A label-free aptasensor for carcinoembryonic antigen detection using three-way junction structure and ATMND as a fluorescent probe

Accepted Manuscript Title: A label-free aptasensor for carcinoembryonic antigen detection using three-way junction structure and ATMND as a fluorescent probe Authors: Noor Mohammad Danesh, Rezvan Yazdian-Robati, Mohammad Ramezani, Mona Alibolandi, Khalil Abnous, Seyed Mohammad Taghdisi PII: DOI: Reference:

S0925-4005(17)32028-2 https://doi.org/10.1016/j.snb.2017.10.126 SNB 23430

To appear in:

Sensors and Actuators B

Received date: Revised date: Accepted date:

15-6-2017 28-9-2017 21-10-2017

Please cite this article as: Noor Mohammad Danesh, Rezvan Yazdian-Robati, Mohammad Ramezani, Mona Alibolandi, Khalil Abnous, Seyed Mohammad Taghdisi, A label-free aptasensor for carcinoembryonic antigen detection using three-way junction structure and ATMND as a fluorescent probe, Sensors and Actuators B: Chemical https://doi.org/10.1016/j.snb.2017.10.126 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

A label-free aptasensor for carcinoembryonic antigen detection using threeway junction structure and ATMND as a fluorescent probe Noor Mohammad Danesha,b,¥, Rezvan Yazdian-Robatic,¥, Mohammad Ramezania, Mona Alibolandid, Khalil Abnousd,*, Seyed Mohammad Taghdisie,* a

Nanotechnology Research Center, Mashhad University of Medical Sciences, Mashhad, Iran.

b c

Research Institute of Sciences and New Technology, Mashhad, Iran.

Department of Pharmaceutical Biotechnology, School of Pharmacy, Mashhad University of

Medical Sciences, Mashhad, Iran d

Pharmaceutical Research Center, Mashhad University of Medical Sciences, Mashhad, Iran

e

Targeted Drug Delivery Research Center, Mashhad University of Medical Sciences, Mashhad,

Iran ¥

These authors contributed equally to the work.

*Corresponding authors: Dr. Khalil Abnous ([email protected]) and Dr. Seyed Mohammad Taghdisi ([email protected]), Tel.: +98 513 1801535, Fax.: +98 513 882 3251

1

Graphical Abstract (for review)

b (a)

a

(b)

Apt

CS1

CS2

ATMND

CEA

Three-way junction structure

Highlights * Carcinoembryonic antigen (CEA), a type of glycoprotein, is a broad-spectrum tumor marker. * A fluorescent aptasensor was designed for detection of CEA using three-way junction pocket and ATMND as a fluorescent agent. * The presented aptasensor benefits from a simplicity design and a label-free aptamer. * The relative fluorescence intensity indicated a wide linearity range from 4.5 pg/mL to 30 ng/mL of CEA with a detection limit of 1.5 pg/mL. * The aptasensor was also successfully used in human serum for CEA detection.

Abstract Herein, we report a novel approach to design a fluorescent aptasensor for detection of carcinoembryonic antigen (CEA), a tumor marker, using three-way junction pocket and 5,6,7-trimethyl-1,8-naphthyridin-2-amine (ATMND) as a fluorescent agent. The analytical method was based on the entrapment of ATMND in the three-way junction pocket in the absence of CEA, leading to a significant decrease of fluorescence intensity of ATMND. Under, the optimum condition, the relative fluorescence intensity indicated a wide linearity range from 4.5 pg/mL to 30 ng/mL of CEA with a detection limit of 1.5 pg/mL. The aptasensor was also successfully used in human serum for CEA detection, which showed a good recovery (96.12

106.7%). This aptasensor owned several advantages such as simplicity and application of a label-free aptamer. Keywords: Carcinoembryonic antigen; Fluorescent aptasensor; ATMND; Threeway junction structure; Serum sample

1. Introduction Carcinoembryonic antigen (CEA), a type of glycoprotein, is a broad-spectrum tumor marker associated with colon, breast and lung cancers [1, 2]. The concentration of CEA in serum of cancer patients is significantly higher than serum of healthy people [3]. So, the sensitive detection of CEA in serum plays an important role in clinical cancer screening and early diagnostic applications. Over the past few years, different types of protocols have been developed for CEA determination, including chemiluminescent immunoassay, fluoroimmunoassay, mass spectrometry, electrochemical methods and surface-enhanced Raman

3

scattering [4-6]. Nevertheless, most of these methods indicate drawbacks, such as poor stability, time-consuming procedures and sophisticated instrumentation [7-9]. Aptamers are functional single-chain oligonucleotides isolated from nucleic acids libraries via the systematic evolution of ligands by exponential enrichment (SELEX) process [10, 11]. They can bind with high affinity and strong specificity to a vast range of targets, including small dyes, amino acids, proteins and even bacterial cells [12, 13]. Aptamers have been considered as excellent alternatives to replace antibodies because of their various advantages such as simple modification and synthesis, low cost and chemical robustness [14-16]. So, aptamers are promising targeting agents for bioanalytical applications. Aptamer-based fluorescent methods stand out from the rest of other detection strategies for design of sensing platforms, due to their rapid detection speed, high sensitivity and simplicity [13, 17, 18]. In this study, a fluorescent aptasensor was introduced for CEA detection based on the formation of three-way junction pocket in the absence of CEA, CEA aptamer (Apt) as a targeting agent [19] and 5,6,7-trimethyl-1,8-naphthyridin-2-amine (ATMND) as a fluorescent dye. The presented aptasensor benefits from a simplicity design and containing a label-free aptamer.

4

2. Experimental section 2.1.

Materials and reagents

The DNA strands were synthesized by Bioneer (South Korea) (Table 1). Human serum albumin (HSA), human serum, immunoglobulin E (IgE), tyrosinase, dopamine and myoglobin were obtained from Sigma-Aldrich (USA). 5,6,7trimethyl-1,8-naphthyridin-2-amine (ATMND) was purchased from Santa Cruz (USA). Alpha fetoprotein (AFP) was purchased from MyBioSource (USA). 2.2.

Optimization of incubation time of ATMND

48 µL phosphate buffer saline (10 mM PBS, pH 7.4), 40 µL water, 3 µL CS1 (1.5 µM final concentration), 3 µL CS2 (1.5 µM final concentration) and 3 µL Apt (1.5 µM final concentration) were incubated at room temperature for 40 min. Then, 3 µL ATMND (0.3 µM final concentration) was added to the mixtures and incubated for different times (0-30 min). Thereafter, the fluorescence intensities of the mixtures, λEx= 358 nm and λEm= 405 nm, were measured by a Synergy H4 microplate reader (BioTeK, USA). 2.3.

Fluorescence detection of CEA

40 µL different concentrations of CEA (0-50 ng/mL) were added to 48 µL PBS (10 mM, pH 7.4) and 3 µL Apt (1.65 µM final concentration). After incubation for 25 5

min at room temperature, 3 µL CS1 (1.55 µM final concentration) and 3 µL CS2 (1.55 µM final concentration) were added to the mixtures for 40 min at room temperature. Next, the samples were treated with 3 µL ATMND (0.3 µM final concentration) for 20 min at room temperature. Finally, the fluorescence intensities of the samples were recorded. 2.4.

Selectivity test

In order to analyze the specificity of the designed aptasensor, the interfering influences of different materials, such as HSA, AFP, IgE, tyrosinase, dopamine and myoglobin (the concentration of each analyte was 30 ng/mL), on the response of the sensor were investigated. 2.5.

Real sample measurement

To verify the feasibility of the designed sensor for analysis of actual samples, 4 known concentrations of CEA (0.4 ng/mL, 2 ng/mL, 6 ng/mL and 20 ng/mL) were spiked into human serum samples and fluorescence intensity was applied to determine CEA concentrations.

6

3. Results and Discussion 3.1.

Principle of the proposed method

The principle strategy of the designed sensing platform was based on three-way junction pocket and ATMND. In this study, ATMND was used as a fluorescent dye. It has been shown that ATMND can be trapped on the three-way junction structures especially those with GC nucleotides repeats, resulting in the fluorescence quenching of ATMND [20, 21]. The sensing principle is shown in Scheme 1. In the absence of CEA, Apt and its complementary strands (CS1 and CS2) formed a three-way junction structure. So, ATMND was locked in this structure following its addition to the sample, leading to a weak fluorescence intensity. In the presence of CEA, Apt/CEA complex was formed and the Apt involved in the Apt/CEA complex was not hybridized with its CSs. Thus, upon addition of ATMND to the sample, a strong fluorescence intensity was detected, owing to the absence of three-way junction structure. 3.2.

Optimum incubation time of ATMND

The sensitivity of the biosensor could be affected by the ATMND. So, it was necessary to evaluate the effect of incubation time of ATMND. As depicted in Fig. 7

1, with increasing the incubation time of ATMND, the fluorescence intensity showed a significant decrease and approximately reached the minimum within 20 min. Thus, 20 min was selected as the optimum time. 3.3.

Evaluation of the function of the sensor

Formation of three-way junction pocket and the function of the sensor were assessed by gel electrophoresis and fluorescence measurement. In gel electrophoresis, in the absence of CEA, when CS1 and CS2 were incubated with the Apt, the mobilities of the bands of CS1, CS2 and Apt were retarded and only one band appeared (Fig. 2(a), lane 4), showing the formation of three way junction pocket as a big structure. In the presence of CEA, when CS1 and CS2 were incubated with Apt, the band of three-way junction structure disappeared and two bands which belonged to CS1/CS2 complex and Apt/CEA complex appeared (Fig. 2(a), lane 5). These results verified the necessity of the absence of CEA for the formation of three-way junction structure. Moreover, the band of Apt/CEA complex (Fig. 2(a), lane 5) migrated less than the band of free Apt (Fig. 2(a), lane 1), demonstrating the interaction of Apt with CEA and the formation of Apt/CEA complex. Also, the fluorescence measurement was utilized to investigate the feasibility of the presented aptasensor. In the absence of CEA, addition of the ATMND to the

8

mixture of CS1, CS2 and Apt, showed a weak fluorescence intensity (Fig. 2(b), green curve), implying the formation of three-way junction pocket and the entrapment of ATMND in the pocket. While in the presence of CEA, addition of ATMND to the mixture of CS1, CS2 and Apt induced a strong fluorescence intensity (Fig. 2(b), red curve), confirming the absence of three-way junction pocket and presence of free ATMND in the sensing environment. 3.4.

Sensitivity of the aptasensor

In order to assess the sensitivity of the aptasensor, a series of different amounts of CEA were added into the sensing platform to record the change of relative fluorescence intensity. As indicated in Fig. 3(a), the relative fluorescence intensity enhanced with the increase of the CEA concentration and the relative fluorescence intensity was linear with the logarithm of CEA concentrations in the range of 4.5 pg/mL-30 ng/mL (Fig. 3(b)). The detection limit was determined to be 1.5 pg/mL under the signal-to-noise ratio of 3:1. The obtained limit of detection (LOD) was acceptable and lower than some other detection methods for CEA (Table S1) [2, 9, 19, 22-24]. 3.5.

Specificity of the aptasensor

To investigate the selectivity of the sensor, we assessed the response of aptasensor after treatment with different interfering compounds, including HSA, IgE, AFP,

9

tyrosinase, dopamine and myoglobin. As shown in Fig. 3(c), the relative fluorescence intensity enhanced obviously in response to CEA. In contrast, no obvious responses were detected for other interfering compounds at the same amount, showing the fluorescent aptasensor could detect CEA with high selectivity. 3.6.

Real sample analysis

To evaluate the suitability of the reported fluorescent aptasensor for actual applications, CEA was spiked into the human serum samples as a complicated matrix and was quantified by the aptasensor. Recoveries of the known spiked amounts of CEA, determined by the fluorescent aptasensor, ranged from 96.1% to 106.7% with the relative standard deviations (RSDs) in the range of 1.3-6.7% (Table 2). These results verified the applicability and reliability of the presented aptasensor.

10

4. Conclusion In conclusion, a fluorescent aptasensor was constructed for ultrasensitive detection of CEA based on the three-way junction pocket and ATMND as a fluorescent probe. The simplicity and label-free aptamer were some of the unique properties of the developed sensor. The aptasensor showed good performance for the detection of CEA with wide linear range, high specificity and a low LOD (1.5 pg/mL). Moreover, this strategy showed great potential for clinical examinations. We believe this aptasensor can be extended to other types of aptamer for detection of a wide range of targets. Conflict of interest There is no conflict of interest about this article. Acknowledgment Financial support of this study was provided by Mashhad University of Medical Sciences.

11

References [1] Y. Li, Y. Chen, D. Deng, L. Luo, H. He, Z. Wang, Water-dispersible graphene/amphiphilic pyrene derivative nanocomposite: High AuNPs loading capacity for CEA electrochemical immunosensing, Sensors and Actuators B: Chemical. [2] S.X. Lee, H.N. Lim, I. Ibrahim, A. Jamil, A. Pandikumar, N.M. Huang, Horseradish peroxidase-labeled silver/reduced graphene oxide thin film-modified screen-printed electrode for detection of carcinoembryonic antigen, Biosensors and Bioelectronics, 89, Part 1(2017) 673-80. [3] M. Hasanzadeh, N. Shadjou, Advanced nanomaterials for use in electrochemical and optical immunoassays of carcinoembryonic antigen. A review, Microchimica Acta, 184(2017) 389-414. [4] Y. Song, Y. Shen, J. Chen, Y. Song, C. Gong, L. Wang, A pH-Dependent Electrochemical Immunosensor Based on Integrated Macroporous Carbon Electrode for Assay of Carcinoembryonic Antigen, Electrochimica Acta, 211(2016) 297-304. [5] B. He, Differential pulse voltammetric assay for the carcinoembryonic antigen using a glassy carbon electrode modified with layered molybdenum selenide, graphene, and gold nanoparticles, Microchimica Acta, 184(2017) 229-35. [6] W. Wen, J.-Y. Huang, T. Bao, J. Zhou, H.-X. Xia, X.-H. Zhang, et al., Increased electrocatalyzed performance through hairpin oligonucleotide aptamer-functionalized gold nanorods labels and graphene-streptavidin nanomatrix: Highly selective and sensitive electrochemical biosensor of carcinoembryonic antigen, Biosensors and Bioelectronics, 83(2016) 142-8. [7] H. Miao, L. Wang, Y. Zhuo, Z. Zhou, X. Yang, Label-free fluorimetric detection of CEA using carbon dots derived from tomato juice, Biosensors and Bioelectronics, 86(2016) 83-9. [8] Z. Wu, H. Li, Z. Liu, An aptasensor for carcinoembryonic antigen based on upconversion fluorescence resonance energy transfer, Sensors and Actuators B: Chemical, 206(2015) 531-7. [9] X.-c. Sun, C. Lei, L. Guo, Y. Zhou, Giant magneto-resistance based immunoassay for the tumor marker carcinoembryonic antigen, Microchimica Acta, 183(2016) 1107-14. [10] K. Abnous, N.M. Danesh, M. Alibolandi, M. Ramezani, S.M. Taghdisi, Amperometric aptasensor for ochratoxin A based on the use of a gold electrode modified with aptamer, complementary DNA, SWCNTs and the redox marker Methylene Blue, Microchimica Acta, 184(2017) 1151-9. [11] B. Rezaei, M. Shahshahanipour, A.A. Ensafi, H. Farrokhpour, Development of highly selective and sensitive fluorimetric label-free mercury aptasensor based on cysteamine@CdTe/ZnS quantum dots, experimental and theoretical investigation, Sensors and Actuators B: Chemical, 247(2017) 400-7. [12] L. Wang, R. Ma, L. Jiang, L. Jia, W. Jia, H. Wang, A novel “signal-on/off” sensing platform for selective detection of thrombin based on target-induced ratiometric electrochemical biosensing and bio-bar-coded nanoprobe amplification strategy, Biosensors and Bioelectronics, 92(2017) 390-5. [13] Y. Song, T. Tang, X. Wang, G. Xu, F. Wei, Y. Wu, et al., Highly selective and sensitive detection of adenosine utilizing signal amplification based on silver ions-assisted cation exchange reaction with CdTe quantum dots, Sensors and Actuators B: Chemical, 247(2017) 30511. [14] K. Abnous, N.M. Danesh, M. Alibolandi, M. Ramezani, S.M. Taghdisi, A.S. Emrani, A novel electrochemical aptasensor for ultrasensitive detection of fluoroquinolones based on single-stranded DNA-binding protein, Sensors and Actuators, B: Chemical, 240(2017) 100-6. 12

[15] L. Lv, D. Li, R. Liu, C. Cui, Z. Guo, Label-free aptasensor for ochratoxin A detection using SYBR Gold as a probe, Sensors and Actuators B: Chemical, 246(2017) 647-52. [16] T. Shiravand, A. Azadbakht, Impedimetric biosensor based on bimetallic AgPt nanoparticledecorated carbon nanotubes as highly conductive film surface, Journal of Solid State Electrochemistry, (2017) 1-13. [17] M. Joo, S.H. Baek, S.A. Cheon, H.S. Chun, S.-W. Choi, T.J. Park, Development of aflatoxin B1 aptasensor based on wide-range fluorescence detection using graphene oxide quencher, Colloids and Surfaces B: Biointerfaces, 154(2017) 27-32. [18] S.M. Taghdisi, N.M. Danesh, M. Ramezani, N. Ghows, S.A. Mousavi Shaegh, K. Abnous, A novel fluorescent aptasensor for ultrasensitive detection of microcystin-LR based on singlewalled carbon nanotubes and dapoxyl, Talanta, 166(2017) 187-92. [19] H. Khang, K. Cho, S. Chong, J.H. Lee, All-in-one dual-aptasensor capable of rapidly quantifying carcinoembryonic antigen, Biosensors and Bioelectronics, 90(2017) 46-52. [20] D. Roncancio, H. Yu, X. Xu, S. Wu, R. Liu, J. Debord, et al., A label-free aptamerfluorophore assembly for rapid and specific detection of cocaine in biofluids, Analytical Chemistry, 86(2014) 11100-6. [21] Y. Sato, A. Honjo, D. Ishikawa, S. Nishizawa, N. Teramae, Fluorescent trimethylsubstituted naphthyridine as a ligand for C-C mismatch detection in CCG trinucleotide repeats, Chemical Communications, 47(2011) 5885-7. [22] Y.L. Wang, J.T. Cao, Y.H. Chen, Y.M. Liu, A label-free electrochemiluminescence aptasensor for carcinoembryonic antigen detection based on electrodeposited ZnS-CdS on MoS2 decorated electrode, Analytical Methods, 8(2016) 5242-7. [23] J. Wang, J. Long, Z. Liu, W. Wu, C. Hu, Label-free and high-throughput biosensing of multiple tumor markers on a single light-addressable photoelectrochemical sensor, Biosensors and Bioelectronics, 91(2017) 53-9. [24] T. Yang, Y. Gao, Z. Liu, J. Xu, L. Lu, Y. Yu, Three-dimensional gold nanoparticles/prussian blue-poly(3,4-ethylenedioxythiophene) nanocomposite as novel redox matrix for label-free electrochemical immunoassay of carcinoembryonic antigen, Sensors and Actuators B: Chemical, 239(2017) 76-84.

13

Seyed Mohammad Taghdisi SMT received his Pharm.D. degree in 2006 from School of Pharmacy, Mazandran University of Medical Sciences and his Ph.D in 2011 form Department of Pharmaceutical Biotechnology, Mashhad University of Medical Sciences, Iran. He is currently assistant Professor in Mashhad University of Medical Sciences. He is interested in aptamer design and its application in targeted drug delivery and aptasensors. Mohammad Ramezani MR received his Pharm.D. degree in 1988 from School of Pharmacy, Mashhad, University of Medical Sciences, and his Ph.D in 1996 form Department of Chemistry, Dalhousie University, Canada. He is currently Professor in Mashhad University of Medical Sciences. He is interested in gene therapy using non-viral vectors like PEI and also aptamer design and its application in targeted drug delivery and aptasensors. Khalil Abnous KA received his Pharm.D. degree in 1998 from School of Pharmacy, Mashhad University of Medical Sciences, and his Ph.D in 2007 form Department of Chemistry, Carleton University, Canada. He is currently Professor in Mashhad University of Medical Sciences. He is interested in aptamer design and its application in targeted drug delivery and aptasensors. Noor Mohammad Danesh NMD received his M.Sc. degree in chemistry in 2005 from School of Science, Ferdowsi University and his Ph.D in 2017 form Nanotechnology Research Center, Mashhad University of Medical Sciences, Iran. He is interested in aptamer design and its application in targeted drug delivery and aptasensors. Mona Alibolandi MA received her Ph.D in 2015 form Department of Biotechnology, Mashhad University of Medical Sciences, Iran. She is currently assistant Professor in Mashhad University of Medical Sciences. She is interested in aptamer design and its application in targeted drug delivery and aptasensors. Rezvan Yazdian-Robati RYR is a Ph.D student of Pharmaceutical Biotechnology at Mashhad University of Medical Sciences, Mashhad, Iran. She is interested in aptamer design and its application in targeted drug delivery and aptasensors. 14

b (a)

a

(b)

Apt

CS1

CS2

ATMND

CEA

Three-way junction structure

Scheme 1. Schematic illustration of CEA detection by the three–way junction structure-based fluorescent aptasensor. In the absence of CEA, Apt, CS1 and CS1 form three-way junction structure in the sensing environment and ATMND is locked in this structure. Thus, a weak fluorescence signal is observed (a). In the presence of CEA, Apt binds to its target, leading to no formation of three-way junction structure. Thus, a strong fluorescence signal can be detected following the addition of ATMND (b).

15

Fig. 1. Fluorescence intensity of ATMND, as a function of its incubation time.

16

1 2 3 4 5 a) CS1/CS2 Apt/CEA

b)

Fig. 2. Investigation of the formation and the function of the proposed sensing platform. (a) Analysis of three-way junction structure formation using agarose gel electrophoresis. Lane 1: Apt, Lane 2: CS1, Lane 3: CS2, Lane 4: Apt + CS1 + CS2 (Three-way junction pocket), Lane 5: Apt + CS1 + CS2 + CEA. (b) Fluorescence spectra of the designed aptasensor in the absence (green curve) and presence of CEA (red curve). 17

a)

b)

18

c)

Fig. 3. (a) Relative fluorescence signals of the developed analytical technique after interaction with various concentrations of CEA. (b) The calibration plot in the presence of various concentrations of CEA. F0 and F are the fluorescence intensities (Em= 405 nm) before and after addition of CEA, respectively. (c) Relative fluorescence signals of the presented sensing method in the presence of different interfering materials (the concentration of each substance was 30 ng/mL). F0 and F are the fluorescence intensities (Em= 405 nm) before and after addition of each substance, respectively.

19

Table 1. Oligonucleotide sequences used in this study. Complementary strands have been shown with the same color. The underlined sequence is aptamer.

Oligonucleotide CEA aptamer (Apt)

Sequence (from 5' to 3') AAGTTTATACCAGCTTATTCAATTTTTGATTA

Complementary strand 1 (CS1) Complementary strand 2 (CS2)

TAATCAAAAATTAAACCGCCGAATTTACTTT AAAGTAAATAGCCGCCGCCTTGTATAAACTT

Table 2. Recovery of CEA from serum samples (n=4). Data are mean ± RSD.

Serum

Found

Added

Total Found

samples

(ng/mL)

CEA (ng/mL)

(ng/mL)

1

2.6

0.4

3.2

106.7

4.9

2

2.6

2

4.45

96.7

6.7

3

2.6

6

8.91

103.6

3.8

4

2.6

20

21.72

96.1

1.3

20

Recovery (%)

RSD (%, n=4)

Scheme 1. Schematic illustration of CEA detection by the three–way junction structure-based fluorescent aptasensor. In the absence of CEA, Apt, CS1 and CS1 form three-way junction structure in the sensing environment and ATMND is locked in this structure. Thus, a weak fluorescence signal is observed (a). In the presence of CEA, Apt binds to its target, leading to no formation of three-way junction structure. Thus, a strong fluorescence signal can be detected following the addition of ATMND (b). Fig. 1. Fluorescence intensity of ATMND, as a function of its incubation time. Fig. 2. Investigation of the formation and the function of the proposed sensing platform. (a) Analysis of three-way junction structure formation using agarose gel electrophoresis. Lane 1: Apt, Lane 2: CS1, Lane 3: CS2, Lane 4: Apt + CS1 + CS2 (Three-way junction pocket), Lane 5: Apt + CS1 + CS2 + CEA. (b) Fluorescence spectra of the designed aptasensor in the absence (green curve) and presence of CEA (red curve). Fig. 3. (a) Relative fluorescence signals of the developed analytical technique after interaction with various concentrations of CEA. (b) The calibration plot in the presence of various concentrations of CEA. F0 and F are the fluorescence intensities (Em= 405 nm) before and after addition of CEA, respectively. (c) Relative fluorescence signals of the presented sensing method in the presence of different interfering materials (the concentration of each substance was 30 ng/mL). F0 and F are the fluorescence intensities (Em= 405 nm) before and after addition of each substance, respectively. Table 1. Oligonucleotide sequences used in this study. Complementary strands have been shown with the same color. The underlined sequence is aptamer. Table 2. Recovery of CEA from serum samples (n=4). Data are mean ± RSD.

21