- Email: [email protected]
Nga mice with atopic dermatitis
Journal of Dermatological Science (2007) 46, 199—210
www.intl.elsevierhealth.com/journals/jods
A hypothetical mechanism of intraepidermal neurite formation in NC/Nga mice with atopic dermatitis Mitsutoshi Tominaga a, Sumiko Ozawa b, Hideoki Ogawa a, Kenji Takamori a,b,* a
Institute for Environmental and Gender Specific Medicine, Juntendo University Graduate School of Medicine, 2-1-1 Tomioka, Urayasu, Chiba 279-0021, Japan b Department of Dermatology, School of Medicine, Juntendo University Urayasu Hospital, 2-1-1 Tomioka, Urayasu, Chiba 279-0021, Japan Received 15 August 2006; received in revised form 20 January 2007; accepted 2 February 2007
KEYWORDS Amphiregulin; Atopic dermatitis; Cell—cell junction; Gelatinase; NGF
Summary Background: Pruritus is a symptom in atopic dermatitis (AD). Previous studies have reported that increased intraepidermal neurites are observed in AD, suggesting that the neuritogenesis is related to itching in the skin. Objective: This study was conducted to reveal the mechanism of intraepidermal neurite formation in AD. Methods: In this study, we used conventional (Conv) NC/Nga mice with AD. NC/Nga mice maintained in specific pathogen-free (SPF) condition were used as a control with no AD. Distribution of intraepidermal neurites and expression patterns of growth factors (NGF and amphiregulin (AR)) and cell—cell junctional molecules (E-cadherin, zona occludens 1 (ZO-1) and desmoglein 3 (Dsg3)) were examined in the skins by immunohistochemistry or quantitative RT-PCR. Furthermore, detection of gelatinase activity was performed with in situ zymography. The same experiments were conducted in ICR mice for comparison with NC/Nga mice. Results: Neurite density and expression levels of growth factors and gelatinase were remarkably increased in the epidermis of Conv-NC/Nga mice compared with those of SPF-NC/Nga mice. Decreased expression of E-cadherin and ZO-1 and misexpression of
Abbreviations: AD, atopic dermatitis; AR, amphiregulin; CGRP, calcitonin-gene-related peptide; Conv, conventional; DAPI, 40 60 diamidino-2-phenylindole hydrochloride; Dsg3, desmoglein 3; NGF, nerve growth factor; PBS, phosphate-buffered saline; PGP9.5, protein gene product 9.5; RT-PCR, reverse transcriptase polymerase chain reaction; SD, standard deviation; Sema3A, semaphorin 3A; SP, substance P; SPF, specific pathogen-free; ZO-1, zona occludens 1 * Corresponding author at: Department of Dermatology, School of Medicine, Juntendo University Urayasu Hospital, 2-1-1 Tomioka, Urayasu, Chiba 279-0021, Japan. Tel.: +81 47 353 3171; fax: +81 47 353 3178. E-mail address: [email protected] (K. Takamori). 0923-1811/$30.00 # 2007 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jdermsci.2007.02.002
200
M. Tominaga et al. Dsg3 were also observed in the atopic skins. In comparison with ICR mice, increases of neurite density and gelatinase activity were found in the skins of SPF-NC/Nga mice but expression levels of growth factors and cell—cell junctional molecules were unchanged. Conclusions: Increases of growth factors and gelatinase activity may be related to neurite outgrowth in the epidermis of atopic NC/Nga mice. Additionally, abnormal expressions of cell—cell junctional molecules in the epidermis may provide intercellular spaces for the neurite formation. # 2007 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
1. Introduction Atopic dermatitis (AD) is frequently associated with skin dryness and elevated serum levels of IgE antibodies against many kinds of inhaled allergens [1—3]. Patients with AD often complain of intense itching and excessive scratching. It is one of the most important symptoms in AD, and is consequently a major diagnostic criterion for AD [4]. In a process known as the itch-scratch cycle, scratching leads to increased itching and aggravated skin lesions in AD patients [3]. Therefore, reduction of itching and scratching is an effective strategy for preventing aggravation of skin lesions and improving the quality of life for AD patients [5]. Histamine is the best-known pruritogen and has been regarded as a main treatment for antipruritic therapies [6,7]. However, in some cases the pruritus is uncontrolled by antihistamine treatment [6]. This discrepancy may be due either to an intrinsic downregulation of neuronal H1-receptor density or affinity, or an increased histamine degradation in atopic skin [7,8]. Rukwied and colleagues have also demonstrated that pruritus induced by the mast cell degranulating substance compound 48/80 in AD patients could not be relieved by cetirizine H1 blockade [9]. Furthermore, in ddy mice, subcutaneous injection of the compound 48/80 elicited scratching behavior in the injected sites, but histamine was without significant effects [10]. These results suggest that other mediators such as proteinases and cytokines are additionally involved in the pathophysiology of itch response during AD [7]. Nerve growth factor (NGF) has effects on neurite outgrowth and neuronal survival [11—13]. The sprouting of intraepidermal neurites that is initiated by increased NGF is found in AD patients [14—16] and NC/Nga mouse, which is an AD model [17—20]. In addition, remarkably increased density levels of intraepidermal neurites and elevated plasma levels of NGF have been found to correlate with the severity of the disease in AD [21,22]. These findings suggest that the lesioned skin is susceptible to any stimulation and sensitive to itching. A recent study
of NC/Nga mice has demonstrated that anti-NGF antibodies significantly inhibited both intraepidermal neurite formation and scratching behavior but did not ameliorate scratching already developed [23]. This suggests that epidermal neurite outgrowth is related to itching in the atopic skin, probably explaining why antihistamines are frequently not efficient in AD. Thus, the participation of NGF in the epidermal innervation has been clarified in atopic skin. However, the other mechanism regulating the intraepidermal neurite formation is poorly understood. In the present study, neurite density, expression patterns of growth factors and cell—cell junctional molecules, and gelatinase activity were examined in NC/Nga mice. Interestingly, unlike NC/Nga mice, ICR mice are good responders for scratching behavior against histamine [24]. However, in ICR mice cohabitated with atopic NC/Nga mice, the number of scratching was less than half the number in NC/ Nga mice cohabitated with atopic NC/Nga mice [25]. It is unclear why such difference of scratching behavior appears, but this may be due to a high density of intraepidermal neurites in NC/Nga mice. To address this issue, ICR mice were also used for comparison with NC/Nga mice. Based on the histological analyses in these mice, we here describe a hypothetical model of intraepidermal neurite formation in AD.
2. Materials and methods 2.1. Animals All animal procedures were approved by the institutional Animal Care and Use Committee at Juntendo University Graduate School of Medicine and conformed to the guidelines for the use of laboratory animals of the National Institutes of Health. Male NC/Nga mice (SLC Japan, Shizuoka, Japan) were maintained in specific pathogen-free (SPF) or airuncontrolled conventional circumstances and provided with food and tap water ad libitum. In this
Intraepidermal neurite formation in atopic NC/Nga mice
201
study, we used conventional (Conv) NC/Nga mice at the age of 8—12 weeks that manifested mild to severe skin lesions similar to atopic dermatitis (AD). NC/Nga mice maintained in the SPF condition were used as a control with no AD. For comparison with NC/Nga mice, male ICR mice (SLC Japan) at the age of 8—12 weeks were used, and they were maintained in the SPF condition.
temperature. The sections were mounted in vectashield mounting medium with 40 ,60 -diamidino-2-phenylindole hydrochloride (DAPI) (Vector Laboratories, Ltd., Peterborough, UK). Immunolabeling controls were performed by omitting primary antibodies in the procedure. Fluorescence specimens were viewed with a confocal laser scanning microscope DMIRE2 (Leica).
2.2. Antibodies
2.4. In situ zymography
Primary antibodies used in this study were as follows; rabbit anti-product gene protein 9.5 (PGP9.5, 1:4000; BIOMOL International L.P., PA, USA), rabbit anti-nerve growth factor (NGF, 1:2000; Chemicon, Temecula, CA, USA), rabbit anti-zona occludens 1 (ZO-1, 1:200; Zymed Laboratories Inc., South San Francisco, CA, USA), rat anti-nidogen (1:500; Chemicon), rat anti-E-cadherin (1:200; Zymed Laboratories Inc.), goat anti-amphiregulin (AR, 1:20; R&D Systems, Inc., Minneapolis, MN, USA), goat antidesmoglein 3 (Dsg3, 1:100; Santa Cruz Biotechnology, CA, USA). Secondary antibodies conjugated with Alexa 488 or Alexa 594 used in this study were obtained from Molecular Probes (Eugene, OR, USA).
In situ zymography was performed with modifications as described previously [26]. Briefly, cryosections without fixation were washed with PBS, overlaid with 50 mg/ml DQ-gelatin (Molecular Probes), and incubated for 3 h at 37 8C in a humidified chamber. The samples were then observed with a confocal laser scanning microscope DMIRE2 (Leica).
2.3. Immunohistochemistry Mice were perfused through the left ventricle with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) under anesthesia with ether. After perfusion, the skins were removed from the neck and immersed in the same fixative for 1 h at 4 8C. Small pieces of the skins were immersed successively in PBS solution containing 10%, 15% or 20% sucrose. They were embedded in OCT compound and frozen in liquid nitrogen. Cryosections (thickness 4— 20 mm) were cut using a CM1850 cryostat (Leica, Wetzlar, Germany) and mounted on silane-coated glass slides. After blocking in PBS with 5% (v/v) normal donkey serum (Chemicon) and 2% BSA (Sigma, St. Louis, MO, USA), cryosections were incubated with primary antibodies overnight at 4 8C. After washing with PBS, the sections were incubated with secondary antibodies for 1 h at room
2.5. Total RNA preparation from epidermal sheets Skins of mice were incubated with 0.25% trypsin/ 1 mM EDTA solution (Nakarai tesque Inc., Kyoto, Japan) for 16 h at 4 8C. After the trypsinization, epidermal sheets were separated from the skin using forceps. Total RNA from the epidermal sheets was isolated with Rneasy1 Mini Kit (QIAGEN K.K., Tokyo, Japan) according to the manufacturer’s protocol.
2.6. Quantitative RT-PCR analysis Reverse transcription (RT) reaction was done with ExScriptTM RT reagent kit (TaKaRa, Kyoto, Japan) according to the manufacturer’s protocol. Quantitative RT-PCR (qRT-PCR) analysis was performed using the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, CA, USA), based on the SYBR-Green method. The primers used in this study are listed in Table 1. They were designed to meet specific criteria and were synthesized by Perfect Real Time support system (TaKaRa). The qRT-PCR reaction mixture consisted of 0.2 mM of each primer, 1 SYBR1 Premix EX TaqTM (Perfect
Table 1 Sequences of primer pairs used for qRT-PCR analysis Gene NGF
Product (bp) 62
AR
117
b-actin
131
NGF, nerve growth factor; AR, amphiregulin.
Primer
Sequence (50 -30 )
Forward Reverse Forward Reverse Forward Reverse
TTTCTATACTGGCCGCAGTGA TGATCAGAGTGTAGAACAACATGGA TCCATGCACTGCCAAGTTTCA TCTCCACACCGTTCACCAAAGTAA TGACAGGATGCAGAAGGAGA GCTGGAAGGTGGACAGTGAG
202 Real Time) premix reagent (TaKaRa), and 50 ng cDNA to a final volume of 25 ml. The PCR was performed with 40 cycles (denaturation at 95 8C for 5 s, primer annealing and elongation at 60 8C for 30 s). The PCR specificity was confirmed by dissociation curve analysis and gel electrophoresis. The gene expressions were calculated relative to expression of b-actin. The qRT-PCR analyses in this study were performed at least three times.
M. Tominaga et al. NC/Nga mice, increased expression of NGF was observed in the epidermis of Conv-NC/Nga mice (Fig. 1E). Furthermore, qRT-PCR analysis for NGF gene expression was conducted in the epidermal sheets from ICR and NC/Nga mice (Fig. 1F). Transcripts for NGF were detected in the epidermis of ICR and NC/Nga mice, and the expression was significantly increased only in Conv-NC/Nga mice.
2.7. Quantification and statistical analysis
3.2. Expression of epidermal amphiregulin in ICR and NC/Nga mice
To quantify the intraepidermal neurite number, five mice per group were used in each experiment, and three specimens in each mouse were stained with an anti-PGP9.5 antibody. In confocal microscopic analysis, optical sections of 0.9 mm thickness were scanned through the z-plane of the stained specimens (thickness 20 mm). Three-dimensional reconstruction of the images was done with Leica Confocal Software (Leica). For measurement of the intraepidermal neurite number, at least 25 confocal images were analyzed per group in each experiment. The number of intraepidermal neurites per 1.6 105 mm2 in the images was hand-counted by two researchers. All values were presented as mean standard deviation (S.D.) from three independent experiments. Non-parametric Mann—Whitney’s U-test was used for statistical analyses.
In previous studies, amphiregulin (AR) has been reported to promote neurite outgrowth [30,31]. To examine the AR expression in ICR and NC/Nga mice, the skins were stained with an anti-AR antibody. AR proteins were slightly expressed in the epidermis of both ICR and SPF-NC/Nga mice (Fig. 2A). In contrast, the expression level was increased only in the epidermis of Conv-NC/Nga mice (a right panel in Fig. 2A). The proteins were also localized in the plasma membrane of basal cells, whereas they were diffused in the suprabasal layer. To further confirm the immunohistochemical results, qRT-PCR analysis was conducted in the epidermal sheets from ICR and NC/Nga mice (Fig. 2B). Transcripts for AR were detected in the epidermis of ICR and NC/Nga mice, and the expression was significantly increased only in Conv-NC/Nga mice, as well as an increased NGF level.
3. Results
3.3. Gelatinase activity in skins of ICR and NC/Nga mice
3.1. Distribution of intraepidermal neurites and expression of epidermal NGF in ICR and NC/Nga mice The distribution of intraepidermal neurites was examined immunohistochemically in the skins of ICR and NC/Nga mice. In this experiment, we used antibodies against PGP9.5 for the staining of peripheral nerves [27,28] and nidogen for the staining of basement membranes [29]. In ICR mice, PGP9.5-positive neurites were occasionally present in the epidermis (Fig. 1A and D). Many more PGP9.5-positive intraepidermal neurites were observed in SPF-NC/Nga than in ICR mice (Fig. 1B and D). In the skin lesions of Conv-NC/ Nga mice, the number of intraepidermal neurites was significantly increased over SPF-NC/Nga mice (Fig. 1C and D). Previous studies have reported an increase of NGF levels in the epidermis of atopic NC/Nga mice [19,20]. To confirm the expression level of NGF in ICR and NC/Nga mice, the skins were stained with an anti-NGF antibody. In comparison with ICR or SPF-
Gelatinase activity in skins of ICR and NC/Nga mice was analyzed by in situ zymography. In the skins of both ICR (Fig. 3A) and SPF-NC/Nga (Fig. 3B) mice, gelatinase activity was detected in the granular layer. The level of gelatinase activity in SPF-NC/ Nga mice was higher than that of ICR mice (insets in Fig. 3A and B). In contrast, in Conv-NC/Nga mice, the activity was detected in the suprabasal layer including the spinous and granular layers, and a high level of activity was observed in the lesional skins compared with that of SPF-NC/Nga mice (Fig. 3C).
3.4. Expression of cell—cell junctional molecules in skins of ICR and NC/Nga mice Expression of cell—cell junctional molecules was examined immunohistochemically in skins of ICR and NC/Nga mice (Fig. 4). The cell—cell junctional molecules examined in this experiment were Ecadherin as an adherens junctional protein [32,33], zona occludens 1 (ZO-1) as a tight junctional protein [34,35], and desmoglein 3 (Dsg3) as a desmosomal protein [36,37].
Intraepidermal neurite formation in atopic NC/Nga mice
203
Fig. 1 Increases of neurite density and NGF levels in the epidermis of atopic NC/Nga mice. (A—C) Skins of ICR, SPF-NC/ Nga and Conv-NC/Nga mice were stained with anti-PGP9.5 (green) and anti-nidogen (red) antibodies. Nuclei are counterstained with DAPI (blue). Scale bars, 75 mm; 15 mm in insets. (D) The intraepidermal neurite number in SPFNC/Nga mice was significantly increased over ICR mice. In Conv-NC/Nga mice, the number of intraepidermal neurites was approximately 2.9-fold increase compaired with that of SPF-NC/Nga mice. Five mice per group were used in each experiment. All values show as mean S.D. (*P < 0.01). (E) In immunohistochemical analysis, increased expression of NGF (green) was observed only in lesional skins of Conv-NC/Nga mice. In all panels, nuclei were stained with DAPI (blue), and the epidermal (epi)-dermal (der) border is shown by a broken line. Scale bars, 15 mm. (F) Expression of epidermal NGF mRNA was examined with qRT-PCR analysis in ICR and NC/Nga mice. Five mice per group were used in each experiment. The levels of mRNA expression for the gene were calculated by the comparative Ct-method compared to b-actin. Results were shown as values compared to the levels of the gene expression in the epidermis of SPF-NC/Nga mice. Each value represents the mean S.D. of three different experiments (*P < 0.01).
E-cadherin expression was detected in the epidermis of ICR and SPF-NC/Nga mice, and there were no apparent differences between the expression patterns (Fig. 4A and B). On the other hand, the expression was decreased in the basal layer of ConvNC/Nga mice compared with that of SPF-NC/Nga mice (Fig. 4A). ZO-1 protein was expressed in the granular layer of both ICR and SPF-NC/Nga mice, whereas the
expression was undetectable in the granular layer of Conv-NC/Nga mice (Fig. 4C and D). Dsg3 protein expresses in the basal layer of normal epidermis at sites of cell—cell contact [36,37]. In ICR and SPF-NC/Nga mice, the protein primarily expressed at the surface of basal cells (Fig. 4E and F). In contrast, the expression in Conv-NC/Nga mice was observed in the suprabasal layer but not in the basal layer (Fig. 4E).
204
M. Tominaga et al.
Fig. 2 Expression of epidermal AR in ICR and NC/Nga mice. (A) In immunohistochemical analysis, expression of AR (red) was slightly detected in the epidermis of ICR and SPF-NC/Nga mice. In contrast, the expression was remarkably increased in the epidermis of Conv-NC/Nga mice. In all panels, nuclei were stained with DAPI (blue), and the epidermal (epi)dermal (der) border is shown by a broken line. Scale bars, 15 mm. (B) Expression of epidermal AR mRNA in ICR and NC/Nga mice was examined with qRT-PCR analysis. Five mice per group were used in each experiment. The levels of mRNA expression for the gene were calculated by the comparative Ct-method compared to b-actin. Results were shown as values compared to the levels of the gene expression in the epidermis of SPF-NC/Nga mice. Each value represents the mean S.D. of three different experiments (*P < 0.01).
4. Discussion The present study demonstrated that epidermal neurite density and epidermal NGF levels were significantly increased in Conv-NC/Nga mice compared with those of SPF-NC/Nga mice as described previously [19,20]. The sprouting of intraepidermal neurites is found in AD patients, concomitant with elevated NGF levels in the epidermis [14—16,21,22]. Epidermally targeted NGF-transgenic mice have also shown increased sensory neuron numbers and enhanced innervation [38]. These data suggest that increased NGF promotes neurite outgrowth in the epidermis of AD (Fig. 5A). Similar to NGF, neurotrophin-3 (NT-3) and brain-derived neurotrophin factor (BDNF) altered somatosensory innervation patterns [39,40]. However, our qRT-PCR analysis revealed that expression for BDNF, NT-3 and NT-4/5 genes did not upregulate in the epidermis of Conv-NC/Nga mice (data not shown). In this investigation, we also found that the expression of amphiregulin (AR), which is a member of the epidermal growth factor
family, was upregulated in the epidermis of ConvNC/Nga mice. Previous studies have shown that AR has effects on neurite outgrowth [30] and neuronal survival [31]. Therefore, the increased expression of AR may be involved in neurite outgrowth in the epidermis (Fig. 5A), as well as NGF. NGF is also known to upregulate neuropeptides, especially substance P (SP) and calcitonin-generelated peptide (CGRP) in adult rat primary sensory neurons [41]. Interestingly, in NC/Nga mice, SP levels are increased and CGRP levels are decreased compared with that in the controls [42]. Given that sensitivity to pain induced by heat correlates to CGRP concentrations [43], and pain sensitivity negatively correlates to itch sensitivity in animal models [44], it could be speculated that CGRP has a greater role in nociception and SP has a greater role in itch [45]. SP also stimulates release of tumor necrosis factor a, histamine, prostaglandin D2, and leukotrien B4 from skin mast cells [46]. This suggests their possible involvement in the pathophysiology of AD. Furthermore, SP and neurokinin A directly induce
Intraepidermal neurite formation in atopic NC/Nga mice
205
keratinocyte NGF [47]. Thus, an increased level of epidermal NGF is associated with the development and aggravation of AD. Recently, therapeutic antiNGF approaches against pruritus have been tested in NC/Nga mice. The treatment of anti-NGF antibodies has inhibitory effects on intraepidermal neurite outgrowth and scratching behavior [23]. This report suggests that the increased density of intraepidermal neurites is related to scratching behavior in atopic NC/Nga mice, and the lesioned skin may be susceptible to any stimulation and sensitive to itching. In our immunohistochemical analysis, many intraepidermal neurites were observed in SPF-NC/ Nga mice compared with that of ICR mice. Inagaki and colleagues found significant differences in the histamine-induced scratching behavior of 12 mouse strains, and ICR mice were good responders against histamine [24]. However, in ICR mice cohabitated with atopic NC/Nga mice, the number of scratching was less than half the number in NC/Nga mice cohabitated with atopic NC/Nga mice [25]. Additionally, NC/Nga mice may have a predisposition to impairment of the ceramide metabolism, which causes dryness and reduces skin barrier ability [48]. Increased density of intraepidermal neurites and higher local NGF concentrations is also found in patients with pruritic contact dermatitis [49] and in patients with xerosis (Takamori et al., unpublished observations). Taken together, SPF-NC/Nga mice may be hypersensitive to external stimuli by the high density of intraepidermal neurites and the lowering of skin barrier function, and this may explain the difference of scratching behavior between ICR and NC/Nga mice in cohabitation with atopic NC/Nga mice. Although we found a high density of intraepidermal neurites in SPF-NC/Nga mice, expression levels of epidermal NGF and AR in the mice were unchanged when compared to those of ICR mice. Semaphorin 3A (Sema3A) induces growth cone collapse and axonal repulsion of several neuronal populations [50,51]. A recent study has reported that a balance between NGF levels and Sema3A levels is an important factor for epidermal innervation [52]. Therefore, we examined the expression level of epidermal Sema3A in SPF-NC/Nga mice. Our qRTPCR analysis showed that Sema3A expression was decreased in the epidermis of SPF-NC/Nga mice compared with that of ICR mice (data not shown).
Fig. 3 Gelatinase activity in skins of ICR and NC/Nga mice. Gelatinase activity (green) in mouse skin was analyzed by in situ zymography. In the skins of ICR (A) and SPFNC/Nga (B) mice, gelatinase activity was detected only in
the granular layer. In contrast, the activity in the lesional skins of Conv-NC/Nga mice was detected in the suprabasal layer including the spinous and granular layers (C). Epidermal (epi)-dermal (der) border is shown by a broken line. Scale bars, 75 mm.
206 Consequently, in SPF-NC/Nga mice, the high density of intraepidermal neurites might be due to the decrease of epidermal Sema3A levels. Recent studies have reported that AR is released from transmembrane precursors by metalloproteinases (MPs), and the release is blocked by the
M. Tominaga et al. broad-spectrum MP inhibitors GM6001 and MMP-2/ MMP-9 (gelatinase A and B) inhibitor II [53]. We demonstrated using in situ zymography that gelatinase activity was remarkably increased in the suprabasal layer of Conv-NC/Nga mice compared with that of SPF-NC/Nga mice. Additionally, AR proteins
Fig. 4 Expression patterns of cell—cell junctional molecules in skins of ICR and NC/Nga mice. (A) E-cadherin expression (green) was detected in the epidermis of ICR, SPF-NC/Nga and Conv-NC/Nga mice. The expression level was decreased only in the basal layer of Conv-NC/Nga mice. In the suprabasal layer, the level of E-cadherin expression remained unchanged among these mice. (B) Differential interference contrast (DIC) microscopic analysis in the skins shown in panel A. (C) ZO-1 (green) was expressed in the granular layer of both ICR and SPF-NC/Nga mice. In Conv-NC/Nga mice, the expression was undetectable in the granular layer. Nuclei were stained with DAPI (blue). (D) DIC microscopic analysis of the skins shown in panel C. (E) Expression of Dsg3 (red) was observed in the basal layer of ICR and SPF-NC/Nga mice. In Conv-NC/Nga mice, the protein was expressed in the suprabasal layer but not in the basal layer. Nuclei were stained with DAPI (blue). (F) DIC microscopic analysis of the skins shown in panel E. In panels A, C and E, the epidermal (epi)-dermal (der) borders are shown by broken lines. Scale bars, 30 mm.
Intraepidermal neurite formation in atopic NC/Nga mice
207
Figure 4. (Continued ).
were localized in the plasma membrane of basal cells. In contrast, they were diffused in the suprabasal layer. Thus, gelatinase in suprabasal cells may be involved in AR elaboration into intercellular space between keratinocytes. Shubayev and Myers have also reported that MMP-9 (gelatinase B) promotes NGF-induced neurite elongation in PC12 cells [54], suggesting that the increased level of gelatinase activity in NC/Nga mice may play a role in the promotion of intraepidermal neurite outgrowth (Fig. 5A). To further identify the types of gelatinase, distribution of MMP-2 and MMP-9 was examined imunohistochemically in the skins of Conv-NC/Nga mice. However, increased expression of these MMPs was not observed in the epidermis (data not shown). Therefore, further studies using enzymatical methods will be required to identify the types of gelatinase. Adherens junctions and tight junctions are critical for normal epidermal barrier function and have been shown to be altered in psoriasis [55— 58]. Epidermally targeted AR-transgenic mouse strains develop many features of psoriasis spontaneously [59,60]. In the AR-transgenic mice, expression of E-cadherin, an adherens junction
protein, is downregulated in the epidermis [61]. In addition, levels of the tight junction proteins, ZO-1 and ZO-2, are also downregulated in the epidermis of AR-transgenic mice. Thus, AR causes downregulation of the epithelial junctional molecules in psoriatic skins, suggesting that AR affects the integrity of cell—cell junctions. But to date, no such changes were found in atopic skins. In this investigation, we found that the expression of Ecadherin and ZO-1 was decreased only in the epidermis of Conv-NC/Nga mice. This result indicates that the expression of adherens and tight junction proteins is downregulated in atopic skin as well as psoriatic skin. We also found an increased expression of emidermal AR in ConvNC/Nga mice. Therefore, the downregulation of E-cadherin and ZO-1 may be caused by the activation of AR receptor signaling. Desmosomes are complex intercellular junctions that link the keratin filaments of adjacent cells, providing mechanical strength to epithelial tissues such as the epidermis. Dsg3 is one of the desmosomal cadherins. In mammalian skin, the protein is expressed at high levels in the basal layer, and its expression decreases when the cells differentiate
208
M. Tominaga et al.
Fig. 5 A hypothetical mechanism of intraepidermal neurite formation in atopic NC/Nga mice. (A) In atopic skin, epidermal keratinocytes produce NGF and AR proteins at high levels. Elevated levels of these growth factors may induce neurite outgrowth in/into the epidermis. Additionally, gelatinase is involved in AR elaboration and NGF-induced neurite elongation. Therefore, the increase of gelatinase activity may promote the epidermal neurite outgrowth. (B) A widening of intercellular space in the epidermis of atopic NC/Nga mice may be caused by the downregulation of E-cadherin and ZO1 and misexpression of Dsg3. It could be speculated that the increased intercellular space promotes the neurite outgrowth in/into the epidermis.
[62]. Electron microscopic analysis in Dsg3transgenic mice using cytokeratin 1 promoter has revealed an increase of intercellular spaces in the basal and spinous layers [63]. In this study, we found that Dsg3 protein is misexpressed in the epidermis of Conv-NC/Nga mice but not in other groups. This result suggests a widening of intercellular spaces in the epidermis. It is also possible that the increased spaces are required for neurite elongation into the epidermis such as T-cell infiltration in AD [64]. Taken together, the downregulation of E-cadherin and ZO-1 and the misexpression of Dsg3 may provide intercellular spaces for epidermal neurite formation (Fig. 5B). This idea is also supported by previous studies that E-cadherin conditional knockout mice show an increase of intercellular spaces in the basal layer [65,66]. Thus, the intraepidermal neurite formation in atopic NC/Nga mice could be regulated by alterations in the epidermal extracellular environment.
Acknowledgements This work was supported by a Health Labour Sciences Research Grant for Research on Allergic disease and Immunology from the Japanese Ministry of Health, Labour and Welfare, and by MEXT. HAITEKU (2002).
References [1] Werner Y, Lindberg M, Forslind B. Membrane-coating granules in ‘‘dry’’ non-eczematous skin of patients with atopic dermatitis. A quantitative electron microscopic study. Acta Derm Venereol 1987;67:385—90. [2] Fartasch M, Diepgen TL. The barrier function in atopic dry skin. Disturbance of membrane-coating granule exocytosis and formation of epidermal lipids? Acta Derm Venereol Suppl (Stockh) 1992;176:26—31. [3] Wahlgren CF. Itch and atopic dermatitis: an overview. J Dermatol 1999;26:770—9. [4] Williams HC. Atopic dermatitis: new information from epidemiological studies. Br J Hosp Med 1994;52:409—12.
Intraepidermal neurite formation in atopic NC/Nga mice [5] Koblenzer CS. Itching and the atopic skin. J Allergy Clin Immunol 1999;104:S109—13. [6] Yosipovitch G, Greaves MW, Fleischer Jr AB, McGlone F. Itch, Basic Mechanisms and Therapy. Marcel Dekker, Inc.; 2004. [7] Stander S, Steinhoff M. Pathophysiology of pruritus in atopic dermatitis: an overview. Exp Dermatol 2002;11:12—24. [8] Heyer G. Abnormal cutaneous neurosensitivity in atopic skin. Acta Derm Venereol Suppl (Stockh) 1992;176:93—4. [9] Rukwied R, Lischetzki G, McGlone F, Heyer G, Schmelz M. Mast cell mediators other than histamine induce pruritus in atopic dermatitis patients: a dermal microdialysis study. Br J Dermatol 2000;142:1114—20. [10] Kuraishi Y, Nagasawa T, Hayashi K, Satoh M. Scratching behavior induced by pruritogenic but not algesiogenic agents in mice. Eur J Pharmacol 1995;275:229—33. [11] Levi-Montalcini R. The nerve growth factor 35 years later. Science 1987;237:1154—62. [12] Lewin GR, Mendell LM. Nerve growth factor and nociception. Trends Neurosci 1993;16:353—9. [13] Bennett DL, Koltzenburg M, Priestley JV, Shelton DL, McMahon SB. Endogenous nerve growth factor regulates the sensitivity of nociceptors in the adult rat. Eur J Neurosci 1998;10:1282—91. [14] Urashima R, Mihara M. Cutaneous nerves in atopic dermatitis. A histological, immunohistochemical and electron microscopic study. Virchows Arch 1998;432:363—70. [15] Steinhoff M, Stander S, Seeliger S, Ansel JC, Schmelz M, Luger T. Modern aspects of cutaneous neurogenic inflammation. Arch Dermatol 2003;139:1479—88. [16] Dou YC, Hagstromer L, Emtestam L, Johansson O. Increased nerve growth factor and its receptors in atopic dermatitis: an immunohistochemical study. Arch Dermatol Res 2006;298:31—7. [17] Matsuda H, Watanabe N, Geba GP, Sperl J, Tsudzuki M, Hiroi J, et al. Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice. Int Immunol 1997;9:461—6. [18] Kawamoto K, Matsuda H. Animal Models of Human Inflammatory Skin Diseases. LLC: CRC Press; 2004. [19] Horiuchi Y, Bae S, Katayama I. Nerve growth factor (NGF) and epidermal nerve fibers in atopic dermatitis model NC/ Nga mice. J Dermatol Sci 2005;39:56—8. [20] Tanaka A, Matsuda H. Expression of nerve growth factor in itchy skins of atopic NC/NgaTnd mice. J Vet Med Sci 2005;67: 915—9. [21] Sugiura H, Omoto M, Hirota Y, Danno K, Uehara M. Density and fine structure of peripheral nerves in various skin lesions of atopic dermatitis. Arch Dermatol Res 1997;289:125—31. [22] Toyoda M, Nakamura M, Makino T, Hino T, Kagoura M, Morohashi M. Nerve growth factor and substance P are useful plasma markers of disease activity in atopic dermatitis. Br J Dermatol 2002;147:71—9. [23] Takano N, Sakurai T, Kurachi M. Effects of anti-nerve growth factor antibody on symptoms in the NC/Nga mouse, an atopic dermatitis model. J Pharmacol Sci 2005;99:277— 86. [24] Inagaki N, Nagao M, Igeta K, Kawasaki H, Kim JF, Nagai H. Scratching behavior in various strains of mice. Skin Pharmacol Appl Skin Physiol 2001;14:87—96. [25] Hashimoto Y, Arai I, Takano N, Tanaka M, Nakaike S. Induction of scratching behaviour and dermatitis in various strains of mice cohabiting with NC/Nga mice with chronic dermatitis. Br J Dermatol 2006;154:28—33. [26] Hayashita-Kinoh H, Kinoh H, Okada A, Komori K, Itoh Y, Chiba T, et al. Membrane-type 5 matrix metalloproteinase is expressed in differentiated neurons and regulates axonal growth. Cell Growth Differ 2001;12:573—80.
209
[27] Thompson RJ, Doran JF, Jackson P, Dhillon AP, Rode J. PGP 9.5-a new marker for vertebrate neurons and neuroendocrine cells. Brain Res 1983;278:224—8. [28] Dalsgaard CJ, Rydh M, Haegerstrand A. Cutaneous innervation in man visualized with protein gene product 9.5 (PGP 9. 5) antibodies. Histochemistry 1989;92:385—90. [29] Ljubimov AV, Afanasjeva AV, Litvinova LV, Senin VM. Basement membrane components produced by a mouse ascites teratocarcinoma TB24. Analysis with monoclonal and polyclonal antibodies. Exp Cell Res 1986;165:530—40. [30] Kimura H, Schubert D. Schwannoma-derived growth factor promotes the neuronal differentiation and survival of PC12 cells. J Cell Biol 1992;116:777—83. [31] Nilsson A, Kanje M. Amphiregulin acts as an autocrine survival factor for adult sensory neurons. Neuroreport 2005;16:213—8. [32] Hirai Y, Nose A, Kobayashi S, Takeichi M. Expression and role of E- and P-cadherin adhesion molecules in embryonic histogenesis. II. Skin morphogenesis. Development 1989;105: 271—7. [33] Haftek M, Hansen MU, Kaiser HW, Kreysel HW, Schmitt D. Interkeratinocyte adherens junctions: immunocytochemical visualization of cell—cell junctional structures, distinct from desmosomes, in human epidermis. J Invest Dermatol 1996;106:498—504. [34] Stevenson BR, Siliciano JD, Mooseker MS, Goodenough DA. Identification of ZO-1: a high molecular weight polypeptide associated with the tight junction (zonula occludens) in a variety of epithelia. J Cell Biol 1986;103:755—66. [35] Morita K, Miyachi Y. Tight junctions in the skin. J Dermatol Sci 2003;31:81—9. [36] Shimizu H, Masunaga T, Ishiko A, Kikuchi A, Hashimoto T, Nishikawa T. Pemphigus vulgaris and pemphigus foliaceus sera show an inversely graded binding pattern to extracellular regions of desmosomes in different layers of human epidermis. J Invest Dermatol 1995;105:153—9. [37] Amagai M, Koch PJ, Nishikawa T, Stanley JR. Pemphigus vulgaris antigen (desmoglein 3) is localized in the lower epidermis, the site of blister formation in patients. J Invest Dermatol 1996;106:351—5. [38] Albers KM, Wright DE, Davis BM. Overexpression of nerve growth factor in epidermis of transgenic mice causes hypertrophy of the peripheral nervous system. J Neurosci 1994;14:1422—32. [39] Albers KM, Perrone TN, Goodness TP, Jones ME, Green MA, Davis BM. Cutaneous overexpression of NT-3 increases sensory and sympathetic neuron number and enhances touch dome and hair follicle innervation. J Cell Biol 1996;134:487— 97. [40] LeMaster AM, Krimm RF, Davis BM, Noel T, Forbes ME, Johnson JE, et al. Overexpression of brain-derived neurotrophic factor enhances sensory innervation and selectively increases neuron number. J Neurosci 1999;19: 5919—31. [41] Verge VM, Richardson PM, Wiesenfeld-Hallin Z, Hokfelt T. Differential influence of nerve growth factor on neuropeptide expression in vivo: a novel role in peptide suppression in adult sensory neurons. J Neurosci 1995;15: 2081—96. [42] Katsuno M, Aihara M, Kojima M, Osuna H, Hosoi J, Nakamura M, et al. Neuropeptides concentrations in the skin of a murine (NC/Nga mice) model of atopic dermatitis. J Dermatol Sci 2003;33:55—65. [43] Mogil JS, Miermeister F, Seifert F, Strasburg K, Zimmermann K, Reinold H, et al. Variable sensitivity to noxious heat is mediated by differential expression of the CGRP gene. Proc Natl Acad Sci USA 2005;102:12938—43.
210 [44] Green AD, Young KK, Lehto SG, Smith SB, Mogil JS. Influence of genotype, dose and sex on pruritogen-induced scratching behavior in the mouse. Pain 2006;124:50—8. [45] Ikoma A, Steinhoff M, Stander S, Yosipovitch G, Schmelz M. The neurobiology of itch. Nat Rev Neurosci 2006;7:535— 47. [46] Furutani K, Koro O, Hide M, Yamamoto S, Substance. P- and antigen-induced release of leukotriene B4, prostaglandin D2 and histamine from guinea pig skin by different mechanisms in vitro. Arch Dermatol Res 1999;291:466—73. [47] Burbach GJ, Kim KH, Zivony AS, Kim A, Aranda J, Wright S, et al. The neurosensory tachykinins substance P and neurokinin A directly induce keratinocyte nerve growth factor. J Invest Dermatol 2001;117:1075—82. [48] Aioi A, Tonogaito H, Suto H, Hamada K, Ra CR, Ogawa H, et al. Impairment of skin barrier function in NC/Nga Tnd mice as a possible model for atopic dermatitis. Br J Dermatol 2001;144:12—8. [49] Kinkelin I, Motzing S, Koltenzenburg M, Brocker EB. Increase in NGF content and nerve fiber sprouting in human allergic contact eczema. Cell Tissue Res 2000;302:31—7. [50] Raper JA. Semaphorins and their receptors in vertebrates and invertebrates. Curr Opin Neurobiol 2000;10:88—94. [51] Fujisawa H. Discovery of semaphorin receptors, neuropilin and plexin, and their functions in neural development. J Neurobiol 2004;59:24—33. [52] Dontchev VD, Letourneau PC. Nerve growth factor and semaphorin 3A signaling pathways interact in regulating sensory neuronal growth cone motility. J Neurosci 2002;22:6659—69. [53] Kansra S, Stoll SW, Johnson JL, Elder JT. Autocrine extracellular signal-regulated kinase (ERK) activation in normal human keratinocytes: metalloproteinase-mediated release of amphiregulin triggers signaling from ErbB1 to ERK. Mol Biol Cell 2004;15:4299—309. [54] Shubayev VI, Myers RR. Matrix metalloproteinase-9 promotes nerve growth factor-induced neurite elongation but not new sprout formation in vitro. J Neurosci Res 2004;77: 229—39. [55] Pummi K, Malminen M, Aho H, Karvonen SL, Peltonen J, Peltonen S. Epidermal tight junctions: ZO-1 and occludin are expressed in mature, developing, and affected skin and in
M. Tominaga et al.
[56]
[57]
[58]
[59]
[60]
[61]
[62] [63]
[64]
[65]
[66]
vitro differentiating keratinocytes. J Invest Dermatol 2001;117:1050—8. Perez-Moreno M, Jamora C, Fuchs E. Sticky business: orchestrating cellular signals at adherens junctions. Cell 2003;112: 535—48. Zhou S, Matsuyoshi N, Takeuchi T, Ohtsuki Y, Miyachi Y. Reciprocal altered expression of T-cadherin and P-cadherin in psoriasis vulgaris. Br J Dermatol 2003;149:268—73. Harhaj NS, Antonetti DA. Regulation of tight junctions and loss of barrier function in pathophysiology. Int J Biochem Cell Biol 2004;36:1206—37. Cook PW, Piepkorn M, Clegg CH, Plowman GD, DeMay JM, Brown JR, et al. Transgenic expression of the human amphiregulin gene induces a psoriasis-like phenotype. J Clin Invest 1997;100:2286—94. Cook PW, Brown JR, Cornell KA, Pittelkow MR. Suprabasal expression of human amphiregulin in the epidermis of transgenic mice induces a severe, early-onset, psoriasis-like skin pathology: expression of amphiregulin in the basal epidermis is also associated with synovitis. Exp Dermatol 2004;13:347— 56. Chung E, Cook PW, Parkos CA, Park YK, Pittelkow MR, Coffey RJ. Amphiregulin causes functional downregulation of adherens junctions in psoriasis. J Invest Dermatol 2005;124: 1134—40. Wheelock MJ, Johnson KR. Cadherins as modulators of cellular phenotype. Annu Rev Cell Dev Biol 2003;19:207—35. Merritt AJ, Berika MY, Zhai W, Kirk SE, Ji B, Hardman MJ, et al. Suprabasal desmoglein 3 expression in the epidermis of transgenic mice results in hyperproliferation and abnormal differentiation. Mol Cell Biol 2002;22:5846—58. Wittmann M, Werfel T. Interaction of keratinocytes with infiltrating lymphocytes in allergic eczematous skin diseases. Curr Opin Allergy Clin Immunol 2006;6:329—34. Young P, Boussadia O, Halfter H, Grose R, Berger P, Leone DP, et al. E-cadherin controls adherens junctions in the epidermis and the renewal of hair follicles. EMBO J 2003;22:5723— 33. Tinkle CL, Lechler T, Pasolli HA, Fuchs E. Conditional targeting of E-cadherin in skin: insights into hyperproliferative and degenerative responses. Proc Natl Acad Sci USA 2004;101: 552—7.
www.intl.elsevierhealth.com/journals/jods
A hypothetical mechanism of intraepidermal neurite formation in NC/Nga mice with atopic dermatitis Mitsutoshi Tominaga a, Sumiko Ozawa b, Hideoki Ogawa a, Kenji Takamori a,b,* a
Institute for Environmental and Gender Specific Medicine, Juntendo University Graduate School of Medicine, 2-1-1 Tomioka, Urayasu, Chiba 279-0021, Japan b Department of Dermatology, School of Medicine, Juntendo University Urayasu Hospital, 2-1-1 Tomioka, Urayasu, Chiba 279-0021, Japan Received 15 August 2006; received in revised form 20 January 2007; accepted 2 February 2007
KEYWORDS Amphiregulin; Atopic dermatitis; Cell—cell junction; Gelatinase; NGF
Summary Background: Pruritus is a symptom in atopic dermatitis (AD). Previous studies have reported that increased intraepidermal neurites are observed in AD, suggesting that the neuritogenesis is related to itching in the skin. Objective: This study was conducted to reveal the mechanism of intraepidermal neurite formation in AD. Methods: In this study, we used conventional (Conv) NC/Nga mice with AD. NC/Nga mice maintained in specific pathogen-free (SPF) condition were used as a control with no AD. Distribution of intraepidermal neurites and expression patterns of growth factors (NGF and amphiregulin (AR)) and cell—cell junctional molecules (E-cadherin, zona occludens 1 (ZO-1) and desmoglein 3 (Dsg3)) were examined in the skins by immunohistochemistry or quantitative RT-PCR. Furthermore, detection of gelatinase activity was performed with in situ zymography. The same experiments were conducted in ICR mice for comparison with NC/Nga mice. Results: Neurite density and expression levels of growth factors and gelatinase were remarkably increased in the epidermis of Conv-NC/Nga mice compared with those of SPF-NC/Nga mice. Decreased expression of E-cadherin and ZO-1 and misexpression of
Abbreviations: AD, atopic dermatitis; AR, amphiregulin; CGRP, calcitonin-gene-related peptide; Conv, conventional; DAPI, 40 60 diamidino-2-phenylindole hydrochloride; Dsg3, desmoglein 3; NGF, nerve growth factor; PBS, phosphate-buffered saline; PGP9.5, protein gene product 9.5; RT-PCR, reverse transcriptase polymerase chain reaction; SD, standard deviation; Sema3A, semaphorin 3A; SP, substance P; SPF, specific pathogen-free; ZO-1, zona occludens 1 * Corresponding author at: Department of Dermatology, School of Medicine, Juntendo University Urayasu Hospital, 2-1-1 Tomioka, Urayasu, Chiba 279-0021, Japan. Tel.: +81 47 353 3171; fax: +81 47 353 3178. E-mail address: [email protected] (K. Takamori). 0923-1811/$30.00 # 2007 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jdermsci.2007.02.002
200
M. Tominaga et al. Dsg3 were also observed in the atopic skins. In comparison with ICR mice, increases of neurite density and gelatinase activity were found in the skins of SPF-NC/Nga mice but expression levels of growth factors and cell—cell junctional molecules were unchanged. Conclusions: Increases of growth factors and gelatinase activity may be related to neurite outgrowth in the epidermis of atopic NC/Nga mice. Additionally, abnormal expressions of cell—cell junctional molecules in the epidermis may provide intercellular spaces for the neurite formation. # 2007 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
1. Introduction Atopic dermatitis (AD) is frequently associated with skin dryness and elevated serum levels of IgE antibodies against many kinds of inhaled allergens [1—3]. Patients with AD often complain of intense itching and excessive scratching. It is one of the most important symptoms in AD, and is consequently a major diagnostic criterion for AD [4]. In a process known as the itch-scratch cycle, scratching leads to increased itching and aggravated skin lesions in AD patients [3]. Therefore, reduction of itching and scratching is an effective strategy for preventing aggravation of skin lesions and improving the quality of life for AD patients [5]. Histamine is the best-known pruritogen and has been regarded as a main treatment for antipruritic therapies [6,7]. However, in some cases the pruritus is uncontrolled by antihistamine treatment [6]. This discrepancy may be due either to an intrinsic downregulation of neuronal H1-receptor density or affinity, or an increased histamine degradation in atopic skin [7,8]. Rukwied and colleagues have also demonstrated that pruritus induced by the mast cell degranulating substance compound 48/80 in AD patients could not be relieved by cetirizine H1 blockade [9]. Furthermore, in ddy mice, subcutaneous injection of the compound 48/80 elicited scratching behavior in the injected sites, but histamine was without significant effects [10]. These results suggest that other mediators such as proteinases and cytokines are additionally involved in the pathophysiology of itch response during AD [7]. Nerve growth factor (NGF) has effects on neurite outgrowth and neuronal survival [11—13]. The sprouting of intraepidermal neurites that is initiated by increased NGF is found in AD patients [14—16] and NC/Nga mouse, which is an AD model [17—20]. In addition, remarkably increased density levels of intraepidermal neurites and elevated plasma levels of NGF have been found to correlate with the severity of the disease in AD [21,22]. These findings suggest that the lesioned skin is susceptible to any stimulation and sensitive to itching. A recent study
of NC/Nga mice has demonstrated that anti-NGF antibodies significantly inhibited both intraepidermal neurite formation and scratching behavior but did not ameliorate scratching already developed [23]. This suggests that epidermal neurite outgrowth is related to itching in the atopic skin, probably explaining why antihistamines are frequently not efficient in AD. Thus, the participation of NGF in the epidermal innervation has been clarified in atopic skin. However, the other mechanism regulating the intraepidermal neurite formation is poorly understood. In the present study, neurite density, expression patterns of growth factors and cell—cell junctional molecules, and gelatinase activity were examined in NC/Nga mice. Interestingly, unlike NC/Nga mice, ICR mice are good responders for scratching behavior against histamine [24]. However, in ICR mice cohabitated with atopic NC/Nga mice, the number of scratching was less than half the number in NC/ Nga mice cohabitated with atopic NC/Nga mice [25]. It is unclear why such difference of scratching behavior appears, but this may be due to a high density of intraepidermal neurites in NC/Nga mice. To address this issue, ICR mice were also used for comparison with NC/Nga mice. Based on the histological analyses in these mice, we here describe a hypothetical model of intraepidermal neurite formation in AD.
2. Materials and methods 2.1. Animals All animal procedures were approved by the institutional Animal Care and Use Committee at Juntendo University Graduate School of Medicine and conformed to the guidelines for the use of laboratory animals of the National Institutes of Health. Male NC/Nga mice (SLC Japan, Shizuoka, Japan) were maintained in specific pathogen-free (SPF) or airuncontrolled conventional circumstances and provided with food and tap water ad libitum. In this
Intraepidermal neurite formation in atopic NC/Nga mice
201
study, we used conventional (Conv) NC/Nga mice at the age of 8—12 weeks that manifested mild to severe skin lesions similar to atopic dermatitis (AD). NC/Nga mice maintained in the SPF condition were used as a control with no AD. For comparison with NC/Nga mice, male ICR mice (SLC Japan) at the age of 8—12 weeks were used, and they were maintained in the SPF condition.
temperature. The sections were mounted in vectashield mounting medium with 40 ,60 -diamidino-2-phenylindole hydrochloride (DAPI) (Vector Laboratories, Ltd., Peterborough, UK). Immunolabeling controls were performed by omitting primary antibodies in the procedure. Fluorescence specimens were viewed with a confocal laser scanning microscope DMIRE2 (Leica).
2.2. Antibodies
2.4. In situ zymography
Primary antibodies used in this study were as follows; rabbit anti-product gene protein 9.5 (PGP9.5, 1:4000; BIOMOL International L.P., PA, USA), rabbit anti-nerve growth factor (NGF, 1:2000; Chemicon, Temecula, CA, USA), rabbit anti-zona occludens 1 (ZO-1, 1:200; Zymed Laboratories Inc., South San Francisco, CA, USA), rat anti-nidogen (1:500; Chemicon), rat anti-E-cadherin (1:200; Zymed Laboratories Inc.), goat anti-amphiregulin (AR, 1:20; R&D Systems, Inc., Minneapolis, MN, USA), goat antidesmoglein 3 (Dsg3, 1:100; Santa Cruz Biotechnology, CA, USA). Secondary antibodies conjugated with Alexa 488 or Alexa 594 used in this study were obtained from Molecular Probes (Eugene, OR, USA).
In situ zymography was performed with modifications as described previously [26]. Briefly, cryosections without fixation were washed with PBS, overlaid with 50 mg/ml DQ-gelatin (Molecular Probes), and incubated for 3 h at 37 8C in a humidified chamber. The samples were then observed with a confocal laser scanning microscope DMIRE2 (Leica).
2.3. Immunohistochemistry Mice were perfused through the left ventricle with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) under anesthesia with ether. After perfusion, the skins were removed from the neck and immersed in the same fixative for 1 h at 4 8C. Small pieces of the skins were immersed successively in PBS solution containing 10%, 15% or 20% sucrose. They were embedded in OCT compound and frozen in liquid nitrogen. Cryosections (thickness 4— 20 mm) were cut using a CM1850 cryostat (Leica, Wetzlar, Germany) and mounted on silane-coated glass slides. After blocking in PBS with 5% (v/v) normal donkey serum (Chemicon) and 2% BSA (Sigma, St. Louis, MO, USA), cryosections were incubated with primary antibodies overnight at 4 8C. After washing with PBS, the sections were incubated with secondary antibodies for 1 h at room
2.5. Total RNA preparation from epidermal sheets Skins of mice were incubated with 0.25% trypsin/ 1 mM EDTA solution (Nakarai tesque Inc., Kyoto, Japan) for 16 h at 4 8C. After the trypsinization, epidermal sheets were separated from the skin using forceps. Total RNA from the epidermal sheets was isolated with Rneasy1 Mini Kit (QIAGEN K.K., Tokyo, Japan) according to the manufacturer’s protocol.
2.6. Quantitative RT-PCR analysis Reverse transcription (RT) reaction was done with ExScriptTM RT reagent kit (TaKaRa, Kyoto, Japan) according to the manufacturer’s protocol. Quantitative RT-PCR (qRT-PCR) analysis was performed using the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, CA, USA), based on the SYBR-Green method. The primers used in this study are listed in Table 1. They were designed to meet specific criteria and were synthesized by Perfect Real Time support system (TaKaRa). The qRT-PCR reaction mixture consisted of 0.2 mM of each primer, 1 SYBR1 Premix EX TaqTM (Perfect
Table 1 Sequences of primer pairs used for qRT-PCR analysis Gene NGF
Product (bp) 62
AR
117
b-actin
131
NGF, nerve growth factor; AR, amphiregulin.
Primer
Sequence (50 -30 )
Forward Reverse Forward Reverse Forward Reverse
TTTCTATACTGGCCGCAGTGA TGATCAGAGTGTAGAACAACATGGA TCCATGCACTGCCAAGTTTCA TCTCCACACCGTTCACCAAAGTAA TGACAGGATGCAGAAGGAGA GCTGGAAGGTGGACAGTGAG
202 Real Time) premix reagent (TaKaRa), and 50 ng cDNA to a final volume of 25 ml. The PCR was performed with 40 cycles (denaturation at 95 8C for 5 s, primer annealing and elongation at 60 8C for 30 s). The PCR specificity was confirmed by dissociation curve analysis and gel electrophoresis. The gene expressions were calculated relative to expression of b-actin. The qRT-PCR analyses in this study were performed at least three times.
M. Tominaga et al. NC/Nga mice, increased expression of NGF was observed in the epidermis of Conv-NC/Nga mice (Fig. 1E). Furthermore, qRT-PCR analysis for NGF gene expression was conducted in the epidermal sheets from ICR and NC/Nga mice (Fig. 1F). Transcripts for NGF were detected in the epidermis of ICR and NC/Nga mice, and the expression was significantly increased only in Conv-NC/Nga mice.
2.7. Quantification and statistical analysis
3.2. Expression of epidermal amphiregulin in ICR and NC/Nga mice
To quantify the intraepidermal neurite number, five mice per group were used in each experiment, and three specimens in each mouse were stained with an anti-PGP9.5 antibody. In confocal microscopic analysis, optical sections of 0.9 mm thickness were scanned through the z-plane of the stained specimens (thickness 20 mm). Three-dimensional reconstruction of the images was done with Leica Confocal Software (Leica). For measurement of the intraepidermal neurite number, at least 25 confocal images were analyzed per group in each experiment. The number of intraepidermal neurites per 1.6 105 mm2 in the images was hand-counted by two researchers. All values were presented as mean standard deviation (S.D.) from three independent experiments. Non-parametric Mann—Whitney’s U-test was used for statistical analyses.
In previous studies, amphiregulin (AR) has been reported to promote neurite outgrowth [30,31]. To examine the AR expression in ICR and NC/Nga mice, the skins were stained with an anti-AR antibody. AR proteins were slightly expressed in the epidermis of both ICR and SPF-NC/Nga mice (Fig. 2A). In contrast, the expression level was increased only in the epidermis of Conv-NC/Nga mice (a right panel in Fig. 2A). The proteins were also localized in the plasma membrane of basal cells, whereas they were diffused in the suprabasal layer. To further confirm the immunohistochemical results, qRT-PCR analysis was conducted in the epidermal sheets from ICR and NC/Nga mice (Fig. 2B). Transcripts for AR were detected in the epidermis of ICR and NC/Nga mice, and the expression was significantly increased only in Conv-NC/Nga mice, as well as an increased NGF level.
3. Results
3.3. Gelatinase activity in skins of ICR and NC/Nga mice
3.1. Distribution of intraepidermal neurites and expression of epidermal NGF in ICR and NC/Nga mice The distribution of intraepidermal neurites was examined immunohistochemically in the skins of ICR and NC/Nga mice. In this experiment, we used antibodies against PGP9.5 for the staining of peripheral nerves [27,28] and nidogen for the staining of basement membranes [29]. In ICR mice, PGP9.5-positive neurites were occasionally present in the epidermis (Fig. 1A and D). Many more PGP9.5-positive intraepidermal neurites were observed in SPF-NC/Nga than in ICR mice (Fig. 1B and D). In the skin lesions of Conv-NC/ Nga mice, the number of intraepidermal neurites was significantly increased over SPF-NC/Nga mice (Fig. 1C and D). Previous studies have reported an increase of NGF levels in the epidermis of atopic NC/Nga mice [19,20]. To confirm the expression level of NGF in ICR and NC/Nga mice, the skins were stained with an anti-NGF antibody. In comparison with ICR or SPF-
Gelatinase activity in skins of ICR and NC/Nga mice was analyzed by in situ zymography. In the skins of both ICR (Fig. 3A) and SPF-NC/Nga (Fig. 3B) mice, gelatinase activity was detected in the granular layer. The level of gelatinase activity in SPF-NC/ Nga mice was higher than that of ICR mice (insets in Fig. 3A and B). In contrast, in Conv-NC/Nga mice, the activity was detected in the suprabasal layer including the spinous and granular layers, and a high level of activity was observed in the lesional skins compared with that of SPF-NC/Nga mice (Fig. 3C).
3.4. Expression of cell—cell junctional molecules in skins of ICR and NC/Nga mice Expression of cell—cell junctional molecules was examined immunohistochemically in skins of ICR and NC/Nga mice (Fig. 4). The cell—cell junctional molecules examined in this experiment were Ecadherin as an adherens junctional protein [32,33], zona occludens 1 (ZO-1) as a tight junctional protein [34,35], and desmoglein 3 (Dsg3) as a desmosomal protein [36,37].
Intraepidermal neurite formation in atopic NC/Nga mice
203
Fig. 1 Increases of neurite density and NGF levels in the epidermis of atopic NC/Nga mice. (A—C) Skins of ICR, SPF-NC/ Nga and Conv-NC/Nga mice were stained with anti-PGP9.5 (green) and anti-nidogen (red) antibodies. Nuclei are counterstained with DAPI (blue). Scale bars, 75 mm; 15 mm in insets. (D) The intraepidermal neurite number in SPFNC/Nga mice was significantly increased over ICR mice. In Conv-NC/Nga mice, the number of intraepidermal neurites was approximately 2.9-fold increase compaired with that of SPF-NC/Nga mice. Five mice per group were used in each experiment. All values show as mean S.D. (*P < 0.01). (E) In immunohistochemical analysis, increased expression of NGF (green) was observed only in lesional skins of Conv-NC/Nga mice. In all panels, nuclei were stained with DAPI (blue), and the epidermal (epi)-dermal (der) border is shown by a broken line. Scale bars, 15 mm. (F) Expression of epidermal NGF mRNA was examined with qRT-PCR analysis in ICR and NC/Nga mice. Five mice per group were used in each experiment. The levels of mRNA expression for the gene were calculated by the comparative Ct-method compared to b-actin. Results were shown as values compared to the levels of the gene expression in the epidermis of SPF-NC/Nga mice. Each value represents the mean S.D. of three different experiments (*P < 0.01).
E-cadherin expression was detected in the epidermis of ICR and SPF-NC/Nga mice, and there were no apparent differences between the expression patterns (Fig. 4A and B). On the other hand, the expression was decreased in the basal layer of ConvNC/Nga mice compared with that of SPF-NC/Nga mice (Fig. 4A). ZO-1 protein was expressed in the granular layer of both ICR and SPF-NC/Nga mice, whereas the
expression was undetectable in the granular layer of Conv-NC/Nga mice (Fig. 4C and D). Dsg3 protein expresses in the basal layer of normal epidermis at sites of cell—cell contact [36,37]. In ICR and SPF-NC/Nga mice, the protein primarily expressed at the surface of basal cells (Fig. 4E and F). In contrast, the expression in Conv-NC/Nga mice was observed in the suprabasal layer but not in the basal layer (Fig. 4E).
204
M. Tominaga et al.
Fig. 2 Expression of epidermal AR in ICR and NC/Nga mice. (A) In immunohistochemical analysis, expression of AR (red) was slightly detected in the epidermis of ICR and SPF-NC/Nga mice. In contrast, the expression was remarkably increased in the epidermis of Conv-NC/Nga mice. In all panels, nuclei were stained with DAPI (blue), and the epidermal (epi)dermal (der) border is shown by a broken line. Scale bars, 15 mm. (B) Expression of epidermal AR mRNA in ICR and NC/Nga mice was examined with qRT-PCR analysis. Five mice per group were used in each experiment. The levels of mRNA expression for the gene were calculated by the comparative Ct-method compared to b-actin. Results were shown as values compared to the levels of the gene expression in the epidermis of SPF-NC/Nga mice. Each value represents the mean S.D. of three different experiments (*P < 0.01).
4. Discussion The present study demonstrated that epidermal neurite density and epidermal NGF levels were significantly increased in Conv-NC/Nga mice compared with those of SPF-NC/Nga mice as described previously [19,20]. The sprouting of intraepidermal neurites is found in AD patients, concomitant with elevated NGF levels in the epidermis [14—16,21,22]. Epidermally targeted NGF-transgenic mice have also shown increased sensory neuron numbers and enhanced innervation [38]. These data suggest that increased NGF promotes neurite outgrowth in the epidermis of AD (Fig. 5A). Similar to NGF, neurotrophin-3 (NT-3) and brain-derived neurotrophin factor (BDNF) altered somatosensory innervation patterns [39,40]. However, our qRT-PCR analysis revealed that expression for BDNF, NT-3 and NT-4/5 genes did not upregulate in the epidermis of Conv-NC/Nga mice (data not shown). In this investigation, we also found that the expression of amphiregulin (AR), which is a member of the epidermal growth factor
family, was upregulated in the epidermis of ConvNC/Nga mice. Previous studies have shown that AR has effects on neurite outgrowth [30] and neuronal survival [31]. Therefore, the increased expression of AR may be involved in neurite outgrowth in the epidermis (Fig. 5A), as well as NGF. NGF is also known to upregulate neuropeptides, especially substance P (SP) and calcitonin-generelated peptide (CGRP) in adult rat primary sensory neurons [41]. Interestingly, in NC/Nga mice, SP levels are increased and CGRP levels are decreased compared with that in the controls [42]. Given that sensitivity to pain induced by heat correlates to CGRP concentrations [43], and pain sensitivity negatively correlates to itch sensitivity in animal models [44], it could be speculated that CGRP has a greater role in nociception and SP has a greater role in itch [45]. SP also stimulates release of tumor necrosis factor a, histamine, prostaglandin D2, and leukotrien B4 from skin mast cells [46]. This suggests their possible involvement in the pathophysiology of AD. Furthermore, SP and neurokinin A directly induce
Intraepidermal neurite formation in atopic NC/Nga mice
205
keratinocyte NGF [47]. Thus, an increased level of epidermal NGF is associated with the development and aggravation of AD. Recently, therapeutic antiNGF approaches against pruritus have been tested in NC/Nga mice. The treatment of anti-NGF antibodies has inhibitory effects on intraepidermal neurite outgrowth and scratching behavior [23]. This report suggests that the increased density of intraepidermal neurites is related to scratching behavior in atopic NC/Nga mice, and the lesioned skin may be susceptible to any stimulation and sensitive to itching. In our immunohistochemical analysis, many intraepidermal neurites were observed in SPF-NC/ Nga mice compared with that of ICR mice. Inagaki and colleagues found significant differences in the histamine-induced scratching behavior of 12 mouse strains, and ICR mice were good responders against histamine [24]. However, in ICR mice cohabitated with atopic NC/Nga mice, the number of scratching was less than half the number in NC/Nga mice cohabitated with atopic NC/Nga mice [25]. Additionally, NC/Nga mice may have a predisposition to impairment of the ceramide metabolism, which causes dryness and reduces skin barrier ability [48]. Increased density of intraepidermal neurites and higher local NGF concentrations is also found in patients with pruritic contact dermatitis [49] and in patients with xerosis (Takamori et al., unpublished observations). Taken together, SPF-NC/Nga mice may be hypersensitive to external stimuli by the high density of intraepidermal neurites and the lowering of skin barrier function, and this may explain the difference of scratching behavior between ICR and NC/Nga mice in cohabitation with atopic NC/Nga mice. Although we found a high density of intraepidermal neurites in SPF-NC/Nga mice, expression levels of epidermal NGF and AR in the mice were unchanged when compared to those of ICR mice. Semaphorin 3A (Sema3A) induces growth cone collapse and axonal repulsion of several neuronal populations [50,51]. A recent study has reported that a balance between NGF levels and Sema3A levels is an important factor for epidermal innervation [52]. Therefore, we examined the expression level of epidermal Sema3A in SPF-NC/Nga mice. Our qRTPCR analysis showed that Sema3A expression was decreased in the epidermis of SPF-NC/Nga mice compared with that of ICR mice (data not shown).
Fig. 3 Gelatinase activity in skins of ICR and NC/Nga mice. Gelatinase activity (green) in mouse skin was analyzed by in situ zymography. In the skins of ICR (A) and SPFNC/Nga (B) mice, gelatinase activity was detected only in
the granular layer. In contrast, the activity in the lesional skins of Conv-NC/Nga mice was detected in the suprabasal layer including the spinous and granular layers (C). Epidermal (epi)-dermal (der) border is shown by a broken line. Scale bars, 75 mm.
206 Consequently, in SPF-NC/Nga mice, the high density of intraepidermal neurites might be due to the decrease of epidermal Sema3A levels. Recent studies have reported that AR is released from transmembrane precursors by metalloproteinases (MPs), and the release is blocked by the
M. Tominaga et al. broad-spectrum MP inhibitors GM6001 and MMP-2/ MMP-9 (gelatinase A and B) inhibitor II [53]. We demonstrated using in situ zymography that gelatinase activity was remarkably increased in the suprabasal layer of Conv-NC/Nga mice compared with that of SPF-NC/Nga mice. Additionally, AR proteins
Fig. 4 Expression patterns of cell—cell junctional molecules in skins of ICR and NC/Nga mice. (A) E-cadherin expression (green) was detected in the epidermis of ICR, SPF-NC/Nga and Conv-NC/Nga mice. The expression level was decreased only in the basal layer of Conv-NC/Nga mice. In the suprabasal layer, the level of E-cadherin expression remained unchanged among these mice. (B) Differential interference contrast (DIC) microscopic analysis in the skins shown in panel A. (C) ZO-1 (green) was expressed in the granular layer of both ICR and SPF-NC/Nga mice. In Conv-NC/Nga mice, the expression was undetectable in the granular layer. Nuclei were stained with DAPI (blue). (D) DIC microscopic analysis of the skins shown in panel C. (E) Expression of Dsg3 (red) was observed in the basal layer of ICR and SPF-NC/Nga mice. In Conv-NC/Nga mice, the protein was expressed in the suprabasal layer but not in the basal layer. Nuclei were stained with DAPI (blue). (F) DIC microscopic analysis of the skins shown in panel E. In panels A, C and E, the epidermal (epi)-dermal (der) borders are shown by broken lines. Scale bars, 30 mm.
Intraepidermal neurite formation in atopic NC/Nga mice
207
Figure 4. (Continued ).
were localized in the plasma membrane of basal cells. In contrast, they were diffused in the suprabasal layer. Thus, gelatinase in suprabasal cells may be involved in AR elaboration into intercellular space between keratinocytes. Shubayev and Myers have also reported that MMP-9 (gelatinase B) promotes NGF-induced neurite elongation in PC12 cells [54], suggesting that the increased level of gelatinase activity in NC/Nga mice may play a role in the promotion of intraepidermal neurite outgrowth (Fig. 5A). To further identify the types of gelatinase, distribution of MMP-2 and MMP-9 was examined imunohistochemically in the skins of Conv-NC/Nga mice. However, increased expression of these MMPs was not observed in the epidermis (data not shown). Therefore, further studies using enzymatical methods will be required to identify the types of gelatinase. Adherens junctions and tight junctions are critical for normal epidermal barrier function and have been shown to be altered in psoriasis [55— 58]. Epidermally targeted AR-transgenic mouse strains develop many features of psoriasis spontaneously [59,60]. In the AR-transgenic mice, expression of E-cadherin, an adherens junction
protein, is downregulated in the epidermis [61]. In addition, levels of the tight junction proteins, ZO-1 and ZO-2, are also downregulated in the epidermis of AR-transgenic mice. Thus, AR causes downregulation of the epithelial junctional molecules in psoriatic skins, suggesting that AR affects the integrity of cell—cell junctions. But to date, no such changes were found in atopic skins. In this investigation, we found that the expression of Ecadherin and ZO-1 was decreased only in the epidermis of Conv-NC/Nga mice. This result indicates that the expression of adherens and tight junction proteins is downregulated in atopic skin as well as psoriatic skin. We also found an increased expression of emidermal AR in ConvNC/Nga mice. Therefore, the downregulation of E-cadherin and ZO-1 may be caused by the activation of AR receptor signaling. Desmosomes are complex intercellular junctions that link the keratin filaments of adjacent cells, providing mechanical strength to epithelial tissues such as the epidermis. Dsg3 is one of the desmosomal cadherins. In mammalian skin, the protein is expressed at high levels in the basal layer, and its expression decreases when the cells differentiate
208
M. Tominaga et al.
Fig. 5 A hypothetical mechanism of intraepidermal neurite formation in atopic NC/Nga mice. (A) In atopic skin, epidermal keratinocytes produce NGF and AR proteins at high levels. Elevated levels of these growth factors may induce neurite outgrowth in/into the epidermis. Additionally, gelatinase is involved in AR elaboration and NGF-induced neurite elongation. Therefore, the increase of gelatinase activity may promote the epidermal neurite outgrowth. (B) A widening of intercellular space in the epidermis of atopic NC/Nga mice may be caused by the downregulation of E-cadherin and ZO1 and misexpression of Dsg3. It could be speculated that the increased intercellular space promotes the neurite outgrowth in/into the epidermis.
[62]. Electron microscopic analysis in Dsg3transgenic mice using cytokeratin 1 promoter has revealed an increase of intercellular spaces in the basal and spinous layers [63]. In this study, we found that Dsg3 protein is misexpressed in the epidermis of Conv-NC/Nga mice but not in other groups. This result suggests a widening of intercellular spaces in the epidermis. It is also possible that the increased spaces are required for neurite elongation into the epidermis such as T-cell infiltration in AD [64]. Taken together, the downregulation of E-cadherin and ZO-1 and the misexpression of Dsg3 may provide intercellular spaces for epidermal neurite formation (Fig. 5B). This idea is also supported by previous studies that E-cadherin conditional knockout mice show an increase of intercellular spaces in the basal layer [65,66]. Thus, the intraepidermal neurite formation in atopic NC/Nga mice could be regulated by alterations in the epidermal extracellular environment.
Acknowledgements This work was supported by a Health Labour Sciences Research Grant for Research on Allergic disease and Immunology from the Japanese Ministry of Health, Labour and Welfare, and by MEXT. HAITEKU (2002).
References [1] Werner Y, Lindberg M, Forslind B. Membrane-coating granules in ‘‘dry’’ non-eczematous skin of patients with atopic dermatitis. A quantitative electron microscopic study. Acta Derm Venereol 1987;67:385—90. [2] Fartasch M, Diepgen TL. The barrier function in atopic dry skin. Disturbance of membrane-coating granule exocytosis and formation of epidermal lipids? Acta Derm Venereol Suppl (Stockh) 1992;176:26—31. [3] Wahlgren CF. Itch and atopic dermatitis: an overview. J Dermatol 1999;26:770—9. [4] Williams HC. Atopic dermatitis: new information from epidemiological studies. Br J Hosp Med 1994;52:409—12.
Intraepidermal neurite formation in atopic NC/Nga mice [5] Koblenzer CS. Itching and the atopic skin. J Allergy Clin Immunol 1999;104:S109—13. [6] Yosipovitch G, Greaves MW, Fleischer Jr AB, McGlone F. Itch, Basic Mechanisms and Therapy. Marcel Dekker, Inc.; 2004. [7] Stander S, Steinhoff M. Pathophysiology of pruritus in atopic dermatitis: an overview. Exp Dermatol 2002;11:12—24. [8] Heyer G. Abnormal cutaneous neurosensitivity in atopic skin. Acta Derm Venereol Suppl (Stockh) 1992;176:93—4. [9] Rukwied R, Lischetzki G, McGlone F, Heyer G, Schmelz M. Mast cell mediators other than histamine induce pruritus in atopic dermatitis patients: a dermal microdialysis study. Br J Dermatol 2000;142:1114—20. [10] Kuraishi Y, Nagasawa T, Hayashi K, Satoh M. Scratching behavior induced by pruritogenic but not algesiogenic agents in mice. Eur J Pharmacol 1995;275:229—33. [11] Levi-Montalcini R. The nerve growth factor 35 years later. Science 1987;237:1154—62. [12] Lewin GR, Mendell LM. Nerve growth factor and nociception. Trends Neurosci 1993;16:353—9. [13] Bennett DL, Koltzenburg M, Priestley JV, Shelton DL, McMahon SB. Endogenous nerve growth factor regulates the sensitivity of nociceptors in the adult rat. Eur J Neurosci 1998;10:1282—91. [14] Urashima R, Mihara M. Cutaneous nerves in atopic dermatitis. A histological, immunohistochemical and electron microscopic study. Virchows Arch 1998;432:363—70. [15] Steinhoff M, Stander S, Seeliger S, Ansel JC, Schmelz M, Luger T. Modern aspects of cutaneous neurogenic inflammation. Arch Dermatol 2003;139:1479—88. [16] Dou YC, Hagstromer L, Emtestam L, Johansson O. Increased nerve growth factor and its receptors in atopic dermatitis: an immunohistochemical study. Arch Dermatol Res 2006;298:31—7. [17] Matsuda H, Watanabe N, Geba GP, Sperl J, Tsudzuki M, Hiroi J, et al. Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice. Int Immunol 1997;9:461—6. [18] Kawamoto K, Matsuda H. Animal Models of Human Inflammatory Skin Diseases. LLC: CRC Press; 2004. [19] Horiuchi Y, Bae S, Katayama I. Nerve growth factor (NGF) and epidermal nerve fibers in atopic dermatitis model NC/ Nga mice. J Dermatol Sci 2005;39:56—8. [20] Tanaka A, Matsuda H. Expression of nerve growth factor in itchy skins of atopic NC/NgaTnd mice. J Vet Med Sci 2005;67: 915—9. [21] Sugiura H, Omoto M, Hirota Y, Danno K, Uehara M. Density and fine structure of peripheral nerves in various skin lesions of atopic dermatitis. Arch Dermatol Res 1997;289:125—31. [22] Toyoda M, Nakamura M, Makino T, Hino T, Kagoura M, Morohashi M. Nerve growth factor and substance P are useful plasma markers of disease activity in atopic dermatitis. Br J Dermatol 2002;147:71—9. [23] Takano N, Sakurai T, Kurachi M. Effects of anti-nerve growth factor antibody on symptoms in the NC/Nga mouse, an atopic dermatitis model. J Pharmacol Sci 2005;99:277— 86. [24] Inagaki N, Nagao M, Igeta K, Kawasaki H, Kim JF, Nagai H. Scratching behavior in various strains of mice. Skin Pharmacol Appl Skin Physiol 2001;14:87—96. [25] Hashimoto Y, Arai I, Takano N, Tanaka M, Nakaike S. Induction of scratching behaviour and dermatitis in various strains of mice cohabiting with NC/Nga mice with chronic dermatitis. Br J Dermatol 2006;154:28—33. [26] Hayashita-Kinoh H, Kinoh H, Okada A, Komori K, Itoh Y, Chiba T, et al. Membrane-type 5 matrix metalloproteinase is expressed in differentiated neurons and regulates axonal growth. Cell Growth Differ 2001;12:573—80.
209
[27] Thompson RJ, Doran JF, Jackson P, Dhillon AP, Rode J. PGP 9.5-a new marker for vertebrate neurons and neuroendocrine cells. Brain Res 1983;278:224—8. [28] Dalsgaard CJ, Rydh M, Haegerstrand A. Cutaneous innervation in man visualized with protein gene product 9.5 (PGP 9. 5) antibodies. Histochemistry 1989;92:385—90. [29] Ljubimov AV, Afanasjeva AV, Litvinova LV, Senin VM. Basement membrane components produced by a mouse ascites teratocarcinoma TB24. Analysis with monoclonal and polyclonal antibodies. Exp Cell Res 1986;165:530—40. [30] Kimura H, Schubert D. Schwannoma-derived growth factor promotes the neuronal differentiation and survival of PC12 cells. J Cell Biol 1992;116:777—83. [31] Nilsson A, Kanje M. Amphiregulin acts as an autocrine survival factor for adult sensory neurons. Neuroreport 2005;16:213—8. [32] Hirai Y, Nose A, Kobayashi S, Takeichi M. Expression and role of E- and P-cadherin adhesion molecules in embryonic histogenesis. II. Skin morphogenesis. Development 1989;105: 271—7. [33] Haftek M, Hansen MU, Kaiser HW, Kreysel HW, Schmitt D. Interkeratinocyte adherens junctions: immunocytochemical visualization of cell—cell junctional structures, distinct from desmosomes, in human epidermis. J Invest Dermatol 1996;106:498—504. [34] Stevenson BR, Siliciano JD, Mooseker MS, Goodenough DA. Identification of ZO-1: a high molecular weight polypeptide associated with the tight junction (zonula occludens) in a variety of epithelia. J Cell Biol 1986;103:755—66. [35] Morita K, Miyachi Y. Tight junctions in the skin. J Dermatol Sci 2003;31:81—9. [36] Shimizu H, Masunaga T, Ishiko A, Kikuchi A, Hashimoto T, Nishikawa T. Pemphigus vulgaris and pemphigus foliaceus sera show an inversely graded binding pattern to extracellular regions of desmosomes in different layers of human epidermis. J Invest Dermatol 1995;105:153—9. [37] Amagai M, Koch PJ, Nishikawa T, Stanley JR. Pemphigus vulgaris antigen (desmoglein 3) is localized in the lower epidermis, the site of blister formation in patients. J Invest Dermatol 1996;106:351—5. [38] Albers KM, Wright DE, Davis BM. Overexpression of nerve growth factor in epidermis of transgenic mice causes hypertrophy of the peripheral nervous system. J Neurosci 1994;14:1422—32. [39] Albers KM, Perrone TN, Goodness TP, Jones ME, Green MA, Davis BM. Cutaneous overexpression of NT-3 increases sensory and sympathetic neuron number and enhances touch dome and hair follicle innervation. J Cell Biol 1996;134:487— 97. [40] LeMaster AM, Krimm RF, Davis BM, Noel T, Forbes ME, Johnson JE, et al. Overexpression of brain-derived neurotrophic factor enhances sensory innervation and selectively increases neuron number. J Neurosci 1999;19: 5919—31. [41] Verge VM, Richardson PM, Wiesenfeld-Hallin Z, Hokfelt T. Differential influence of nerve growth factor on neuropeptide expression in vivo: a novel role in peptide suppression in adult sensory neurons. J Neurosci 1995;15: 2081—96. [42] Katsuno M, Aihara M, Kojima M, Osuna H, Hosoi J, Nakamura M, et al. Neuropeptides concentrations in the skin of a murine (NC/Nga mice) model of atopic dermatitis. J Dermatol Sci 2003;33:55—65. [43] Mogil JS, Miermeister F, Seifert F, Strasburg K, Zimmermann K, Reinold H, et al. Variable sensitivity to noxious heat is mediated by differential expression of the CGRP gene. Proc Natl Acad Sci USA 2005;102:12938—43.
210 [44] Green AD, Young KK, Lehto SG, Smith SB, Mogil JS. Influence of genotype, dose and sex on pruritogen-induced scratching behavior in the mouse. Pain 2006;124:50—8. [45] Ikoma A, Steinhoff M, Stander S, Yosipovitch G, Schmelz M. The neurobiology of itch. Nat Rev Neurosci 2006;7:535— 47. [46] Furutani K, Koro O, Hide M, Yamamoto S, Substance. P- and antigen-induced release of leukotriene B4, prostaglandin D2 and histamine from guinea pig skin by different mechanisms in vitro. Arch Dermatol Res 1999;291:466—73. [47] Burbach GJ, Kim KH, Zivony AS, Kim A, Aranda J, Wright S, et al. The neurosensory tachykinins substance P and neurokinin A directly induce keratinocyte nerve growth factor. J Invest Dermatol 2001;117:1075—82. [48] Aioi A, Tonogaito H, Suto H, Hamada K, Ra CR, Ogawa H, et al. Impairment of skin barrier function in NC/Nga Tnd mice as a possible model for atopic dermatitis. Br J Dermatol 2001;144:12—8. [49] Kinkelin I, Motzing S, Koltenzenburg M, Brocker EB. Increase in NGF content and nerve fiber sprouting in human allergic contact eczema. Cell Tissue Res 2000;302:31—7. [50] Raper JA. Semaphorins and their receptors in vertebrates and invertebrates. Curr Opin Neurobiol 2000;10:88—94. [51] Fujisawa H. Discovery of semaphorin receptors, neuropilin and plexin, and their functions in neural development. J Neurobiol 2004;59:24—33. [52] Dontchev VD, Letourneau PC. Nerve growth factor and semaphorin 3A signaling pathways interact in regulating sensory neuronal growth cone motility. J Neurosci 2002;22:6659—69. [53] Kansra S, Stoll SW, Johnson JL, Elder JT. Autocrine extracellular signal-regulated kinase (ERK) activation in normal human keratinocytes: metalloproteinase-mediated release of amphiregulin triggers signaling from ErbB1 to ERK. Mol Biol Cell 2004;15:4299—309. [54] Shubayev VI, Myers RR. Matrix metalloproteinase-9 promotes nerve growth factor-induced neurite elongation but not new sprout formation in vitro. J Neurosci Res 2004;77: 229—39. [55] Pummi K, Malminen M, Aho H, Karvonen SL, Peltonen J, Peltonen S. Epidermal tight junctions: ZO-1 and occludin are expressed in mature, developing, and affected skin and in
M. Tominaga et al.
[56]
[57]
[58]
[59]
[60]
[61]
[62] [63]
[64]
[65]
[66]
vitro differentiating keratinocytes. J Invest Dermatol 2001;117:1050—8. Perez-Moreno M, Jamora C, Fuchs E. Sticky business: orchestrating cellular signals at adherens junctions. Cell 2003;112: 535—48. Zhou S, Matsuyoshi N, Takeuchi T, Ohtsuki Y, Miyachi Y. Reciprocal altered expression of T-cadherin and P-cadherin in psoriasis vulgaris. Br J Dermatol 2003;149:268—73. Harhaj NS, Antonetti DA. Regulation of tight junctions and loss of barrier function in pathophysiology. Int J Biochem Cell Biol 2004;36:1206—37. Cook PW, Piepkorn M, Clegg CH, Plowman GD, DeMay JM, Brown JR, et al. Transgenic expression of the human amphiregulin gene induces a psoriasis-like phenotype. J Clin Invest 1997;100:2286—94. Cook PW, Brown JR, Cornell KA, Pittelkow MR. Suprabasal expression of human amphiregulin in the epidermis of transgenic mice induces a severe, early-onset, psoriasis-like skin pathology: expression of amphiregulin in the basal epidermis is also associated with synovitis. Exp Dermatol 2004;13:347— 56. Chung E, Cook PW, Parkos CA, Park YK, Pittelkow MR, Coffey RJ. Amphiregulin causes functional downregulation of adherens junctions in psoriasis. J Invest Dermatol 2005;124: 1134—40. Wheelock MJ, Johnson KR. Cadherins as modulators of cellular phenotype. Annu Rev Cell Dev Biol 2003;19:207—35. Merritt AJ, Berika MY, Zhai W, Kirk SE, Ji B, Hardman MJ, et al. Suprabasal desmoglein 3 expression in the epidermis of transgenic mice results in hyperproliferation and abnormal differentiation. Mol Cell Biol 2002;22:5846—58. Wittmann M, Werfel T. Interaction of keratinocytes with infiltrating lymphocytes in allergic eczematous skin diseases. Curr Opin Allergy Clin Immunol 2006;6:329—34. Young P, Boussadia O, Halfter H, Grose R, Berger P, Leone DP, et al. E-cadherin controls adherens junctions in the epidermis and the renewal of hair follicles. EMBO J 2003;22:5723— 33. Tinkle CL, Lechler T, Pasolli HA, Fuchs E. Conditional targeting of E-cadherin in skin: insights into hyperproliferative and degenerative responses. Proc Natl Acad Sci USA 2004;101: 552—7.