A live attenuated strain of Yersinia pestis ΔyscB provides protection against bubonic and pneumonic plagues in mouse model

Vaccine 31 (2013) 2539–2542

Contents lists available at SciVerse ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Short communication

A live attenuated strain of Yersinia pestis yscB provides protection against bubonic and pneumonic plagues in mouse model Xuecan Zhang a,1 , Zhizhen Qi b,1 , Zongmin Du a,1 , Yujing Bi a , Qingwen Zhang b , Yafang Tan a , Huiying Yang a , Youquan Xin b , Ruifu Yang a,∗ , Xiaoyi Wang a,∗ a b

Laboratory of Analytical Microbiology, State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China Qinghai Institute for Endemic Disease Prevention and Control of Qinghai Province, Xining 811602, China

a r t i c l e

i n f o

Article history: Received 12 November 2012 Received in revised form 26 February 2013 Accepted 28 March 2013 Available online 12 April 2013 Keywords: Yersinia pestis Plague Live attenuated vaccine

a b s t r a c t To develop a safe and effective live plague vaccine, the yscB mutant was constructed based on Yersinia pestis biovar Microtus strain 201 that is avirulent to humans, but virulent to mice. The virulence, immunogenicity and protective efficacy of the yscB mutant were evaluated in this study. The results showed that the yscB mutant was severely attenuated, elicited a higher F1-specific antibody titer and provided protective efficacy against bubonic and pneumonic plague in mouse model. The yscB mutant could induce the secretion of both Th1-associated cytokines (IFN-␥, IL-2 and TNF-␣) and Th2-associated cytokines (IL4 and IL-10). Taken together, the yscB mutant represented a potential vaccine candidate based on its ability to generate strong humoral and cell-mediated immune responses and to provide good protection against both subcutaneous and intranasal Y. pestis challenge. © 2013 Elsevier Ltd. All rights reserved.

1. Introduction Plague is a zoonotic disease caused by Gram-negative bacterium Yersinia pestis, which is usually transmitted to humans from infected rodents via the bite of an infected flea [1]. Historically, plague was a fatal infectious disease afflicting human populations, leading to millions of deaths. Recently, plague has been classified as a re-emerging infectious disease by the World Health Organization [2] and has attracted a considerable attention because of its potential misuse as an agent of biological warfare or bioterrorism [3]. Thus, it is imperative to develop an ideal plague vaccine for human use. Construction of live attenuated vaccines is considered as one of the most effective strategies to develop plague vaccines. Effector proteins (Yops) of the type III secretion system (T3SS) play an essential role in the pathogenesis of Y. pestis [4]. Regulation of Yop secretion is dependent on the expression of at least five proteins YopN and its chaperones SycN and YscB, TyeA and LcrG [5]. Mutational inactivation of yscB induces secretion of Yops in the presence or absence of calcium and before host cell contact, and secretes reduced level of YopN in comparison to the parent strain [6]. These results signify that the yscB mutant might result in an avirulent

∗ Corresponding authors. Tel.: +86 10 66948562; fax: +86 10 63815689. E-mail addresses: [email protected] (R. Yang), [email protected] (X. Wang). 1 These authors contributed equally to this work. 0264-410X/$ – see front matter © 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.vaccine.2013.03.054

or highly attenuated phenotype. In this study, we constructed the yscB mutant based on a strain of Y. pestis biovar Microtus strain 201 which is avirulent in larger mammals and humans, and investigated the possibility of using the mutant as a live attenuated plague vaccine. 2. Methods 2.1. Construction of the yscB mutant The Y. pestis yscB mutant (yscB) was constructed by using one-step inactivation method based on the ␭-Red-mediated recombinant system [7]. Briefly, the yscB::kana mutagenic cassette was amplified from pRS551 using the primer pairs yscB-kana-F (5 CTAAAAAACTTGGCAGCCAGTTTAGGAAGAAAACCGTTTGAGATTGCAGCATTACACG-3 ) and yscB-kana-R (5 -TTAATTCCACCCCACGCGAGACGCTACAGAAAATGGTGTTTGTAACGCACTGAGAAGC-3 ). The underlined sequences are homologous to the 13–52 and 375–414 nucleotides of the yscB sequence and the italic sequence is used as primers to amplify Km-resistance cassette. 2.2. Determination of virulence for the yscB mutant Groups of 6-week-old female BALB/c mice (6 mice per group) were challenged with the yscB mutant by subcutaneous or intranasal route. The actual challenge doses were calculated by counting CFUs on agar plates. The challenged animals were observed for 14 days after injections, and the dose that killed 50%

2540

X. Zhang et al. / Vaccine 31 (2013) 2539–2542

of the mice (LD50 ) was calculated using the Reed–Muench method [8]. 2.3. Animal immunizations The yscB mutant was cultivated at 26 ◦ C to mid-log phase, and then the bacterial cultures were shifted to 37 ◦ C for another 3 h. Groups of ten female BALB/c mice were injected s.c. in the groin with one dose of the yscB mutant (1.63 × 104 CFU), the vaccine EV76 (1.6 × 104 CFU) or the same volume of PBS (0.1 ml). 2.4. F1-specific antibody assays Sera collected from the immunized and control mice were assayed for the presence of F1-specific IgG by a modified ELISA. The titer of specific antibody was estimated as the maximum dilution of the serum with an OD value of 0.2 units over background. Background values were obtained from serum samples collected from the animals only receiving PBS. Antibody endpoint titer per immunization group is presented as the GMT to F1 antigen. 2.5. Elispot assay of cytokines Enzyme-linked immunospot (ELISPOT) assays were performed for INF-␥, IL-2, TNF-␣, IL-4 and IL-10 cytokines using commercially available murine Elispot kits (R&D Systems) according to the manufacturer’s instructions. The stimulants include F1 peptide pool (10 ␮g/ml), LcrV peptide pool (10 ␮g/ml), Concanavalin A (5 ␮g/ml, positive control), the YscB mutant of Y. pestis strain 201 (105 CFU) or medium RPMI 1640 (negative control). Results are expressed as number of spot-forming cells (SFC)/106 cells.

Fig. 1. Development of IgG titers to F1 in BALB/c mice immunized with the yscB mutant and wild-type Y. pestis strain 201 six weeks post immunization.

which is more than 400,000-fold higher than 3 CFU of the wild-type strain. It is clearly demonstrated that the Microtus strain of Y. pestis 201 can be highly attenuated by deletion of yscB gene in mouse infection model. Although antibody level does not correlate with protective efficacy, humoral immunity plays an important role in protection against plague [11]. The antibody response to F1 antigen from each group of 10 animals on week 6 after primary immunization was determined and shown in Fig. 1. There was no significant anti-F1 IgG titer difference between the immunized animals with the yscB mutant and those with EV76 (p > 0.05), whereas no anti-F1 IgG was detected in the control animals that only received PBS buffer. When groups of 10 immunized mice were challenged with 1.24 × 106 CFU of virulent Y. pestis strain 141, the yscB mutant provided 87.5% or complete protection by the subcutaneous or intranasal route,

2.6. Challenge with Y. pestis Challenge experiments were carried out with the Y. pestis 141 strain (Antigua biovar) that was isolated from Marmota himalayana in Qinghai-Tibet plateau and has a median lethal dose (MLD) of 5.6 or 4375 colony-forming unit (CFU) for BALB/c mice by the subcutaneous or intranasal route. The immunized mice were challenged on week 6 after the primary immunization with 1.24 × 106 CFU by the subcutaneous or intranasal route, and then closely observed for 14 days. 2.7. Statistical analysis Differences in immune responses between the treatment group and control group were analyzed with the Student’s t-test. A probability value of <0.05 was considered statistically significant. 3. Results and discussion 3.1. The yscB mutant highly attenuated and effective against plagues Y. pestis biovar Microtus strains are virulent to Microtus and mice, but they seem to be avirulent to larger mammals, such as guinea pigs, rabbits and humans. The Microtus strains might have a good potential to develop an attenuated vaccine for humans, because these strains have all known protective antigens and are avirulent for humans [9,10]. To avoid eliciting ecological disaster, an ideal vaccine must be avirulent in both animals and humans. Therefore, we constructed the yscB mutant from a Microtus strain 201 and investigated the possibility of using the mutant as a live attenuated plague vaccine candidate. Our results show that the LD50 of the yscB mutant in BALB/c mice is estimated to be more than 106 CFU,

Fig. 2. Survival of the mice immunized with the yscB mutant after infection subcutaneously (A) or intranasally (B) with virulent Y. pestis strain 141.

X. Zhang et al. / Vaccine 31 (2013) 2539–2542

whereas the vaccine EV76 offered 90% or complete protection by the subcutaneous or intranasal route. In contrast, the control animals all succumbed to a same dose of Y. pestis 141 challenge by both routes within 4 days (Fig. 2A and B). These results indicate that the yscB mutant has a similar protective efficacy as EV76 vaccine against bubonic or pneumonic plague in mouse model. To our knowledge, this is the first report to demonstrate that the highly attenuated yscB mutant of Y. pestis biovar Microtus provides good protection against bubonic and pneumonic plagues in mouse model. 3.2. yscB mutants induces Th1 and Th2 cell responses The release of IFN-␥, IL-2, IL-10, TNF-␣ or IL-4 was determined by cytokine ELISPOT. An elevated number of IFN-␥ (Fig. 3A), IL-2 (Fig. 3B), IL-4 (Fig. 3C), IL-10 (Fig. 3D) or TNF-␣ (Fig. 3E) producing cells was particularly observed in response to both live attenuated yscB mutant and concanavalin A. In addition, a significant increase of TNF-␣-producing cells was also noted in response to F1 or LcrV peptide pool, but lower than that elicited by attenuated yscB mutant or concanavalin A. These results indicate that a mixture of Th1 and Th2 response was

2541

induced by the yscB mutant. Th1 cells secrete IL-2, IFN-␥ and TNF-␣, whereas Th2 cells secrete IL-4 and IL-10. Th1 cells are mainly implicated in cell-mediated immune reactions and macrophage activation, which are important for the clearance of intracellular pathogens. Th2 cells are key players in humoral immunity, which plays a role in the clearance of extracellular pathogens [12]. It is suggested that vaccines effectively priming both humoral and cellular immunity could provide superior defense against pneumonic plague [13–16]. A number of studies have demonstrated that IFN-␥ and TNF-␣ contribute to protection against a lethal systemic Y. pestis challenge, and that cytokine-mediated Th1-type cellular immunity is very important to overcome the immunosuppression induced by Y. pestis infection [17]. We found that immunization with the yscB mutant could cause the increase of IFN-␥, TNF-␣ and IL-2 secreting cells, indicating that the yscB mutant could induce cytokine-mediated Th1-type cellular immune response. Meanwhile, the numbers of IL-4 and IL-10 secreting cells were significantly higher in the immunized group than the control group after stimulating with the yscB mutant, indicating that the yscB mutant could also induce Th2-type humoral response by secreting IL-4 and IL-10, because these two cytokines are important activators of humoral immunity [18,19]. Taken together, the yscB

Fig. 3. Six weeks after primary immunization, the immunized mice were evaluated for splenic IFN-␥ (A), IL-2 (B), IL-4 (C), IL-10 (D) or TNF-␣ (E) spot-forming cells (SFC) responses by the cytokine ELISPOT method. Immune lymphocytes were isolated and cultured with F1 peptide pool, V peptide pool, the YscB mutant, ConA or medium for 16 h, and then evaluated for cytokine responses. Depicted are the means ± SD CFC/1 × 106 lymphocytes from a total of two experiments. *p < 0.05.

2542

X. Zhang et al. / Vaccine 31 (2013) 2539–2542

mutant could elicit both cell-mediated immunity and humoral immunity in mouse model. Currently, construction of double mutants based on a pgm mutant, an attenuated strain, is a new strategy to create a live attenuated plague vaccine [17]. The results in this study signify that constructing the mutants based on Y. pestis biovar Microtus strains, avirulent strains to humans, is also a promising strategy to develop live attenuated plague vaccine candidates. Acknowledgments Financial support for this study came from the National Natural Science Foundation of China (contract no. 81171529) and the National High Technology Research and Development Program of China (863 program) (contract no. 2012AA02A403). References [1] Perry RD, Fetherston JD. Yersinia pestis-etiologic agent of plague. Clin Microbiol Rev 1997 Jan;10(1):35–66. [2] Williamson ED. Plague vaccine research and development. J Appl Microbiol 2001 Oct;91(4):606–8. [3] Riedel S. Plague: from natural disease to bioterrorism. Proc (Bayl Univ Med Cent) 2005;18(2):116–24. [4] Cornelis GR. Yersinia type III secretion: send in the effectors. J Cell Biol 2002 Aug 5;158(3):401–8. [5] Day JB, Plano GV. A complex composed of SycN and YscB functions as a specific chaperone for YopN in Yersinia pestis. Mol Microbiol 1998;30(4):777–88. [6] Day JB, Ferracci F, Plano GV. Translocation of YopE and YopN into eukaryotic cells by Yersinia pestis yopN, tyeA, sycN, yscB and lcrG deletion mutants measured using a phosphorylatable peptide tag and phosphospecific antibodies. Mol Microbiol 2003 Feb;47(3):807–23.

[7] Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 2000;97:6640–5. [8] Reed LJ, Muench H. A simple method of estimating fifty percent endpoints. Am J Hyg 1938;27:493–7. [9] Fan Z, Ruo Y, Wang S, Jin L, Zhou X, Liu J, et al. Microtus brandti plague in the Xilin Gol Grassland was inoffensive to humans. Chin J Control Endem Dis 1995;10:56–7. [10] Song Y, Tong Z, Wang J, Wang L, Guo Z, Han Y, et al. Complete genome sequence of Yersinia pestis strain 91001, an isolate avirulent to humans. DNA Res 2004;11(3):179–97. [11] Bashaw J, Norris S, Weeks S, Trevino S, Adamovicz JJ, Welkos S. Development of in vitro correlate assays of immunity to infection with Yersinia pestis. Clin Vaccine Immunol 2007;14(5):605–16. [12] Abbas AK, Murphy KM, Sher A. Functional diversity of helper T lymphocytes. Nature 1996;383(6603):787–93. [13] Parent MA, Berggren KN, Kummer LW, Wilhelm LB, Szaba FM, Mullarky IK, et al. Cell-mediated protection against pulmonary Yersinia pestis infection. Infect Immun 2005;73(11):7304–10. [14] Philipovskiy AV, Smiley ST. Vaccination with live Yersinia pestis primes CD4 and CD8T cells that synergistically protect against lethal pulmonary Y. pestis infection. Infect Immun 2007 Feb;75(2):878–85. [15] Lee-Lewis H, Anderson DM. Absence of inflammation and pneumonia during infection with nonpigmented Yersinia pestis reveals a new role for the pgm locus in pathogenesis. Infect Immun 2010 Jan;78(1):220–30. [16] Fetherston JD, Kirillina O, Bobrov AG, Paulley JT, Perry RD. The yersiniabactin transport system is critical for the pathogenesis of bubonic and pneumonic plague. Infect Immun 2010;78(5):2045–52. [17] Szaba FM, Kummer LW, Wilhelm LB, Lin JS, Parent MA, Montminy-Paquette SW, et al. D27-pLpxL, an avirulent strain of Yersinia pestis, primes T cells that protect against pneumonic plague. Infect Immun 2009;77(10):4295–304. [18] Papadogiannakis EI, Kontos VI, Tamamidou M, Roumeliotou A. Determination of intracellular cytokines IFN-gamma and IL-4 in canine T lymphocytes by flow cytometry following whole-blood culture. Can J Vet Res 2009;73(2):137–43. [19] Atreya R, Mudter J, Finotto S, Müllberg J, Jostock T, Wirtz S, et al. Blockade of interleukin 6 trans signaling suppresses T-cell resistance against apoptosis in chronic intestinal inflammation: evidence in Crohn disease and experimental colitis in vivo. Nat Med 2010;6:583–8.