A ketogenic diet combined with melatonin overcomes cisplatin and vincristine drug resistance in breast carcinoma syngraft

Journal Pre-proof

Ketogenic Diet Combined With Melatonin Overcomes Cisplatin and Vincrisitne Drug Resistance in Breast Carcinoma Syngraft Wamidh H. Talib PII: DOI: Reference:

S0899-9007(19)30242-4 https://doi.org/10.1016/j.nut.2019.110659 NUT 110659

To appear in:

Nutrition

Received date: Revised date: Accepted date:

22 July 2019 19 October 2019 4 November 2019

Please cite this article as: Wamidh H. Talib , Ketogenic Diet Combined With Melatonin Overcomes Cisplatin and Vincrisitne Drug Resistance in Breast Carcinoma Syngraft, Nutrition (2019), doi: https://doi.org/10.1016/j.nut.2019.110659

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Elsevier Inc. All rights reserved.

1

Ketogenic Diet Combined With Melatonin Overcomes Cisplatin and Vincrisitne Drug Resistance in Breast Carcinoma Syngraft Wamidh H. Talib Department of Clinical Pharmacy and Therapeutic, Applied Science Private University, Amman, Jordan

Running head: breaking cancer drug resistance by diet For correspondence: Dr. Wamidh H. Talib Department of Clinical Pharmacy and Therapeutic, Applied Science Private University, Amman, Jordan E-mail: [email protected] TEL: 00962-799840987 Conflict of interest statement: No potential conflicts of interest. Financial support: Funded by Applied Science Private University, Amman, Jordan (Grant No. DRGS-2014-2015-166). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

2

Highlights

 Ketogenic diet and melatonin were tested for their ability to overcome drug resistance in breast cancer implanted in mice.  Combination of ketogenic diet and melatonin showed high ability to inhibit cisplatin and vincristine breast cancer in mice.  This combination target cancer cells by apoptosis induction, angiogenesis inhibition, lowering blood glucose, and increasing the level of ketone bodies in the blood.  The combination of melatonin and ketogenic diet represents a promising option to overcome drug resistance in cancer chemotherapy and can be used to augment conventional anticancer therapies.

3

Abstract Background: Chemotherapy is one of the major treatments of cancer. Therefore, development of new mechanisms to overcome drug resistance is essential and may be further developed into effective therapies that can flip the switch from drug resistance to susceptibility. In this study, a combination consisting of ketogenic diet and melatonin was evaluated to inhibit cisplatin and vincristine resistance breast cancer. Methods: In the in vitro part, drug resistant cell lines were treated with melatonin and real time PCR was used to measure levels of expression of genes involved in apoptosis and resistance. On protein level, the activity of caspase-3 and the level of VEGF protein were determined. In the in vivo part, tumor bearing mice received one of the following treatments: ketogenic diet, melatonin, combination of melatonin and ketogenic diet, vehicle, and chemotherapy. Results: Successful inhibition of resistant cell lines was achieved by melatonin. This inhibition is mediated by apoptosis induction, angiogenesis inhibition, and down-regulation of resistance genes. A synergistic anticancer effect was observed between melatonin and ketogenic diet against resistant breast tumors inoculated in mice with percentage cure of 70%. Conclusions: The combination of melatonin and ketogenic diet represents a promising option to overcome drug resistance in cancer chemotherapy. However, further testing on the protein level using flow cytometry is important to have better understanding to the mechanisms of action.

Key Words: Drug Resistance, Breast Cancer, Chemotherapy, Combination Therapy

4

Introduction Chemotherapy and radiation are the mainstream anticancer treatment modalities. Both therapies faced multiple setbacks in the battle against cancer. One of the main hurdles is the development of multidrug resistance (MDR) [1]. The definition of MDR is the resistance of cancer cells to the effects of structurally and functionally unrelated therapeutic agents. This resistance is divided into two types: intrinsic (present before exposure to the drug) and extrinsic (arise during treatment). About 50% of drug resistance in cancer is intrinsic [2] and it is common in some cancers like lung, melanoma, and pancreatic cancers [3]. On the other hand, breast, ovarian, and leukemia are more associated with extrinsic resistance [4]. Diverse mechanisms were exploited by cancer cells to resist chemotherapeutic agents. The main mechanisms include: drug target modification, accelerated drug efflux, biotransformation of drugs into nontoxic products, enhanced activity of DNA repair system, and resistance to apoptosis [5]. Melatonin (N-acetyl-5-methoxytryptamine) is an indoleamine with numerous biological activities including immune system modulation, reducing oxidative stress, vasoregulation, anti-inflammation, and anticancer [6]. During the last 80 years, large number of studies showed potent anticancer effects of melatonin experimentally and clinically [7]. Apoptosis induction, immune system modulation, angiogenesis inhibition, inhibition of metastasis, and targeting tumor metabolism are among the mechanisms used by melatonin to inhibit cancer [8-9]. These inhibitory effects are not limited to normal cancer cells and recent studies reported the ability of melatonin to sensitize various resistant cancers to chemotherapeutic agents [5]. One study showed that melatonin

5

supplementation reduced the expression of breast cancer resistance protein (BCRP) in MCF-7 breast tumor xenografts and suppressed carbonyl reductase 1 (CBR1) and aldoketo reductases (AKR) levels in doxorubicin resistant breast cancer. Both enzymes are involved in acquired and intrinsic resistance by metabolic inactivation of chemotherapeutic agents [10]. Other mechanisms of melatonin to sensitize resistant cancer cells include enhancing the activity of DNA damage repair systems [11], apoptosis induction [12], inhibition of human telomerase reverse transcriptase (hTERT) activity [13], and suppression of aerobic glycolysis [14]. Cancer cells depend mainly on aerobic glycolysis as a source of energy production. This metabolic alteration ensures rapid ATP production and divergence of carbon from glucose to produce various macromolecules like proteins, lipids, and nucleotides [15]. As a result of this alteration, glucose is catabolized to lactate instead of full oxidation to carbon dioxide by mitochondrial oxidative phosphorylation [16]. Many studies tested supplements and dietary components as cancer preventive agents. However, limited studies focused on using diet as adjuvant cancer therapy. One of these adjuvant therapies is the ketogenic diet. This diet consists of high fat, very low carbohydrates, and moderate proteins levels [17]. Such composition shifts the metabolism in the body toward burning of fat instead of carbohydrates. After ingestion of a ketogenic diet, fatty acids are oxidized in the liver to ketone bodies (β-hydroxybutyrate, acetoacetate, and acetone) which then transported through the circulation to different tissues in the body where they are converted to acetyl-CoA. The net result of consuming ketogenic diet is a modest decrease in blood glucose, high levels of ketone bodies and greater glycemic control (low levels of hemoglobin A1C) [18].

6

Many studies were conducted to evaluate the effectiveness of ketogenic diet against different cancers. The diet reduced tumor size and improved survival in animal models of malignant glioma [19], gastric cancer [20], prostate cancer [21], and colon cancer [22]. Clinical studies showed 21.8% reduction in tumor size of advanced stage malignant astrocytoma after taking ketogenic diet [23]. Combination of ketogenic diet with standard treatment caused improvement in female patient with glioblastoma multiforme [24]. In this study a novel combination of melatonin and ketogenic diet was evaluated to overcome breast cancer drug resistance in mice. The hypothesis of this research is that ketogenic diet may decrease the function of drug resistance pumps by lowering ATP availability in cancer cells. This effect may be augmented by melatonin targeting multiple mechanisms in drug resistance.

Materials and methods Cell culture Three mouse mammary cell lines were used in this study. The parent (EMT6/P), cisplatin resistance (EMT6/CPR), and vincristine resistance (EMT6/VCR/R) cell lines were purchased from the European Collection of Cell Cultures (Salisbury, UK). All cell lines were cultured using minimum essential medium supplemented with 10% fetal calf serum, 1% L-glutamine, 0.1% gentamycin, and 1% penicillin-streptomycin solution. Cells were incubated at 37°C, 5% carbon dioxide, and 95% humidity.

7

Antiproliferative (MTT) assay Mouse mammary cell lines (EMT6/P, EMT6/CPR, and EMT6/VCR/R) were cultured overnight then actively growing cells were harvested and tested for viability using trypane blue exclusion method. Cells were counted then cultured into 96-well tissue culture flat bottom plates at a density of 15 000 cells/well for 24 hours incubation. After incubation, cells were exposed to increasing concentration of melatonin (3.5–20 mM) for 48 hours. Cell viability was tested using 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) assay and color development was measured using microplate reader (Biotek, Winooski, VT, USA) at a wave length of 595 nm. Percentage cell survival was measured for all treatments and compared with untreated cells. Increasing concentrations of cisplatin and vincristine sulfate (2.5 -100 µM) were used to test the response of different cell lines against standard chemotherapeutic agents. The resistance index (RI) was calculated using the following equation: RI = (IC50 in resistance cells)/(IC50 in parental cells) x100% [25].

Measuring apoptosis induction in cultured cells The ability of melatonin to induce apoptosis in parent and drug resistance cell lines was measured through evaluation of caspase-3 activity. Freshly growing cells (EMT6/P, EMT6/CPR, and EMT6/VCR/R) were treated for 48 h with melatonin at concentrations close to the IC50 value for each cell line. Cisplatin and vincristine sulfate were used as positive controls. After treatment, cells were harvested, washed, and lysed using lysis buffer. Caspase-3 activity for different treatments was measured using instructions in the standard kit (caspase-3assay kit, Abcam, Cambridge, MA, USA).

8

Determination of VEGF expression Parent and drug resistance cell lines were cultured for 24 h then harvested using trypsinEDTA treatment. Cells were suspended in culture media and assessed for their viability using trypan blue dye exclusion method. Cells were seeded at a concentration of 1.3×10 6 cell/10 ml media and incubated for 24 h in small tissue culture flasks (one flask for each cell line). Then, culture media were removed and replaced with fresh media containing melatonin (8 mM). Cells treated with cisplatin and vincristine were used as positive controls and untreated cells were used as a negative control. Cells were incubated for 48 h followed by removal of culture media and harvesting cells. Mouse VEGF ELISA kit (catalogue # RAB0510; Sigma-Aldrich, Missouri, USA) was used to measure the expression of Vascular Endothelial Growth Factor (VEGF) in treated cells.

Real-time PCR assay Actively growing cells (parent and resistant cell lines) were harvested, washed, counted, and seeded in 96 well-plate at a density of 15,000 cells/ well. Cultured cells were exposed to melatonin for 48 h at a concentration of 8 mM. SV Total RNA Isolation System (Promega, USA) was used to extract total RNA from treated cells and RNA concentration was determined via absorbance at 260/ 280 nm (Quawell NanoDrop, USA). cDNA synthesis was achieved using 1000 ng of RNA in a 20 μl reaction volume using (SCRIPT cDNA Synthesis Kit, Germany). Random hexamer primers were used in reverse transcription reaction and real time PCR was conducted using the (5x HOT FIREPol EvaGreen Qpcr Supermix kit, Estonia). Targets primers were provided from (Solis

9

BioDyne, Estonia) and primers sequence was designed according to previous study [26]. The following reaction conditions were used for qPCR reaction and (Prime Pro 48 Realtime qPCR, UK) was used to carry out the amplification process. Cycle step Initial denaturation Denaturation Annealing Elongation

Temp. 95c 95c 62c 72c

Time 12 min 15 sec. 25 sec. 25 sec

Cycles 1 40

The same microchip plate was used to amplify all targeted genes in duplicate. Dissociation curve analysis was used to confirm that only one PCR product was amplified and the amplicons for all targets were tested by gel electrophoresis to check the number of the resulting bands from each amplicon. The following primers were used in this experiment:

Target

Forward Primer (5’  3’)

Reverse Primer (5’  3’)

β -actin

CATGTACGTTGCTATCCAGGC

CTCCTTAATGTCACGCACGAT

CASP 3

AGAACTGGACTGTGGCATTGAG

GCTTGTCGGCATACTGTTTCAG

CASP 7

AGTGACAGGTATGGGCGTTCG

CASP 8

CTCCCCAAACTTGCTTTATG

AAGACCCCAGAGCATTGTTA

CASP 9

CTGTCTACGGCACAGATGGAT

GGGACTCGTCTTCAGGGGAA

GCATCTATCCCCCCTAAAGTGG

P53

TCAACAAGATGTTTTGCCAACTG ATGTGCTGTGACTGCTTGTAGATG

BAX

CCTTTTCTACTTTGCCAGCAAAC

GAGGCCGTCCCAACCAC

BCL2

ATGTGTGTGGAGAGCGTCAACC

TGAGCAGAGTCTTCAGAGACAGCC

BAD

CCTCAGGCCTATGCAAAAAG

AAACCCAAAACTTCCGATGG

PI3K

ACCCAGCAACAGAAAAATGG

GCGCTGTGAATTTAGCCTTC

AKT

AACCTGTGCTCCATGACCTC

CCCTTCTACAACCAGGACCA

10

TOPO I

TCCGGAACCAGTATCGAGAAGA

CCTCCTTTTCATTGCCTGCTC

TOPO II

CTAGTTAATGCTGCGGACAACA

CATTTCGACCACCTGTCACTT

GST

TCCGCTGCAAATACATCTCC

TGTTTCCCGTTGCCATTGAT

Pgp

GTGGGGCAAGTCAGTTCATT

TCTTCACCTCCAGGCTCAGT

VEGFA

GGGCAGAATCATCACGAAGT

ATCTGCATGGTGATGTTGGA

Mice In this study, 165 Balb/C female mice were used. Mice were 4–6 weeks old and 21–25 g/mouse weight. All animal experiments were approved by the Research and Ethical Committee of Applied Science University. Separate cages with wood shavings bedding were used to keep mice. The environmental conditions of the animal house were: stable temperature at 25 ◦C, 50–60% humidity, continuous air ventilation, and alternating light/dark cycles of 12 h. Antitumor activity on experimental animals Actively growing breast cancer cells (EMT6/P, EMT6/CPR, and EMT6/VCR/R) were harvested by trypsinization and cell viability was assessed using trypan blue exclusion method. Tumor inoculation was conducted by injecting a tumor induction dose of 100 000 cells (in 0.1 mL) in the abdominal area of each female Balb/C mouse. Injected cancer cells were left for 14 days to grow and form new tumors. Digital caliper was used to measure tumor dimensions and the following formula was used to calculate tumor volumes: (A× B2 × 0.5), where A represents represents the length of the longest aspect of the tumor and B represents the length of the aspect perpendicular to A [27]. Tumor-bearing mice were divided as following:

11

1. EMT6/P group: This group involves inoculation of mice with EMT6/P (parent breast cancer cell line) and treatments start 14 days after tumor inoculation. Seventy tumor bearing mice were used in this group and mice were divided into 7 sub-groups (N =10 for each sub-group). Sub-group 1 was used as a negative control and exposed to intraperitoneal injection of vehicle (phosphate-buffered saline) 0.1 mL daily. Sub-group 2 was treated with ketogenic diet (KetoCal®; Nutricia North America, Gaithersburg, MD). This diet provides complete nutrition with a 4:1 ratio of fats to carbohydrates plus protein (72% fat, 15% protein, and 3% carbohydrate). For diet preparation, KetoCal® was mixed with water in (2:1) ratio and fed to the animals each day (ad libitum). Sub-group 3 was treated with daily intraperitoneal injection of melatonin (2 mg/kg/day). Sub-group 4 was treated with a combination of ketogenic diet (similar to subgroup 2) and melatonin treatments (2 mg/kg/day). Sub-group 5 was treated with intraperitoneal injection of cisplatin (6 mg/kg/day). Sub-group 6 was treated with doxorubicin (intraperitoneal injection at 6mg/kg/day). Sub-group 7 was treated with daily intraperitoneal injection of vincristine (2mg/kg/day).

2. EMT6/CPR group: This group involves inoculation of mice with EMT6/CPR (cisplatin resistant breast cancer cell line) and treatments start 14 days after tumor inoculation. Fifty tumor bearing mice were used in this group and mice were divided into 5 sub-groups (N =10 for each sub-group). (Sub-group 1 was used as a negative control and treated as previously described. Sub-group 2 was treated with daily intraperitoneal injection of cisplatin (6 mg/kg/day). Sub-group 3 was

12

treated with ketogenic diet (described above). Sub-group 4 was exposed to melatonin treatment (2 mg/kg/day). Sub-group 5 was subjected to the combination therapy of melatonin (2mg/kg/day) and ketogenic diet (similar to subgroup 3).

3. EMT6/VCR/R group: : This group involves inoculation of mice with EMT6/VCR/R (vincristine resistant breast cancer cell line) and treatments start 14 days after tumor inoculation. Forty five mice were used in this group and mice were divided into 5 sub-groups (N = 9 for each sub-group). Treatments are exactly the same as EMT6/CPR group except that the cisplatin treated group was replaced by vincristine treatment at a concentration of 2 mg/kg/day.

All treatments continued for 14 days. At day 14, tumor volumes were measured, mice were sacrificed, and dissected tumors were stored in 10% formalin.

Measurement of glucose and beta-hydroxybutyrate (β-OHB) levels in the blood Blood levels of glucose and β-OHB were measured on the first day of treatments (day 0) and at the end of the experiment (day 14). Blood glucose levels were measured using Accu-Chek blood glucose monitoring system (Roche, Basel, Switzerland) βHydroxybutyrate Assay Kit (Sigma, USA) was used to measure levels of β-OHB in the blood.

13

Statistical analysis Data are presented using mean ± SE from three independent experiments. One way analysis of variance (ANOVA) followed by unpaired student’s t-test was used to determine the statistical significance among groups (. P < 0.05 was considered significant). Nonlinear regression in Statistical Package for the Social Sciences version 18 (SPSS Inc. Chicago, IL, USA) was used to calculate IC50 values of melatonin against different cell lines.

Results Melatonin inhibits cell proliferation in sensitive and drug resistant cell lines Three breast cancer cell lines (EMT6/P, EMT6/CPR, and EMT6/VCR/R) were used in the in vitro study to evaluate the ability of melatonin to inhibit the sensitive (EMT6/P), cisplatin resistant (EMT6/CPR), and vincristine resistance (EMT6/VCR/R) breast cancer cells. A dose-dependent response was observed after treatment of the sensitive cell line (EMT6/P) with melatonin (5.5 mM- 3.5 mM). The lowest survival percentage (33.6%) was observed at melatonin concentration of 5.5 mM (Figure 1). Treatment of the same cell line with standard chemotherapeutic agents (cisplatin and vincristine,) resulted in similar response with the higher sensitivity toward vincristine (Figure 1A). Cisplatin resistant cell line (EMT6/CPR) was exposed to melatonin treatment at a concentration range (20 mM- 3.5 mM). The cell line exhibited resistance to melatonin

14

compared with the sensitive cell line. For example at melatonin concentration of 5.5 mM the survival percentage increased from 33.6% (Figure 1A) in the sensitive cell line to 51.7% in the resistant cell line (Figure 1B). On the other hand, this cell line showed higher resistance toward cisplatin with the highest survival percentage of 87.1% at cisplatin concentration of 2.5 µM (Figure 1B). This value is higher than the survival percentage (63.3%) observed in the sensitive cell line treated with 3 µM cisplatin (Figure 1A). The resistance to melatonin was also observed in vincristine resistant cell line (EMT6/VCR/R) after treatment with increasing concentrations of melatonin (20 mM- 3.5 mM).The survival percentage was 51.2% in cells treated with 5.5 mM melatonin (Figure 1C) which is higher than the percentage observed in sensitive cells (33.6%) treated with the same concentration of melatonin (Figure 1A). On the other hand, this cell line (EMT6/VCR/R) exhibited very high resistance to vincristine with survival percentage of 82.2% in cells treated with 2.5 µM vincristine compared with 48.6% survival in sensitive (EMT6/P) cells treated with 3 µM vincristine (Figure 1A).

15

Figure 1: Antiproliferative effect of melatonin on breast cancer cell lines. (A) Treatment of EMT6/P cells with increasing concentration melatonint. (B) Treatment of EMT6/CPR cells with increasing concentration melatonin. (C) Treatment of EMT6/VCR/R cells with increasing concentrations of melatonin.

Calculation of IC50 and resistance index values revealed low resistance in both cell lines (EMT6/CP and EMT6/VCR/R) toward melatonin treatment compared with standard chemotherapeutic agents. The IC50 value of melatonin in the sensitive cell line (EMT6/P) was 3.48 mM. This value increased to 7.50 mM in cisplatin resistant cell line (EMT6/CP) and 5.49 in vincristine resistant cell line (EMT6/VCR/R) with resistant index of 2.16 and 1.58, respectively (Table 1). These resistance index values are lower than the values

16

observed with standard chemotherapeutic agents where resistant index values of 2.75 and 36.61 where obtained for cisplatin and vincristine, respectively (Table 1). Table 1: IC50 and resistance index values for melatonin, cisplatin, and vincristine on sensetive and drug resistant breast cancer cell lines.

Treatment EMT6/P (IC50)

EMT6/CP R (IC50) Melatonin 3.48± 0.76 7.50± (mM) 0.89 Cisplatin 4.42± 0.25 12.15 ± (µM) 0.95 Vincristine 1.53± 0.37 …………. (µM)

EMT6/VCR/R Resistance (IC50) index (Cisplatin) 5.49 ± 0.34 2.16

Resistance index (Vincristine) 1.58

………

2.75

……

56.02 ± 0.93

…………

36.61

Melatonin induces apoptosis in sensitive and drug resistant cell lines Caspase-3 activity was used as an indicator for apoptosis induction. An increase in caspase-3 activity was observed in EMT6/P treated with melatonin or one of the standard therapeutic agents (cisplatin, vincristine, and doxorubicin) (Figure 2A). Similar results were obtained after treating EMT6/CP cells with melatonin. However, the cell line showed high resistance to cisplatin with caspase-3 activity levels close to the negative control (Figure 2B). A slight increase in caspase-3 activity was observed in EMT6/VCR/R cells treated with melatonin. However, this limited increase was higher than the increase in caspase-3 activity obtained after treatment with vincristine (Figure 2C).

17

Figure 2: Caspase- 3 activity in breast cancer cells after treatment with melatonin. (A) Treatment of EMT6/P cells with melatonin (3.50 mM), cisplatin (4.50 µM), vincristine (1.50 µM) and doxorubicin (3.5 µM) . (B) Treatment of EMT6/CPR cells with melatonin (3.50 mM), cisplatin (4.50 µM), and vincristine (1.50 µM). (C) Treatment of EMT6/VCR/R cells with melatonin (3.50 mM), cisplatin (4.50 µM), and vincristine (1.50 µM). Results are expressed as means (bars)±SEM (lines). The asterisks represent significant difference compared with the negative control (*P < 0.05). An increase in caspase-3 activity was observed in cells treated with melatonin compared with the negative control.

Melatonin inhibits angiogenesis in sensitive and drug resistant cell lines Angiogenesis inhibition was also evaluated by measuring levels of vascular endothelial growth factor (VEGF). For EMT6/P cell line, all treatments caused reduction in VEGF levels. The highest reduction in VEGF levels was observed in cells treated with

18

doxorubicin (0.10 pg/ml) compared with the negative control group (0.45 pg/ml) (Figure 3A). For EMT6/CP cell line, melatonin showed the highest activity with VEGF levels of 1.10 pg/ml compared with the negative control (1.70 pg/ml) (Figure 3B). A reduction in VEGF levels was also observed in EMT6/VCR/R cells treated with melatonin with VEGF levels of 0.3 pg/ml. This level is lower than VEGF levels obtained in the negative control group (0.45 pg/ml) (Figure 3C).

Figure 3: Vascular Endothelial Growth Factor (VEGF) levels in breast cancer cells after treatment with melatonin. A) Treatment of EMT6/P cells with melatonin (3.50 mM), cisplatin (4.50 µM), vincristine (1.50 µM) and doxorubicin (3.5 µM) . (B) Treatment of EMT6/CPR cells with melatonin (3.50 mM), cisplatin (4.50 µM), and vincristine (1.50 µM). (C) Treatment of EMT6/VCR/R cells with melatonin (3.50 mM), cisplatin (4.50 µM), and vincristine (1.50 µM). Each treatment was performed three times. Results are expressed as means (bars)±SEM (lines). The asterisks represent significant difference compared with the negative control (*P < 0.05). Melatonin caused a decrease in VEGF levels in all cell lines.

19

Melatonin increases the expression of pre-apoptotic genes and decreases the expression of resistant genes The effect of melatonin on expression levels of genes involves in apoptosis and resistance were evaluated using real time PCR. For EMT6/P cells, an increase in the expression of pre-apoptotic genes (BAD, BAX, and P53) and a decrease in anti-apoptotic gene (BCL2) were observed in cells treated with melatonin. Similar results were obtained for cells treated with cisplatin or vincristine (Figure 4A). On the other hand, an increase in the expression levels of capsases 3, 7, and 8 was observed in cells treated with melatonin compared with the negative control (Figure 4B). Additionally, PI3K and AKT expression levels were decreased after melatonin treatment and topoisomerases 1 and 2 were also decreased (Figure 4C).

20

Figure 4: Relative RNA expression of target genes in EMT6/P cells treated for 48 h with melatonin (3.50 mM). Values are presented as mean (bars)±SEM (lines) of three replicates. The asterisks represent significant difference compared with the negative control (*P < 0.05). Similar results were obtained for EMT6/CP cells treated with melatonin with an increase in pre-apoptotic genes (BAX and P53) and a decrease in anti-apoptotic gene expression (BCL2) (Figure 5A). An increase in the expression of caspases was observed in this cell line after melatonin treatment (Figure 5B). Moreover, melatonin treatment induced a decrease in PI3K and AKT expression levels with an increase in the expression levels of topoisomerase 2 (Figure 5C). The results observed in EMT6/VCR/R treated with melatonin were close to the result obtained with EMT6/CP cells (Figure 6).

21

Figure 5: Relative RNA expression of target genes in EMT6/CPR cells treated for 48 h with melatonin (3.50 mM). Values are presented as mean (bars)±SEM (lines) of three replicates. The asterisks represent significant difference compared with the negative control (*P < 0.05).

22

Figure 6: Relative RNA expression of target genes in EMT6/VCR/R cells treated for 48 h with melatonin (3.50 mM). Values are presented as mean (bars)±SEM (lines) of three replicates. The asterisks represent significant difference compared with the negative control (*P < 0.05). A reduction in the expression levels of P-glycoprotein (Pgp), glutathione-s-transferase, and vascular endothelial growth factor (VEGFA) was achieved after treating EMT6/CP cells with melatonin (Figure 7A). Similar results were also obtained with EMT6/VCR/R cells treated with melatonin (Figure 7B).

23

Figure 7: Relative RNA expression of target genes in EMT6/ CP and EMT6/VCR/R cells treated for 48 h with melatonin (3.50 mM). Values are presented as mean (bars)±SEM (lines) of three replicates. The asterisks represent significant difference compared with the negative control (*P < 0.05).

Ketogenic diet combined with melatonin caused regression of sensitive and drug resistant tumors inoculated in mice Results of the in vivo study revealed that daily treatment (for 14 days) of EMT6/P tumor bearing mice with ketogenic diet induced 20% cure (Figure 8) with around 74% (Table 2) reduction in tumor size compared with the negative control. The cure percentage

24

increased to 30% for mice treated with melatonin with percentage regression in tumor size around 73%. Table 2: Effect of different treatments on tumor size and cure percentage Treatment

% change in tumor size (EMT6/P)

% change in tumor size (EMT6/C PR)

% change in tumor size (EMT6/V CR/R)

% cure (EMT 6/P)

% cure (EMT6/CP R)

% cure (EMT6/VCR/ R)

Melatonin Ketogenic diet Melatonin + ketogenic diet cisplatin

-72. 88 -73.96

-78.19 -60.11

-80.87 -78.72

30 20

44.40 22.20

30.00 20.00

-87.75

-87.56

-93.06

70

55.50

70.00

-85.18

-17.29

70

0.00

……….

vincristine Negative control

-88.20 94.02

……… 23.02

………… . 17.34 27.40

70 0

…………. 11.10%

0.00 0.00

However, the highest cure percentage was achieved in the group treated with a combination of melatonin and ketogenic diet with a 70% cure and around 88% reduction in tumor size (Figure 8 and Table 2). The same cure percentage was also obtained in groups treated with cisplatin, vincristine, and doxorubicin.

25

Figure 8: Effect of different treatments on EMT6/P tumor size and cure percentage. Combination of melatonin and ketogenic diet resulted in highest cure percentage (70%) and lowest tumor sizes. There were 10 mice in each group. The same treatments were repeated for cisplatin resistant (EMT6/CPR) tumor bearing mice. Two mice (out of 9) were spontaneously cured in the untreated group. Similar result was also obtained in the cisplatin treated group. The highest cure percentage (55.5%) was observed in the group treated with melatonin and the group treated with the combination therapy (Figure 9). However, the highest regression in tumor size (87.56%) was observed in the group treated with the combination therapy (Table 2).

26

Figure 9: Effect of different treatments on EMT6/ CP tumor size and cure percentage. Combination of melatonin and ketogenic diet resulted in highest cure percentage (55.5%) and lowest tumor sizes. There were 9 mice in each group.

Vincristine resistant (EMT6/VCR/R) tumor bearing mice were also exposed to the same treatments. Vincristine treated group showed results similar to the untreated group (0% cure). The cure percentage increased to 20% in group treated with ketogenic diet and to 30% in melatonin treated group. However, the highest cure percentage (70%) was observed in the group treated with a combination of melatonin and ketogenic diet (Figure 10). The combination also induced the highest reduction (93%) in tumor size (Table 2).

27

Figure 10: Effect of different treatments on EMT6/VCR/R tumor size and cure percentage. Combination of melatonin and ketogenic diet resulted in highest cure percentage (70%) and lowest tumor sizes. There were 10 mice in each group.

Ketogenic diet decreases blood glucose and increases β-hydroxybutyrate with normal lipid profile Serum levels of glucose and β-hydroxybutyrate were measured for all treatment groups. For all tumor bearing mice, the lowest serum glucose levels were observed in groups treated with ketogenic diet and combination therapy (Figure 11A). On the other hand, both groups showed the highest β-hydroxybutyrate compared with other treatments (Figure 11B).

28

Figure 11: Serum levels of glucose and β-hydroxybutyrate for different treatments. Lowest glucose and highest β-hydroxybutyrate levels were observed in groups taking ketogenic diet and combination therapy. Serum lipid profile was evaluated by measuring total cholesterol, triglycerides, highdensity lipoprotein (LDL), and low-density lipoprotein (HDL). All treatments did not cause significant differences compared with the healthy mice (Figure 12).

29

Figure 12: serum lipid profile in tumors bearing mice exposed to different treatments. No significant difference was observed between treated groups and the negative control.

Discussion Genomic instability in cancer cells drives the emergence of reduced sensitivity and enhanced resistance to anticancer drugs. The pleitropic effects of melatonin make it a targeted agent to overcome drug resistance in cancer [5]. This indole amine has the ability to interfere with multiple cancer hallmarks including angiogenesis, apoptotic pathway, immune evasion, and altered metabolism [8].

30

The altered metabolism in cancer was suggested as an attractive target for selective anticancer therapies. One of the promising and affordable adjuvant anticancer therapies is the use of dietary intervention. Ketogenic diet is an example of such intervention and the anticancer effect of this diet was explained in many studies [17]. However, Ketogenic diet cannot be used as a single anticancer therapy [28].and its combination with conventional therapies resulted in more effective treatments. In the current study, a new combination consisting of melatonin and ketogenic diet was tested to inhibit drug resistance in murine breast cancer cells in vitro and in vivo. The combination exhibited a clear synergistic effect against cisplatin and vincristine resistance breast cancer cells implanted in mice. In the in vitro experiments, melatonin induced a dose dependent inhibition in all tested cell lines. Calculation of resistance index values in resistant cell lines revealed lower resistance toward melatonin compared with standard chemotherapeutic agents (cisplatin and vincristine). Our results are consistent with previous studies reporting the ability the ability of melatonin to sensitize various resistant cancers to the effect of therapeutic agents. A recent review article summarizes this effect of melatonin against lung, colon, hepatic, blood, and breast cancers [5]. For better understanding to the mechanisms of action of melatonin, we measured its ability to inhibit angiogenesis and induce apoptosis in resistant and susceptible cell lines. Melatonin induced apoptosis in resistant and susceptible breast cancer cells by enhancing caspase-3 activity. Such effect of melatonin was reported in previous studies that showed

31

an activation of caspase-3 after melatonin treatment in different cancers including neuroblastoma, cervical cancer, lymphoma, and leukemia [29-32]. Angiogenesis (blood vessels formations) is an essential step in cancer progression, invasion and metastasis [33]. This process is highly associated with the production of vascular endothelial growth factor (VEGF) and other angiogenesis inducing factors [34]. The crucial role of VEGF in the angiogenesis process makes it an attractive target in testing anti-angiogenesis therapies [35]. Our results revealed a significant reduction in VEGF levels in EMT6/P cells treated with melatonin. This inhibition was also observed in cisplatin and vincristine (EMT6/CPR and EMT6/VCR/R) resistant cell lines. These results are in agreement with previous findings that showed a reduction in VEGF expression after melatonin treatment in hepatocarcinoma, breast cancer, and glioblastoma [36-38]. Additionally, oral administration of melatonin was associated with reduced serum VEGF levels in patients with metastatic cancers [39]. Results of the current study also proved that drug resistance does not alter apoptosis induction and anti-angiogenic abilities of melatonin as we noticed enhanced caspase-3 activity and decreased VEGF expression in both resistant and sensitive cells treated with melatonin. In order to have more insight into the mechanism of apoptosis induced by melatonin, we measured the expression of selected genes involved in this process. Apoptosis induction is mediated by two different pathways: intrinsic (mitochondrial-dependent) and extrinsic (death receptor- dependent). The release of cytochrome c from the mitochondria to the cytoplasm is the starter of intrinsic pathway. This release is facilitated by pro-apoptotic proteins like p53 and BAX and inhibited by anti-apoptotic proteins like Bcl-2 [40]. In the cytoplasm, cytochrome c form apoptosome complex which activates caspase 9. Active

32

caspase 9 then activates executioner caspases (3, 6, and 7) to start apoptosis [41]. In the current study we measured the expression level of key components in the intrinsic pathway in addition to caspase 8 which plays an essential role in the extrinsic pathway. We noticed an increase in the expression levels of pro-apoptotic proteins like p53, BAX, and BAD and a decrease in the expression of antiapoptotic protein Bcl-2 after treatment with melatonin. An increase in the expression levels of caspases was also observed. This result was obtained in the sensitive and drug resistant breast cancer cell lines and indicates the involvement of melatonin in intrinsic and extrinsic apoptotic pathways. Our results are consistent with previous findings that showed an increase in intrinsic and extrinsic caspases in hapatocarcinoma cells treated with melatonin [42]. The same study also reported an increase in the expression of pro-apoptotic proteins p53 and BAX. These results also agree with our findings as we have increased p53 and BAX levels after melatonin treatment. Previous studies showed that the effect of melatonin as an inducer of apoptosis can be achieved as a single agent [43-44] or in combination with other therapies [45-46]. Phosphatidylinositol 3-kinases (PI3Ks) are key enzymes for cancer initiation and progression [47]. PI3K catalyze the production of hosphatidylinositol 3,4,5 -triphosphate (PIP3) which acts as an activator of protein kinase B (AKT). The importance of this signaling pathway for cancer proliferation, angiogenesis, invasion, and metastasis make it an attractive target for testing new anticancer therapies [48]. In our study, treatment of cells with melatonin caused an inhibition in PI3K and AKT expression in sensitive and cisplatin resistant breast cancer cells. On the other hand, no inhibition was observed in vincristine resistant cells treated with melatonin. One

33

explanation of this result is the high degree of genetic alteration in this signaling pathway. This alteration causes cancer cells to increase resistance to therapeutic agents. Breast cancer has the highest rate of genetic alteration in PI3K and AKT with incidence percentage of 27% and 3.7%, respectively [49]. It seems that the mutations in PI3K and AKT in vincristine cell line reduce the capacity of melatonin to target this pathway. The effect of melatonin was also evaluated against Topo I and II (DNA topoisomerases). These enzymes are important for DNA replication and they are highly expressed in cancer cells [50]. No inhibitory effect was observed in the expression levels of both enzymes after treatment with melatonin. This indicates that the anticancer effect of melatonin is not mediated by topoisomerases inhibition. Drug resistance in cancer is a complicated process and involves many mechanisms. Over expression of permeability glycoprotein (Pgp) and glutathione-S-transferase (GST) are among these mechanisms. Permeability glycoprotein (Pgp) is an efflux pump working to remove drugs from the cell to keep the intracellular concentration below the killing threshold [51]. Glutathione-S-transferases (GSTs) are a large group of enzymes involved in drug detoxification and they are overexpressed in several cancers [52].The expressions levels of both proteins were measured in drug resistance cell lines after treatment with melatonin. Melatonin caused a decrease in Pgp and GST in cisplatin and vincristine drug resistance cell lines compared with the negative control. This may explain the ability of melatonin to target both resistant cell lines to induce apoptosis and inhibit angiogenesis. We also measured the expression of VEGF in resistance cell lines to confirm our results on the protein level. A decrease in VEGF levels was also observed after treating resistant cells with melatonin.

34

Our in vitro results showed a clear ability of melatonin to inhibit resistant breast cancer cells. In out attempts to augment this ability, we designed an in vivo study to test the effect of melatonin in combination with ketogenic diet against resistant breast cancer cells implanted in mice. The combination was highly effective against sensitive, cisplatin resistant and vincristine resistant cell lines. The effectiveness was reflected by having highest cure percentage and lowest tumor sizes in the groups treated with the combination of melatonin and ketogenic diet. The low glucose levels in ketogenic diet force the body to burn fats for energy production releasing ketone bodies like acetone and β-hydroxybutyrate [17]. In our study, high levels of β-hydroxybutyrate and low blood glucose levels were observed in groups treated with ketogenic diet and combination therapy. Cancer cells exhibit high levels of mutations in mitochondrial DNA with alteration in the expression of mitochondrial proteins [52]. This alteration cause cancer cells to increase their dependence on glycolysis with high glucose consumption in the presence or absence of oxygen (Warburg effect) [53]. In addition to providing energy for cancer cells, high glycolytic rates increase the activity of pentose phosphate pathway to produce two molecules of nicotinamide adenine dinucleotide phosphate (NADPH) which is important for reducing oxidative stress in cancer cells [54]. In our study, the use of ketogenic diet inhibits breast cancer in mice by reducing blood glucose and enhancing oxidative stress. Also the use of this diet resulted in an increase in blood levels of β-hydroxybutyrate which is known of its antitumor effects [55].Our

35

results are consistent with previous findings that showed similar effect of ketogenic diet against glioblastoma [56], gastric [57], prostate [58], and lung cancers [59]. This is the first study to combine the anticancer effect of melatonin with ketogenic diet. This combination therapy showed superior activity compared with single agent therapies and resulted in the highest cure percentage. Additionally, the combination was highly effective against cisplatin and vincristine resistance breast cancer tumors. Furthermore, liver and kidney function tests showed normal values after using this combination which indicates its safety. An explanation of these results is the possible synergistic interaction between melatonin and ketogenic diet. The low glucose levels resulted from using ketogenic diet caused reduction in the capacity of resistant cells to produce ATP needed to run drug resistance pumps. This may help melatonin to reach its therapeutic intracellular concentrations to act as an inducer for apoptosis and inhibitor for angiogenesis. In conclusion, combination of melatonin and ketogenic diet represents a promising therapeutic option to overcome drug resistant in breast cancer. The anticancer activity of this combination is mediated by angiogenesis inhibition, apoptosis induction, lowering blood glucose, and increasing serum levels of β-hydroxybutyrate. However, further studies on protein level (flow cytometry) are necessary to fully understand the mechanisms of action of this combination and its activity on other cancers. Declaration of interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

36

Acknowledgments: The author is grateful to the Applied Science Private University, Amman, Jordan, for the full financial support granted to this research (Grant No. DRGS2014-2015-166).

37

References 1.

Saha, S., Adhikary, A., Bhattacharyya, P., Das, T., & Sa, G. (2012). Death by design: where curcumin sensitizes drug-resistant tumours. Anticancer research, 32(7), 2567-2584.

2.

Lippert, T. H., Ruoff, H. J., & Volm, M. (2011). Current status of methods to assess cancer drug resistance. International journal of medical sciences, 8(3), 245.

3.

Sosin, M. D., & Handa, S. I. (2003). Spontaneous remission of large granular lymphocytic leukaemia. International journal of clinical practice, 57(6), 551-552.

4.

Pommier, Y., Sordet, O., Antony, S., Hayward, R. L., & Kohn, K. W. (2004). Apoptosis defects and chemotherapy resistance: molecular interaction maps and networks. Oncogene, 23(16), 2934.

5.

Asghari, M. H., Ghobadi, E., Moloudizargari, M., Fallah, M., & Abdollahi, M. (2018). Does the use of melatonin overcome drug resistance in cancer chemotherapy?. Life sciences, 196, 143-155.

6.

Reiter, R. J., Tan, D. X., & Fuentes-Broto, L. (2010). Melatonin: a multitasking molecule. In Progress in brain research (Vol. 181, pp. 127-151). Elsevier.

7.

Li, Y., Li, S., Zhou, Y., Meng, X., Zhang, J. J., Xu, D. P., & Li, H. B. (2017). Melatonin for the prevention and treatment of cancer. Oncotarget, 8(24), 39896.

8.

Talib, W. (2018). Melatonin and cancer hallmarks. Molecules, 23(3), 518.

Talib, W. H., & Saleh, S. (2015). Propionibacterium acnes augments antitumor, anti-angiogenesis and immunomodulatory effects of melatonin on breast cancer implanted in mice. PloS one, 10(4), e0124384. 10. Xiang, S., Dauchy, R. T., Hauch, A., Mao, L., Yuan, L., Wren, M. A., ... & Hill, S. M. (2015). Doxorubicin resistance in breast cancer is driven by light at night‐ induced disruption of the circadian melatonin signal. Journal of pineal research, 59(1), 60-69. 9.

38 11. Alonso‐González, C., González, A., Martínez‐Campa, C., Gómez‐Arozamena, J., &

Cos, S. (2015). Melatonin sensitizes human breast cancer cells to ionizing radiation by downregulating proteins involved in double‐strand DNA break repair. Journal of pineal research, 58(2), 189-197. 12. Fic, M., Podhorska-Okolow, M., Dziegiel, P., Gebarowska, E., Wysocka, T., Drag-

Zalesinska, M., & Zabel, M. (2007). Effect of melatonin on cytotoxicity of doxorubicin toward selected cell lines (human keratinocytes, lung cancer cell line A-549, laryngeal cancer cell line Hep-2). in vivo, 21(3), 513-518.

13. Lu, J. J., Fu, L., Tang, Z., Zhang, C., Qin, L., Wang, J., ... & Huang, W. (2016).

Melatonin inhibits AP-2β/hTERT, NF-κB/COX-2 and Akt/ERK and activates caspase/Cyto C signaling to enhance the antitumor activity of berberine in lung cancer cells. Oncotarget, 7(3), 2985. 14. Mao, L., Dauchy, R. T., Blask, D. E., Dauchy, E. M., Slakey, L. M., Brimer, S., ...

& Frasch, T. (2016). Melatonin suppression of aerobic glycolysis (Warburg effect), survival signalling and metastasis in human leiomyosarcoma. Journal of pineal research, 60(2), 167-177. 15. Vander Heiden, M. G., Cantley, L. C., & Thompson, C. B. (2009). Understanding

the Warburg effect: the metabolic requirements of cell proliferation. science, 324(5930), 1029-1033.

16. Doherty, J. R., & Cleveland, J. L. (2013). Targeting lactate metabolism for cancer

therapeutics. The Journal of clinical investigation, 123(9), 3685-3692. 17. Allen, B. G., Bhatia, S. K., Anderson, C. M., Eichenberger-Gilmore, J. M.,

Sibenaller, Z. A., Mapuskar, K. A., ... & Fath, M. A. (2014). Ketogenic diets as an adjuvant cancer therapy: History and potential mechanism. Redox biology, 2, 963970.

18. Westman, E. C., Yancy, W. S., Mavropoulos, J. C., Marquart, M., & McDuffie, J.

R. (2008). The effect of a low-carbohydrate, ketogenic diet versus a low-glycemic

39

index diet on glycemic control in type 2 diabetes mellitus. Nutrition & metabolism, 5(1), 36. 19. Maurer, G. D., Brucker, D. P., Bähr, O., Harter, P. N., Hattingen, E., Walenta, S., ...

& Rieger, J. (2011). Differential utilization of ketone bodies by neurons and glioma cell lines: a rationale for ketogenic diet as experimental glioma therapy. BMC cancer, 11(1), 315.

20. Otto, C., Kaemmerer, U., Illert, B., Muehling, B., Pfetzer, N., Wittig, R., ... & Coy,

J. F. (2008). Growth of human gastric cancer cells in nude mice is delayed by a ketogenic diet supplemented with omega-3 fatty acids and medium-chain triglycerides. BMC cancer, 8(1), 122. 21. Freedland, S. J., Mavropoulos, J., Wang, A., Darshan, M., Demark‐Wahnefried, W.,

Aronson, W. J., ... & Pizzo, S. V. (2008). Carbohydrate restriction, prostate cancer growth, and the insulin‐like growth factor axis. The Prostate, 68(1), 11-19.

22. Beck, S. A., & Tisdale, M. J. (1989). Nitrogen excretion in cancer cachexia and its

modification by a high fat diet in mice. Cancer Research, 49(14), 3800-3804. 23. Nebeling, L. C., Miraldi, F., Shurin, S. B., & Lerner, E. (1995). Effects of a

ketogenic diet on tumor metabolism and nutritional status in pediatric oncology patients: two case reports. Journal of the American College of Nutrition, 14(2), 202208. 24. Zuccoli, G., Marcello, N., Pisanello, A., Servadei, F., Vaccaro, S., Mukherjee, P., &

Seyfried, T. N. (2010). Metabolic management of glioblastoma multiforme using standard therapy together with a restricted ketogenic diet: Case Report. Nutrition & metabolism, 7(1), 33. 25. Wang, X. B., Wang, S. S., Zhang, Q. F., Liu, M., Li, H. L., Liu, Y., ... & Xiang, J.

Z. (2010). Inhibition of tetramethylpyrazine on P-gp, MRP2, MRP3 and MRP5 in multidrug resistant human hepatocellular carcinoma cells. Oncology reports, 23(1), 211-215. 26. Talib, W. H., & Al Kury, L. T. (2018). Parthenolide inhibits tumor-promoting

effects of nicotine in lung cancer by inducing P53-dependent apoptosis and inhibiting VEGF expression. Biomedicine & Pharmacotherapy, 107, 1488-1495.

40

27. Talib, W. H. (2017). Consumption of garlic and lemon aqueous extracts

combination reduces tumor burden by angiogenesis inhibition, apoptosis induction, and immune system modulation. Nutrition, 43, 89-97. 28. Tennant, D. A., Durán, R. V., & Gottlieb, E. (2010). Targeting metabolic

transformation for cancer therapy. Nature reviews cancer, 10(4), 267.

29. García‐Santos, G., Antolín, I., Herrera, F., Martín, V., Rodriguez‐Blanco, J.,

Carrera, M. D. P., & Rodriguez, C. (2006). Melatonin induces apoptosis in human neuroblastoma cancer cells. Journal of pineal research, 41(2), 130-135. 30. Pariente, R., Pariente, J. A., Rodríguez, A. B., & Espino, J. (2016). Melatonin

sensitizes human cervical cancer H e L a cells to cisplatin‐induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation. Journal of pineal research, 60(1), 55-64.

31. Sánchez‐Hidalgo, M., Lee, M., de la Lastra, C. A., Guerrero, J. M., & Packham, G.

(2012). Melatonin inhibits cell proliferation and induces caspase activation and apoptosis in human malignant lymphoid cell lines. Journal of pineal research, 53(4), 366-373. 32. Koh, W., Jeong, S. J., Lee, H. J., Ryu, H. G., Lee, E. O., Ahn, K. S., ... & Kim, S.

H. (2011). Melatonin promotes puromycin‐induced apoptosis with activation of caspase‐3 and 5′‐adenosine monophosphate‐activated kinase‐alpha in human leukemia HL‐60 cells. Journal of pineal research, 50(4), 367-373.

33. Carmeliet, P., & Jain, R. K. (2000). Angiogenesis in cancer and other diseases.

nature, 407(6801), 249. 34. Musumeci, G., Loreto, C., Giunta, S., Rapisarda, V., Szychlinska, M. A., Imbesi,

R., ... & Ribatti, D. (2016). Angiogenesis correlates with macrophage and mast cell infiltration in lung tissue of animals exposed to fluoro-edenite fibers. Experimental cell research, 346(1), 91-98.

41 35. Byrne, A. M., Bouchier‐Hayes, D. J., & Harmey, J. H. (2005). Angiogenic and cell

survival functions of vascular endothelial growth factor (VEGF). Journal of cellular and molecular medicine, 9(4), 777-794. 36. Colombo, J., Maciel, J. M. W., Ferreira, L. C., Da Silva, R. F., & Zuccari, D. A. P.

D. C. (2016). Effects of melatonin on HIF‑1α and VEGF expression and on the invasive properties of hepatocarcinoma cells. Oncology letters, 12(1), 231-237. 37. Alvarez‐García, V., González, A., Alonso‐González, C., Martínez‐Campa, C., &

Cos, S. (2013). Regulation of vascular endothelial growth factor by melatonin in human breast cancer cells. Journal of Pineal Research, 54(4), 373-380. 38. Zhang, Y., Liu, Q., Wang, F., Ling, E. A., Liu, S., Wang, L., ... & Shi, W. (2013).

Melatonin antagonizes hypoxia‐mediated glioblastoma cell migration and invasion via inhibition of HIF‐1α. Journal of pineal research, 55(2), 121-130. 39. Lissoni, P., Rovelli, F., Malugani, F., Bucovec, R., Conti, A., & Maestroni, G. J.

(2001). Anti-angiogenic activity of melatonin in advanced cancer patients. Neuroendocrinology Letters, 22(1), 45-48. 40. Musumeci, G., Castrogiovanni, P., Trovato, F., Weinberg, A., Al-Wasiyah, M.,

Alqahtani, M., & Mobasheri, A. (2015). Biomarkers of chondrocyte apoptosis and autophagy in osteoarthritis. International journal of molecular sciences, 16(9), 20560-20575. 41. Fulda, S., & DEBATIN, K. M. (2004). Apoptosis signaling in tumor therapy.

Annals of the New York Academy of Sciences, 1028(1), 150-156. 42. Martín‐Renedo, J., Mauriz, J. L., Jorquera, F., Ruiz‐Andrés, O., González, P., &

González‐Gallego, J. (2008). Melatonin induces cell cycle arrest and apoptosis in hepatocarcinoma HepG2 cell line. Journal of pineal research, 45(4), 532-540. 43. Leja‐Szpak, A., Jaworek, J., Pierzchalski, P., & Reiter, R. J. (2010). Melatonin

induces pro‐apoptotic signaling pathway in human pancreatic carcinoma cells (PANC‐1). Journal of pineal research, 49(3), 248-255. 44. Rodriguez, C., Martín, V., Herrera, F., García-Santos, G., Rodriguez-Blanco, J.,

Casado-Zapico, S., ... & Antolín, I. (2013). Mechanisms involved in the proapoptotic effect of melatonin in cancer cells. International journal of molecular sciences, 14(4), 6597-6613.

42

45. Fang, Z., Jung, K. H., Yan, H. H., Kim, S. J., Rumman, M., Park, J. H., ... & Hong,

S. S. (2018). Melatonin Synergizes with Sorafenib to Suppress Pancreatic Cancer via Melatonin Receptor and PDGFR-β/STAT3 Pathway. Cellular Physiology and Biochemistry, 47(5), 1751-1768. 46. Alonso-González, C., Menéndez-Menéndez, J., González-González, A., González,

A., Cos, S., & Martínez-Campa, C. (2018). Melatonin enhances the apoptotic effects and modulates the changes in gene expression induced by docetaxel in MCF‑7 human breast cancer cells. International journal of oncology, 52(2), 560570. 47. Vivanco, I., & Sawyers, C. L. (2002). The phosphatidylinositol 3-kinase–AKT

pathway in human cancer. Nature Reviews Cancer, 2(7), 489.

48. Sabbah, D. A., Al-Tarawneh, F., Talib, W. H., Sweidan, K., Bardaweel, S. K., Al-

Shalabi, E., ... & Mubarak, M. S. (2018). Benzoin schiff bases: Design, synthesis, and biological evaluation as potential antitumor agents. Medicinal Chemistry, 14(7), 695-708. 49. Liu, P., Cheng, H., Roberts, T. M., & Zhao, J. J. (2009). Targeting the

phosphoinositide 3-kinase pathway in cancer. Nature reviews Drug discovery, 8(8), 627. 50. Roy, A., Murakami, M., Ernsting, M. J., Hoang, B., Undzys, E., & Li, S. D. (2014).

Carboxymethylcellulose-based and docetaxel-loaded nanoparticles circumvent Pglycoprotein-mediated multidrug resistance. Molecular pharmaceutics, 11(8), 25922599.

51. Ramkumar, K., Samanta, S., Kyani, A., Yang, S., Tamura, S., Ziemke, E., ... &

Debnath, B. (2016). Mechanistic evaluation and transcriptional signature of a glutathione S-transferase omega 1 inhibitor. Nature communications, 7, 13084.

52. Westerterp-Plantenga, M. S., Nieuwenhuizen, A., Tome, D., Soenen, S., &

Westerterp, K. R. (2009). Dietary protein, weight loss, and weight maintenance. Annual review of nutrition, 29, 21-41.

43

53. Warburg, O. (1956). On the origin of cancer cells. Science, 123(3191), 309-314. 54. R Buettner, G. (2011). Superoxide dismutase in redox biology: the roles of

superoxide and hydrogen peroxide. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents), 11(4), 341-346. 55. Woolf, E. C., Syed, N., & Scheck, A. C. (2016). Tumor metabolism, the ketogenic

diet and β-hydroxybutyrate: novel approaches to adjuvant brain tumor therapy. Frontiers in molecular neuroscience, 9, 122.

56. Martuscello, R. T., Vedam-Mai, V., McCarthy, D. J., Schmoll, M. E., Jundi, M. A.,

Louviere, C. D., ... & Reynolds, B. A. (2016). A supplemented high-fat lowcarbohydrate diet for the treatment of glioblastoma. Clinical Cancer Research, 22(10), 2482-2495. 57. Otto, C., Kaemmerer, U., Illert, B., Muehling, B., Pfetzer, N., Wittig, R., ... & Coy,

J. F. (2008). Growth of human gastric cancer cells in nude mice is delayed by a ketogenic diet supplemented with omega-3 fatty acids and medium-chain triglycerides. BMC cancer, 8(1), 122. 58. Masko, E. M., Thomas, J. A., Antonelli, J. A., Lloyd, J. C., Phillips, T. E., Poulton,

S. H., ... & Freedland, S. J. (2010). Low-carbohydrate diets and prostate cancer: how low is “low enough”?. Cancer prevention research, 3(9), 1124-1131.

59. Allen, B. G., Bhatia, S. K., Buatti, J. M., Brandt, K. E., Lindholm, K. E., Button, A.

M., ... & Fath, M. A. (2013). Ketogenic diets enhance oxidative stress and radiochemo-therapy responses in lung cancer xenografts. Clinical Cancer Research, 19(14), 3905-3913.