and sequential functions in T cell-dependent B cell responses. J Immunol 1997;159:2652–7. w5x Ranheim EA, Kipps TJ. Activated T cells induce expression

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

w6x

w7x

w8x

w9x

w10x

w11x

w12x

w13x

w14x

w15x

w16x

w17x

w18x

w19x

w20x

of B7rBB1 on normal or leukemic B cells through a CD40dependent signal. J Exp Med 1993;177:925–35. Boussiotis VA, Freeman GJ, Gribben JG, Daley J, Grey G, Nadler LM. Activated human B lymphocytes express three CTLA-4 counter-receptors that co-stimulate T-cell activation. Proc Natl Acad 1993;90:11059–63. Goldstein MD, Watts TH. Identification of distinct domains in CD40 involved in B7-1 induction or growth inhibition. J Immunol 1996;157:2837–43. Randall TD, Heath AW, Santos-Argumedo L, Howard MC, Weissman IL, Lund FE. Arrest of B lymphocyte terminal differentiation by CD40 signaling: mechanism for lack of antibody-secreting cells in germinal centers. Immunity 1998; 8:733–42. Durie FH, Foy TM, Masters SR, Laman JD, Noelle RJ. The role of CD40 in the regulation of humoral and cell-mediated immunity. Immunol Today 1994;15:406–11. Splawski JB, Fu SM, Lipsky PE. Immunoregulatory role of CD40 in human B cell differentiation. J Immunol 1993;150: 1276–85. Azuma M, Ito D, Yagita H, Okumura K, Phillips JH, Lanier LL, et al. B70 antigen is a second ligand for CTLA-4 and CD28. Nature 1993;366:76–9. Callard RE, Armitage RJ, Fanslow WC, Spriggs MK. CD40 ligand and its role in X-linked hyper-IgM syndrome. Immunol Today 1993;14:559–64. Grewal IS, Xu J, Flavell RA. Impairment of antigen-specific T-cell priming in mice lacking CD40 ligand. Nature 1995; 378:617–20. Van Essen D, Kikutani H, Grey D. CD40 ligand-transduced co-stimulation of T cells in the development of helper function. Nature 1995;378:620–3. Foy TM, Shepherd DM, Durie FH, Aruffo A, Ledbetter JA, Noelle RJ. In vivo CD40–gp39 interactions are essential for thymus-dependent humoral immunity. II. Prolonged suppression of the humoral immune response by an antibody to the ligand for CD40, gp39. J Exp Med 1993;178:1567–75. Van den Eertwegh AJM, Noelle RJ, Roy M, Shepherd DM, Aruffo A, Ledbetter JA, et al. In vivo CD40–gp39 interactions are essential for thymus-dependent humoral immunity. I. In vivo expression of CD40 ligand, cytokines, and antibody production deliniates sites of cognate T–B cell interactions. J Exp Med 1993;178:1555–65. Foy TM, Laman JD, Ledbetter JA, Aruffo A, Claassen E, Noelle RJ. gp39–CD40 interactions are essential for germinal center formation and the development of B cell memory. J Exp Med 1994;180:157–63. Stuber E, Strober W, Neurath M. Blocking the CD40L–CD40 interaction in vivo specifically prevents the priming of T helper 1 cells through the inhibition of interleukin 12 secretion. J Exp Med 1996;183:693–8. Gerritse K, Laman JD, Noelle RJ, Aruffo A, Ledbetter J, Boersma WJA, et al. CD40–CD40 ligand interactions in experimental allergic encephalomyelitis and multible sclerosis. Proc Natl Acad Sci 1996;93:2499–504. Durie FH, Fava RA, Foy TM, Aruffo A, Ledbetter JA, Noelle RJ. Prevention of collagen-induced arthritis with an

w21x

w22x

w23x

w24x

w25x

w26x

w27x

w28x

w29x

w30x w31x w32x

w33x

w34x

w35x

293

antibody to gp39, the ligand for CD40. Science 1993;261: 1328–30. Mohan C, Shi Y, Laman JD, Datta SK. Interaction between CD40 and its ligand gp39 in the development of murine lupus nephritis. J Immunol 1995;154:1470–80. Griggs ND, Agersborg SS, Noelle RJ, Ledbetter JA, Linsley PS, Tung KSK. The relative contribution of the CD28 and gp39 costimulatory pathways in the clonal expansion of the pathogeneic acquisition of self-reactive T cells. J Exp Med 1996;183:801–10. Karmann K, Hughes CCW, Schechner J, Fanslow WC, Pober JS. CD40 on human endothelial cells: inducibility by cytokines and functional regulation of adhesion molecular expression. Proc Natl Acad Sci U S A 1995;92:4342–6. Hollenbaugh D, Mischel-Petty N, Edwards CP, Simon JC, Denfield RW, Kiener PA, et al. Expression of functional CD40 by vascular endothelial cells. J Exp Med 1995;182: 33–40. Yellin MJ, Brett J, Baum D, Matsushima A, Szabolcs M, Stern D, et al. Functional interactions of T cells with endothelial cells: the role of CD40L–CD40-mediated signals. J Exp Med 1995;182:1857–64. Foy TM, McIlrath M, Masters SR, Dunn JJ, Rosini AA, Schultz LD, et al. Blockade of CD40–CD154 interferes with human T cell engraftment in SCID mice. Cell Transplant 1998;7:25–35. Jones ST, Bendig MM. Rapid PCR-cloning of full-length mouse immunoglobulin variable regions. BiorTechnology 1991;9:88–9. Errata Ž1991. BiorTechnology, 9:579. Kabat EA, Wu TT, Reid-Miller M, Perry HM, Gottesman KS. Sequences of Proteins of Immunological Imterest. 5th edn. Washington, DC: Public Health Sciences, NIH, 1991. Jones PT, Dear PH, Foote J, Neuberger MS, Winter G. Replacing the complementarity-determining regions in a human antibody with those from a mouse. Nature ŽLondon. 1986;321:522–5. Verhoyen M, Milstein C, Winter G. Reshaping human antibodies. Science 1988;239:1534–6. Padlan EA. Anatomy of the antibody molecule. Mol Immunol 1994;31:169–217. Barnett RS, Limoli KL, Huynh TB, Ople EA, Reff ME. Antibody expression and engineering. American Chemical Society Series 604, 207th National Meeting of the American Chemical Society, San Diego, CA, March 13–17, 1994. 1995:27–40. Urlaub G, Mitchell PJ, Kas E, Chasin LA, Funanage VL, Myoda TT, et al. Effect of gamma rays at the dihydrofolate reductase locus: deletions and inversions. Somatic Cell Mol Genet 1986;12:555–66. Reff ME, Carner K, Chambers KS, Chinn PC, Leonard JE, Raab R, et al. Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20. Blood 1994; 83:435–45. Boerner P, LaFond R, Lu W-Z, Brams P, Royston I. Production of antigen-specific human monoclonal antibodies from in vitro primed human splenocytes. J Immunol 1991;147: 86–95.

294

P. Brams et al.r International Immunopharmacology 1 (2001) 277–294

w36x Hollenbaugh D, Grosmaire LS, Kullas CD, Chalupny NJ, Brœst-Andersen S, Noelle RJ, et al. The human T cell antigen gp39, a member of the TNF gene family, is a ligand for the CD40 receptor: expression of a soluble form of gp39 with B cell co-stimulatory activity. EMBO J 1992;11:4313– 21. w37x Tijssen P. Burdon RH, van Knippenberg PH, editors. Laboratory Techniques in Biochemistry and Molecular Biology: Practice and Theory of Enzyme Immunoassays, vol. 15. Amsterdam, The Netherlands: Elsevier; 1993. w38x Scatchard G. J Am Chem Soc 1957;7:12–9. w39x Chamat S, Walsh EE, Anderson D, Osta M, Awaraji C, Pan L-Z, et al. Human monoclonal antibodies isolated from spontaneous EBV transformed tumors of Hu-SPL-SCID mice and specific for fusion protein display broad neutralizing activity towards respiratory syncytial virus. J Infect Dis 1999;180: 268–77. w40x Brams P, Royston I, Boerner P. In vitro immunization of human lymphocytes: I. IL-2 and IL-4 requirements. Hum Antibodies Hybridomas 1993;4:47–56. w41x Brams P, Nguyen M-L, Chamat S, Royston I, Morrow PR. Antigen-specific IgG responses from naive human spleno-

w42x

w43x

w44x

w45x

w46x

cytes: in vitro priming followed by antigen boost in the SCID mouse. J Immunol 1998;160:2051–8. Cox JPL, Tomlinson IM, Winter G. A directory of human germ-line Vkappa segments reveals a strong bias in their usage. Eur J Immunol 1994;24:827–36. Cook GP, Tomlinson IM, Walter G, Riethman H, Carter NP, Buluwela L, et al. A map of the human immunoglobulin VH locus completed by analysis of the telomeric region of chromosome 14q. Nat Genet 1994;7:162–8. Xu J, Foy TM, Laman JD, Dunn JJ, Waldschmidt TJ, Elsemore J, et al. Mice deficient for the CD40 ligand. Immunity 1994;1:423–31. Aruffo A, Farrington M, Hollenbaugh D, Li X, Milatovich A, Nonoyama S, et al. The CD40 ligand, gp39, is defective in activated T cells from patients with X-linked hyper-IgM syndrome. Cell 1993;72:291–300. Early GS, Zhao W, Burns CM. Anti-CD40 ligand antibody treatment prevents the development of lupus-like nephritis in a subset of New Zealand Black=New Zealand White mice. Response correlates with the absence of an anti-antibody response. J Immunol 1996;157:3159–64.