- Email: [email protected]
A long downstream probe-based platform for multiplex target capture
Analytical Biochemistry 491 (2015) 4e9
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
A long downstream probe-based platform for multiplex target capture Ping Wang a, b, Jianqin Huang a, Yingwu Xu a, * a b
Nurturing Station for the State Key Laboratory of Subtropical Silviculture, Zhejiang Agriculture and Forestry University, Lin'an 311300, China National Center for Protein Science Shanghai, Shanghai 201210, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 June 2015 Received in revised form 25 August 2015 Accepted 27 August 2015 Available online 5 September 2015
A simple and rapid detection platform was established for multiplex target capture through generating single-strand long downstream probe (ssLDP), which was integrated with the ligase detection reaction (LDR) method for the purpose of multiplicity and high specificity. To increase sensitivity, the ladder-like polymerase chain reaction (PCR) amplicons were generated by using universal primers that complement ligated products. Each of the amplicons contained a stuffer sequence with a defined yet variable length. Thus, the length of the amplicon is an index of the specific suppressor, allowing its identification via electrophoresis. The multiplexed diagnostic platform was optimized using standard plasmids and validated by using potato virus suppressors as a detection model. This technique can detect down to 1.2 103 copies for single or two mixed target plasmids. When compared with microarray results, the electrophoresis showed 98.73e100% concordance rates for the seven suppressors in the 79 field samples. This strategy could be applied to detect a large number of targets in field and clinical surveillance. © 2015 Elsevier Inc. All rights reserved.
Keywords: Suppressor Single-strand long downstream probe Ligase detection reaction Stuffer sequence Concordance rates
The circulation of the novel H7N9 avian influenza A virus spreading from one country to another within a short span in 2013 [1] and the outbreak of plant viruses [2] are a serious threat to human health and plant production. To take measures promptly, a rapid yet efficient method to detect the pathogen types at the very early stage of the virus outbreak is in great demand [3]. Multiplex target capture technology can meet this type of diagnostic requirement. It can enrich the low level of the target pathogens in a multiplex fashion, followed by a detection strategy. Considerable effort has been devoted to augment the targets for multiplexing [4]. Nonetheless, it is still a great challenge to achieve a streamlined approach while bearing the advantages of specificity, sensitivity, and cost efficiency at the same time. Within the multiplex capturing strategy, DNA microarray technology can detect thousands of templates in a single assay. However, it has limited specificity and sensitivity during hybridizations of DNA samples to the respective capture probes [5e7]. Multiplex
Abbreviations: PCR, polymerase chain reaction; LDR, ligase detection reaction; MLP, multiplex LDRePCR; ssLDP, single-strand long downstream probe; P0BWYV, beet western yellow virus P0; 2bCMV, cucumber mosaic virus 2b; P0PLRV, potato leafroll virus P0; P25PVX, potato virus X P25; HcProPVY, potato virus Y help component proteinase; 16kDaTRV, tobacco rattle virus 16-kDa protein; 19kDaTRSV, tobacco ringspot virus 19-kDa protein. * Corresponding author. E-mail address: [email protected] (Y. Xu). http://dx.doi.org/10.1016/j.ab.2015.08.029 0003-2697/© 2015 Elsevier Inc. All rights reserved.
polymerase chain reaction (PCR) has greatly improved this situation, but it could create spurious amplicons, uneven or nonexistent amplification, despite decades of effort [8e10]. To improve the specificity, Schouten and coworkers [11] developed a method by hybridizing the probes adjacent to the target DNA for ligation and only the ligated probes, not the original target DNAs, are amplified by PCR. However, this method requires producing long downstream ligase detection reaction (LDR) probes. The procedure is laborious. It includes the initial multistep conventional cloning, cell amplification, DNA extraction, double-stranded DNA modification, and so on [12,13]. To overcome these issues, we developed a novel yet low-cost approach that is called multiplex LDRePCR (MLP) (Fig. 1). This method generates ladder-like single-strand long downstream probes (ssLDPs) with lengths between 163 and 754 bases. The conventional asymmetric PCR produces a sufficient amount of ssLDPs that are used as the downstream LDR probes. Each pair of ssLDP and the upstream LDR probes are pathogen specific, containing two universal tags and one variable long stuffer spacer. The platform combines the specificity of the probe-mediated ligation and the advantage of homogeneous amplification for multiplex targets. A test set of seven suppressors was selected as a model assay [14e18]. The assay platform was also tested on a set of 79 field samples, and the results were compared with those of the microarray method, demonstrating a great potential for this assay platform as a tool in surveillance and diagnostics.
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
5
Fig.1. Schematic representation of MLP assay. (A) Preparation of the asymmetric PCR-derived ssLDP oligonucleotides. Each ssLDP has a defined stuffer length (163e754 nt). The subjective template (Hickory Apetala 1 gene) and two primers are used to generate the stuffer sequence with different lengths via asymmetric PCR. The forward primer (left) has a downstream probe adaptor (red) with the 50 end phosphorylated. The reverse primer (right) has a universal tag 1. The AP1 template has no sequence homology with the detected targets. (B) Depiction of the essential components of an MLP assay. Ligation is achieved by using one synthesized upstream LDR probe and one asymmetric PCR-derived ssLDP. The upstream LDR probe (left) is composed of target-specific sequence complementary to the detected region (red) with the 50 universal tag 2 (blue), which is hydroxylated on its 30 end. The ssLDP (right) includes a target-specific sequence complementary to the detected region (red), a stuffer (black), and a universal 30 tag 1 tail sequence, which is phosphorylated on its 50 end. In the case of a perfect match, the set of upstream LDR probe and ssLDP will be hybridized adjacently to each other by DNA ligase (left). In the case of a mismatch, no ligation will occur (right). The ligation products are further amplified in a PCR by the universal primers. The amplicons are loaded onto gel electrophoresis for separation and identification. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.).
Materials and methods Materials Seven suppressor genes used in this study were beet western yellows virus P0 (P0BWYV), cucumber mosaic virus 2b (2bCMV), potato leafroll virus P0 (P0PLRV), potato virus X P25 (P25PVX), potato virus Y help component proteinase (HcProPVY), tobacco rattle virus 16-kDa
protein (16 kDaTRV), and tobacco ringspot virus 19-kDa protein (19 kDaTRSV). The viruses (infected potato leaves) were purchased from Bioreba (Switzerland) and stored at 80 C. Two nontarget viruses, wheat yellow mosaic virus VPg protein region and Chinese wheat mosaic virus W19K protein region, were used to determine the specificity of the assay. Hickory Apetala 1 gene (GenBank: KF918309, AP1), which shares no homology with any of the targets, was used as an initial subjective template to generate different sizes of ssLDPs.
6
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
A total of 79 symptomatic field potato samples that were used previously in microarray [19] were tested in this study.
All primers, universal tags, stuffer spacers, and LDR probes were blasted against the complete GenBank database to ensure that they represent unique sequences to avoid nonspecific PCR products. Primers and probes were synthesized by Sangon.
Oligonucleotide preparation The sequences of the seven suppressors were obtained from GenBank. They were blasted against NCBI to search for the most conserved region, which was selected as the binding region for the probes. To get an optimal set of LDR probe, some factors are taken into consideration during the process of probe design, including the high melting temperature (65 C) and the stuffer length (Table 1; see also Table 1S in online supplementary material). The primers (Table 2S) and probes were designed and optimized by using Primer 5.0 (Premier Biosoft International, Palo Alto, CA, USA) and DNASTAR software. Each MLP probe consists of one short synthetic upstream LDR probe and one asymmetric PCR-derived ladder-like ssLDP sequence (163e754 nt). The short synthesized oligonucleotide of upstream LDR probe contains a target-specific sequence at the 30 end and a universal tag 2 sequence at the 50 end. Preparation of ssLDP is outlined in Fig. 1. To generate the ssLDP from the template AP1, an asymmetric PCR was performed using two primers with unequal amounts. The forward primer contained the target-specific sequence (the downstream probe) from the suppressors. The reverse primer had a universal tag 1. The ratio of the forward primer over reverse was optimized to 10:1 to give the most abundant ssLDP. The purified ssLDP fragments were confirmed via gel electrophoresis and DNA sequencing (Sangon, Shanghai, China). Thus, each ssLDP contains a target-specific sequence at the 50 phosphorylated end, a universal tag 1 sequence at the 30 end, and a stuffer sequence with variable length in between. The stuffer sequence obtained from the template AP1 has no homology with the targets.
RNA extraction and quantification Total RNAs of the positive tissue samples and 79 field samples (~100 mg) were extracted using a Trizol Reagent Kit (Takara, China) following the manufacturer's instructions. The quantities of the purified RNAs and the purified PCR fragments of ssLDPs were determined using a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) by measuring A260, and the quality was evaluated based on the ratio of A260/A280. Suppressor cDNA synthesis and template construction The seven extracted RNAs were reverse transcribed following the procedure recommended by the manufacturer (Takara). 18S rRNA negative controls were included in all runs. Plasmids containing the seven target genes were amplified by the primer set shown in Table 1S and cloned into the pMD-19T simple vector according to the procedures recommended by the manufacturer (Takara). Clones were confirmed by electrophoresis and sequencing. Plasmids were quantitated by using the NanoDrop ND100 spectrophotometer. Setup of simplex LDRePCR and multiplex LDRePCR Simplex LDRePCR was carried out as described in our previous study [20]. Briefly, a set of two probes are ligated and PCR is performed with universal primers. The ladder-like amplicon products are separated on a 3% gel electrophoresis. The MLP was performed
Table 1 Upstream and downstream probes used for LDR. Suppressor TRV
16 kDa
2bCMV
P0BWYV
19kDaTRSV
HcProPVY
P25PVX
P0PLRV
a
Sequence (50 e30 )a F: pAATCGAGAAATCTGGAAACA GGGAGGGGAAGGGTTCAGTT R: Tag1 CACCTCAGCATCACAAAGCACA U: Tag2GTAAACGCTTTGAAGCAAGA LDP: pAATCGAGAAATCTGGAAACA(N)126Tag1 F: pTTCGGAACTAATAGAGATG GCTCAAGGCTAGGATGGAGA R: Tag1 TCTCCTTCACCTGCTTGGC U: Tag2TTACCGTTTTATCAGATAGATGG LDP: pTTCGGAACTAATAGAGATG(N)233Tag1 F: pAACCGACCGCTAACAGCTACAGATGGGGAGGGGAAGGGTTC R: Tag1 CGTTTGTGGAAGGATAGAGG U: Tag2ACAGTTTCACTTGTTCGTTG LDP: pAACCGACCGCTAACAGCTACAG(N)317Tag1 F: p GTTGGGTTCTGGATGTTAGGA GGGAGGGGAAGGGTTCAGTT R: Tag1 AATCAAGCTGCTGCTCCAAA U: Tag2 ATAGCATACAGGTTACTCTT LDP: p GTTGGGTTCTGGATGTTAGGA (N)397Tag1 F: pAATGGAACAAGGAAACTCT GTGCTTTGTGATGCTGAGGTG R: Tag1 CGTTTGTGGAAGGATAGAGG U: Tag2TATGAAATCCGCAAGCATCCA LDP: pAATGGAACAAGGAAACTCT(N)501Tag1 F: pTTCTACTTGGAAACATCATT GGGAGGGGAAGGGTTCAGTT R: Tag1 CGTTTGTGGAAGGATAGAGG U: Tag2GAGTTTAGCCTAGAGCCCCAC LDP: pTTCTACTTGGAAACATCATT(N)569Tag1 F: pCATCAGCATTTGGTTCGGTCT GGAGGGGAAGGGTTCAGTT R: Tag1 GGCAGGAGTACTGCATTGGCT U: Tag2CCGTGACCTTATGGGCAAT LDP: pCATCAGCATTTGGTTCGGTCT(N)716Tag1
Amplicons size (bp) 163 204 269 312 358 398 433 474 537 578 606 647 754 793
The underlined sections are the universal tag sequences. The target matching sequence in probes are indicated in bold; The specific primer sections for the amplification of LDPs are unmodified. (N)n indicate the long stuffers; U, the sequences of the upstream probes; p, 50 phosphorylation; Tag1 ¼ CAGGCAGGTTGGCAGAC; Tag2 ¼ TGCTTATGTTATGCGATGCC.
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
7
using the same method as in the simplex LDRePCR except that the individual plasmid or cDNA template was replaced by the pooled plasmids or cDNA templates for LDR. The MLP was optimized by varying the concentration of LDR probe (5 101 to 5 104 pmol), the LDR annealing temperature (65 C), the quantity of Taq DNA ligase (10e1 U), the total LDR cycles (50e10), the concentration of universal primer (3.5e0.4 mM), and the quantity of rTaq polymerase (3.5e0.5 U). Data analysis The relative densities of the target bands were estimated by using the densitometry analysis software Gel-Pro Analyzer 4.0 (Media Cybernetics, Rockville, MD, USA) and quantified by reference to the standard loading. The relative density data were imported to Excel 2003 for further statistical analysis. The sensitivity measurements and electrophoretic analysis were repeated three times. Results and discussion Design strategy The design strategy for the MLP is schematically illustrated in two stages: an asymmetric PCR step for ssLDP generation (Fig. 1A) and an LDRePCR step for target detection (Fig. 1B). Introduction of ssLDPs and upstream LDR probes in the ligation reaction improved the detection accuracy. Optimization of the protocol was achieved by ligation and amplification adjustments. Each set of MLP probe consists of two universal tags: target-specific probes and a stuffer sequence unique for the ligated product. Thus, the specificity of probes, the tag sequences, and the selectivity of the ligation reaction are combined to increase the discrimination power in the LDRePCR. To achieve similar results, other ligation-based methods would require fluorescently labeled probes or synthesized long probes, which would significantly increase the assay cost as the plex level increases. In the asymmetric PCR step, two primers with unequal amounts were used to generate the 50 phosphorylated ssLDP from a subjective template (Fig. 1). The design was to have the length of ssLDPs increasing from a minimum of 163 nt to a maximum of 754 nt with a least increment of 69 nt to simplify the capturing and identification in the electrophoresis. The ssLDPs inherited a phosphoryl group at the 50 end from the forward primers. This ensured a successful ssLDP ligation with the corresponding LDR probes in the next step when they were annealed onto the detected template without gaps (Fig. 1, Table 1, and Table 1S). Evaluation of assay specificity The specificity of MLP detection mainly depends on the selection of universal tags, stuffer sequences, and design of probes. The LDR technique introduced in this study confers detection specificity [20]. All oligos were designed and inspected (e.g., BLAST analyses) to minimize the chances of hybridizing with other genes. The LDR probe pairs went with the target sequences, with the nucleotides around the nicking site at the junction being perfectly base-paired. The probe sequence was intentionally designed to have a higher theoretical melting temperature of 65 C with 50e60% GC composition. This reduced or prevented the potential problems caused by secondary structures of the targets. In addition, the seven ligated products contain sequences complementary to the universal primers, allowing them to be amplified with similar efficiency. All of the LDR probes from the seven species yielded unique bands with expected sizes (Fig. 2A and B), whereas the negative controls
Fig.2. Detection specificity in the presence of single template and multiplex templates in the MLP reaction using electrophoretic analysis. (A) Electrophoresis results with following single template: 16kDaTRV, 2bCMV, P0BWYV, 19kDaTRSV, HcProPVY, P25PVX, and P0PLRV in the even lanes of 2, 4, 6, 8, 10, 12, and 14, respectively, using the corresponding specific probes. The odd-numbered lanes correspond to the results with healthy potato leaves in the LDR and serve as controls to the left lanes. (B) The results of multiplex LDRePCR in the presence of single suppressor. Lanes 1 to 10 match with the healthy potato leaves, VPg, W19K, 16kDaTRV, 2bCMV, P0BWYV, 19kDaTRSV, HcProPVY, P25PVX, and P0PLRV, respectively. (C) The results of multiplex LDRePCR in the presence of one or several templates. The templates in lanes 1 to 16 are the healthy potato leaves (lane 1), VPg (lane 2), W19K (lane 3), 16kDaTRV (lane 4), P0PLRV (lane 5), 16kDaTRV þ 2bCMV (lane 6), P25PVX þ P0PLRV (lane 7), 16kDaTRV þ 2bCMV þ P0BWYV (lane 8), HcProPVY þ P25PVX þ P0PLRV (lane 9), 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 10), 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY (lane 11), P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 12), 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX (lane 13), 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 14), 2bCMVþP0BWYVþ19kDaTRSVþHcProPVYþP25PVXþP0PLRV(lane 15), and 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 16). M refers to the DL1000 ladder size standard.
gave no band at all (Fig. 2A, lanes with odd numbers, and Fig. 2B, lanes 1e3). These results strongly suggested that the designed LDR probes and the protocol possessed an excellent specificity for the detection of the suppressors and 18S rRNA. Capability of MLP capturing Ligase-based methods are ideal for multiplexing because several probe sets can be ligated along a gene without the interference encountered in the polymerase-based assays [20]. To determine the efficiency of the MLP-based ssLDP method, we generated seven mixed templates to mimic the complex molecular targets. Each mixture contained one to seven parent templates,
8
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
respectively. They were individually subjected to a multiplex ligation reaction primed with the pooled seven LDR probe pairs in a single reaction. As seen in Fig. 2C, all of the expected bands were well detected and well separated, indicating that the MLP achieved higher level multiplexing by performing ligation and amplification in separate steps. It is noteworthy that the amount of LDR products was amplified evenly without obvious bias toward the product lengths. Sensitivity of MLP Plant viruses are distributed randomly, often with low titers in the tissues [21], thereby requiring higher detection sensitivity. This could be achieved through amplifying LDR products by using universal primers after the ligation step. The sensitivity of the method was evaluated by using different concentrations of templates and probes. The concentration was attenuated in 10-fold dilution. In the presence of 1.2 104 copies of templates, the probes were diluted
Table 2 Comparison microarray and gel electrophoresis analysis using for field samples. Suppressor
TRV
16 kDa 2bCMV P0BWYV 19kDaTRSV HcProPVY P25PVX P0PLRV a b
Number of field samples with the following electrophoresis and microarray resulta Eþ/Mþ
E/Mþ
Eþ/M
E/M
19 7 7 17 24 34 23
1 0 1 1 0 1 1
0 0 0 0 0 0 0
59 72 71 61 55 44 55
Concordance rate (%)b
98.73 100 98.73 98.73 100 98.73 98.73
E, Electrophoresis; M, Microarray; þ, positive result; , negative result. Concordance rate ¼ (PCRþ/Mþ þ PCR/M) ÷ Sample Size.
from 5 101 to 5 104 pmol. In the presence of 0.1 pmol mixed probes, the templates were diluted from 1.2 106 to 1.2 102 copies. As shown in Fig. 3A (see also Fig. 1S in supplementary material), the assay could detect as low as 1200 copies of templates easily with a minimal amount of 5 104 pmol probes (Figs. 3A and 1S). The results in the presence of two templates (Fig. 3B and C) were similar to the results in the presence of one template (Fig. 3A). Current detection sensitivity can be raised 10fold reliably if a more sensitive dye were used, for example, SYBRO Green dye [22]. Thus, the detectable number of copies could be decreased to two digits. Performance of MLP with field samples To test the accuracy and reliability of the platform, a panel of 79 potato samples was analyzed with the MLP assay. The results obtained using the current method and those obtained previously using microarray analysis are summarized in Table 2. Overall, the two methods are compatible with each other except for five samples, that is, one from each of following groups: 16kDaTRV, P0BWYV, 19kDaTRSV, P25PVX, and P0PLRV, which were detected by microarray but not by electrophoresis. When compared with the microarray assay, electrophoresis detected all seven suppressors with a concordance rate of 98.73e100% (Table 2).
Conclusion The described ssLDP platform is specific, yielding unequivocal identification of the seven suppressors. Thus, it is amenable to the analysis of complex samples. The sensitivity is high given that it could detect as low as 1.2 103 copies of single or mixed templates. The platform has great potential and could be widely used as a tool for the monitoring of field or clinical samples. Acknowledgments
Fig.3. Quantitative agarose electrophoresis to show the detection sensitivity for the templates. Mixtures (0.1 pmol) of the seven pairs of probes were used as the primers in the presence of single template (A) and a pair of templates (B,C). The seven individual plasmid (A), 2bCMV (B), and 19kDaTRSV (C) were diluted at 10-fold from 6 107 to 6 102 copies. In addition, 6 107 copies of 16kDaTRV were also included in panels B and C. The loading marker was used as a reference to measure the amount of the amplicons. Three PCRs were performed, and the standard deviations are shown by the error bars.
This work was supported by the Initiation Project from the Ministry of Science and Technology of China (2011CB111500), the National Natural Science Foundation of China (31270715), and the Foundation from Zhejiang Agriculture and Forestry University (2010FR072). The authors thank Wei Deng (National Center for Protein Science Shanghai) for help with article revision.
Appendix A. Supplementary material Supplementary material related to this article can be found at http://dx.doi.org/10.1016/j.ab.2015.08.029.
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
References [1] J. Han, F. Niu, M. Jin, L. Wang, J. Liu, P. Zhang, B. Xie, X. Wu, D. Wen, L. Ji, Clinical presentation and sequence analyses of HA and NA antigens of the novel H7N9 viruses, Emerg. Microbes Infect. 2 (2013) e23. [2] J. Tilsner, K.J. Oparka, Missing links? The connection between replication and movement of plant RNA viruses, Curr. Opin. Virol. 2 (2012) 705e711. [3] Q. Meng, C. Wong, A. Rangachari, S. Tamatsukuri, M. Sasaki, E. Fiss, L. Cheng, T. Ramankutty, D. Clarke, H. Yawata, Y. Sakakura, T. Hirose, C. Impraim, Automated multiplex assay system for simultaneous detection of hepatitis B virus DNA, hepatitis C virus RNA, and human immunodeficiency virus type 1 RNA, J. Clin. Microbiol. 39 (2001) 2937e2945. [4] T.A. Clegg, A. Duignan, C. Whelan, E. Gormley, M. Good, J. Clarke, N. Toft, S.J. More, Using latent class analysis to estimate the test characteristics of the g-interferon test, the single intradermal comparative tuberculin test, and a multiplex immunoassay under Irish conditions, Vet. Microbiol. 151 (2011) 68e76. [5] C. Song, X. Yang, K. Wang, Q. Wang, J. Huang, J. Liu, W. Liu, P. Liu, Label-free and non-enzymatic detection of DNA based on hybridization chain reaction amplification and dsDNA-templated copper nanoparticles, Anal. Chim. Acta 827 (2015) 74e79. [6] C. Strauss, A. Endimiani, V. Perreten, A novel universal DNA labeling and amplification system for rapid microarray-based detection of 117 antibiotic resistance genes in gram-positive bacteria, J. Microbiol. Methods 108 (2015) 25e30. [7] L. Li, X. Wang, X. Zhang, J. Wang, W. Jin, Single-cell multiple gene expression analysis based on single-molecule detection microarray assay for multi-DNA determination, Anal. Chim. Acta 854 (2015) 122e128. [8] P. Markoulatos, N. Siafakas, M. Moncany, Multiplex polymerase chain reaction: a practical approach, J. Clin. Lab. Anal. 16 (2002) 47e51. [9] B. Hou, X. Meng, L. Zhang, J. Guo, S. Li, H. Jin, Development of a sensitive and specific multiplex PCR method for the simultaneous detection of chicken, duck, and goose DNA in meat products, Meat Sci. 101 (2015) 90e94. [10] T.T. Hsern Malcolm, Y.K. Cheah, C.W.J.W.M. Radzi, F.A. Kasim, H.K. Kantilal, T.Y. Huat John, J. Martinez-Urtaza, Y. Nakaguchi, M. Nishibuchi, R. Son, Detection and quantification of pathogenic Vibrio parahaemolyticus in shellfish by using multiplex PCR and loop-mediated isothermal amplification assay, Food Control 47 (2015) 664e671. [11] J.P. Schouten, C.J. McElgunn, R. Waaijer, D. Zwijnenburg, F. Diepvens, G. Pals, Relative quantification of 40 nucleic acid sequences by multiplex ligationdependent probe amplification, Nucleic Acids Res. 30 (2002) e57.
9
[12] A. Deshpande, J. Gans, S.W. Graves, L. Green, L. Taylor, H.B. Kim, Y.A. Kunde, P.M. Leonard, P.E. Li, J. Mark, J. Song, M. Vuyisich, P.S. White, A rapid multiplex assay for nucleic acid-based diagnostics, J. Microbiol. Methods 80 (2009) 155e163. [13] X. Zhang, Y. Xu, D. Liu, J. Geng, S. Chen, Z. Jiang, Q. Fu, K. Sun, A modified multiplex ligation-dependent probe amplification method for the detection of 22q11.2 copy number variations in patients with congenital heart disease, BMC Genom. 16 (2015) 364. [14] A.J. Soitamo, B. Jada, K. Lehto, HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers, BMC Plant Biol. 11 (2011) 68. [15] I. Mahmood-ur-Rahman, T. Ali, S. Husnain, Riazuddin, RNA interference: the story of gene silencing in plants and humans, Biotechnol. Adv. 26 (2008) 202e209. [16] A.F. Fusaro, R.L. Correa, K. Nakasugi, C. Jackson, L. Kawchuk, M.F.S. Vaslin, P.M. Waterhouse, The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation, Virology 426 (2012) 178e187. [17] M.H. Chiu, I.H. Chen, D.C. Baulcombe, C.H. Tsai, The silencing suppressor P25 of Potato virus X interacts with Argonaute 1 and mediates its degradation through the proteasome pathway, Mol. Plant Pathol. 11 (2010) 641e649. [18] B. Ghoshal, H. Sanfacon, Temperature-dependent symptom recovery in Nicotiana benthamiana plants infected with tomato ringspot virus is associated with reduced translation of viral RNA2 and requires argonaute 1, Virology 456e457 (2014) 188e197. [19] P. Wang, Y. Guo, J.H. Cheng, Q. Dong, X. Ding, J. Guo, Y. Jiang, Application of multiplex reverse transcriptioneligase detection reactionepolymerase chain reaction (MRLP) mediated universal DNA microarray for detecting potato viruses in field samples, Eur. J. Plant Pathol. 132 (2012) 217e227. [20] P. Wang, Y. Guo, J. Cheng, Q. Dong, X. Ding, J. Guo, Y. Jiang, Development of multiplex reverse transcriptioneligase detection reactionepolymerase chain reaction (MRLP) mediated universal DNA microarray for diagnostic platform, Biosens. Bioelectron. 26 (2011) 3719e3724. [21] E.A. Engel, P.F. Escobar, L.A. Rojas, P.A. Rivera, N. Fiore, P.D. Valenzuela, A diagnostic oligonucleotide microarray for simultaneous detection of grapevine viruses, J. Virol. Methods 163 (2009) 445e451. [22] V.L. Singer, T.E. Lawlor, S. Yue, Comparison of SYBR Green I nucleic acid gel stain mutagenicity and ethidium bromide mutagenicity in the Salmonella/ mammalian microsome reverse mutation assay (Ames test), Mutat. Res. 439 (1999) 37e47.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
A long downstream probe-based platform for multiplex target capture Ping Wang a, b, Jianqin Huang a, Yingwu Xu a, * a b
Nurturing Station for the State Key Laboratory of Subtropical Silviculture, Zhejiang Agriculture and Forestry University, Lin'an 311300, China National Center for Protein Science Shanghai, Shanghai 201210, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 June 2015 Received in revised form 25 August 2015 Accepted 27 August 2015 Available online 5 September 2015
A simple and rapid detection platform was established for multiplex target capture through generating single-strand long downstream probe (ssLDP), which was integrated with the ligase detection reaction (LDR) method for the purpose of multiplicity and high specificity. To increase sensitivity, the ladder-like polymerase chain reaction (PCR) amplicons were generated by using universal primers that complement ligated products. Each of the amplicons contained a stuffer sequence with a defined yet variable length. Thus, the length of the amplicon is an index of the specific suppressor, allowing its identification via electrophoresis. The multiplexed diagnostic platform was optimized using standard plasmids and validated by using potato virus suppressors as a detection model. This technique can detect down to 1.2 103 copies for single or two mixed target plasmids. When compared with microarray results, the electrophoresis showed 98.73e100% concordance rates for the seven suppressors in the 79 field samples. This strategy could be applied to detect a large number of targets in field and clinical surveillance. © 2015 Elsevier Inc. All rights reserved.
Keywords: Suppressor Single-strand long downstream probe Ligase detection reaction Stuffer sequence Concordance rates
The circulation of the novel H7N9 avian influenza A virus spreading from one country to another within a short span in 2013 [1] and the outbreak of plant viruses [2] are a serious threat to human health and plant production. To take measures promptly, a rapid yet efficient method to detect the pathogen types at the very early stage of the virus outbreak is in great demand [3]. Multiplex target capture technology can meet this type of diagnostic requirement. It can enrich the low level of the target pathogens in a multiplex fashion, followed by a detection strategy. Considerable effort has been devoted to augment the targets for multiplexing [4]. Nonetheless, it is still a great challenge to achieve a streamlined approach while bearing the advantages of specificity, sensitivity, and cost efficiency at the same time. Within the multiplex capturing strategy, DNA microarray technology can detect thousands of templates in a single assay. However, it has limited specificity and sensitivity during hybridizations of DNA samples to the respective capture probes [5e7]. Multiplex
Abbreviations: PCR, polymerase chain reaction; LDR, ligase detection reaction; MLP, multiplex LDRePCR; ssLDP, single-strand long downstream probe; P0BWYV, beet western yellow virus P0; 2bCMV, cucumber mosaic virus 2b; P0PLRV, potato leafroll virus P0; P25PVX, potato virus X P25; HcProPVY, potato virus Y help component proteinase; 16kDaTRV, tobacco rattle virus 16-kDa protein; 19kDaTRSV, tobacco ringspot virus 19-kDa protein. * Corresponding author. E-mail address: [email protected] (Y. Xu). http://dx.doi.org/10.1016/j.ab.2015.08.029 0003-2697/© 2015 Elsevier Inc. All rights reserved.
polymerase chain reaction (PCR) has greatly improved this situation, but it could create spurious amplicons, uneven or nonexistent amplification, despite decades of effort [8e10]. To improve the specificity, Schouten and coworkers [11] developed a method by hybridizing the probes adjacent to the target DNA for ligation and only the ligated probes, not the original target DNAs, are amplified by PCR. However, this method requires producing long downstream ligase detection reaction (LDR) probes. The procedure is laborious. It includes the initial multistep conventional cloning, cell amplification, DNA extraction, double-stranded DNA modification, and so on [12,13]. To overcome these issues, we developed a novel yet low-cost approach that is called multiplex LDRePCR (MLP) (Fig. 1). This method generates ladder-like single-strand long downstream probes (ssLDPs) with lengths between 163 and 754 bases. The conventional asymmetric PCR produces a sufficient amount of ssLDPs that are used as the downstream LDR probes. Each pair of ssLDP and the upstream LDR probes are pathogen specific, containing two universal tags and one variable long stuffer spacer. The platform combines the specificity of the probe-mediated ligation and the advantage of homogeneous amplification for multiplex targets. A test set of seven suppressors was selected as a model assay [14e18]. The assay platform was also tested on a set of 79 field samples, and the results were compared with those of the microarray method, demonstrating a great potential for this assay platform as a tool in surveillance and diagnostics.
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
5
Fig.1. Schematic representation of MLP assay. (A) Preparation of the asymmetric PCR-derived ssLDP oligonucleotides. Each ssLDP has a defined stuffer length (163e754 nt). The subjective template (Hickory Apetala 1 gene) and two primers are used to generate the stuffer sequence with different lengths via asymmetric PCR. The forward primer (left) has a downstream probe adaptor (red) with the 50 end phosphorylated. The reverse primer (right) has a universal tag 1. The AP1 template has no sequence homology with the detected targets. (B) Depiction of the essential components of an MLP assay. Ligation is achieved by using one synthesized upstream LDR probe and one asymmetric PCR-derived ssLDP. The upstream LDR probe (left) is composed of target-specific sequence complementary to the detected region (red) with the 50 universal tag 2 (blue), which is hydroxylated on its 30 end. The ssLDP (right) includes a target-specific sequence complementary to the detected region (red), a stuffer (black), and a universal 30 tag 1 tail sequence, which is phosphorylated on its 50 end. In the case of a perfect match, the set of upstream LDR probe and ssLDP will be hybridized adjacently to each other by DNA ligase (left). In the case of a mismatch, no ligation will occur (right). The ligation products are further amplified in a PCR by the universal primers. The amplicons are loaded onto gel electrophoresis for separation and identification. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.).
Materials and methods Materials Seven suppressor genes used in this study were beet western yellows virus P0 (P0BWYV), cucumber mosaic virus 2b (2bCMV), potato leafroll virus P0 (P0PLRV), potato virus X P25 (P25PVX), potato virus Y help component proteinase (HcProPVY), tobacco rattle virus 16-kDa
protein (16 kDaTRV), and tobacco ringspot virus 19-kDa protein (19 kDaTRSV). The viruses (infected potato leaves) were purchased from Bioreba (Switzerland) and stored at 80 C. Two nontarget viruses, wheat yellow mosaic virus VPg protein region and Chinese wheat mosaic virus W19K protein region, were used to determine the specificity of the assay. Hickory Apetala 1 gene (GenBank: KF918309, AP1), which shares no homology with any of the targets, was used as an initial subjective template to generate different sizes of ssLDPs.
6
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
A total of 79 symptomatic field potato samples that were used previously in microarray [19] were tested in this study.
All primers, universal tags, stuffer spacers, and LDR probes were blasted against the complete GenBank database to ensure that they represent unique sequences to avoid nonspecific PCR products. Primers and probes were synthesized by Sangon.
Oligonucleotide preparation The sequences of the seven suppressors were obtained from GenBank. They were blasted against NCBI to search for the most conserved region, which was selected as the binding region for the probes. To get an optimal set of LDR probe, some factors are taken into consideration during the process of probe design, including the high melting temperature (65 C) and the stuffer length (Table 1; see also Table 1S in online supplementary material). The primers (Table 2S) and probes were designed and optimized by using Primer 5.0 (Premier Biosoft International, Palo Alto, CA, USA) and DNASTAR software. Each MLP probe consists of one short synthetic upstream LDR probe and one asymmetric PCR-derived ladder-like ssLDP sequence (163e754 nt). The short synthesized oligonucleotide of upstream LDR probe contains a target-specific sequence at the 30 end and a universal tag 2 sequence at the 50 end. Preparation of ssLDP is outlined in Fig. 1. To generate the ssLDP from the template AP1, an asymmetric PCR was performed using two primers with unequal amounts. The forward primer contained the target-specific sequence (the downstream probe) from the suppressors. The reverse primer had a universal tag 1. The ratio of the forward primer over reverse was optimized to 10:1 to give the most abundant ssLDP. The purified ssLDP fragments were confirmed via gel electrophoresis and DNA sequencing (Sangon, Shanghai, China). Thus, each ssLDP contains a target-specific sequence at the 50 phosphorylated end, a universal tag 1 sequence at the 30 end, and a stuffer sequence with variable length in between. The stuffer sequence obtained from the template AP1 has no homology with the targets.
RNA extraction and quantification Total RNAs of the positive tissue samples and 79 field samples (~100 mg) were extracted using a Trizol Reagent Kit (Takara, China) following the manufacturer's instructions. The quantities of the purified RNAs and the purified PCR fragments of ssLDPs were determined using a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) by measuring A260, and the quality was evaluated based on the ratio of A260/A280. Suppressor cDNA synthesis and template construction The seven extracted RNAs were reverse transcribed following the procedure recommended by the manufacturer (Takara). 18S rRNA negative controls were included in all runs. Plasmids containing the seven target genes were amplified by the primer set shown in Table 1S and cloned into the pMD-19T simple vector according to the procedures recommended by the manufacturer (Takara). Clones were confirmed by electrophoresis and sequencing. Plasmids were quantitated by using the NanoDrop ND100 spectrophotometer. Setup of simplex LDRePCR and multiplex LDRePCR Simplex LDRePCR was carried out as described in our previous study [20]. Briefly, a set of two probes are ligated and PCR is performed with universal primers. The ladder-like amplicon products are separated on a 3% gel electrophoresis. The MLP was performed
Table 1 Upstream and downstream probes used for LDR. Suppressor TRV
16 kDa
2bCMV
P0BWYV
19kDaTRSV
HcProPVY
P25PVX
P0PLRV
a
Sequence (50 e30 )a F: pAATCGAGAAATCTGGAAACA GGGAGGGGAAGGGTTCAGTT R: Tag1 CACCTCAGCATCACAAAGCACA U: Tag2GTAAACGCTTTGAAGCAAGA LDP: pAATCGAGAAATCTGGAAACA(N)126Tag1 F: pTTCGGAACTAATAGAGATG GCTCAAGGCTAGGATGGAGA R: Tag1 TCTCCTTCACCTGCTTGGC U: Tag2TTACCGTTTTATCAGATAGATGG LDP: pTTCGGAACTAATAGAGATG(N)233Tag1 F: pAACCGACCGCTAACAGCTACAGATGGGGAGGGGAAGGGTTC R: Tag1 CGTTTGTGGAAGGATAGAGG U: Tag2ACAGTTTCACTTGTTCGTTG LDP: pAACCGACCGCTAACAGCTACAG(N)317Tag1 F: p GTTGGGTTCTGGATGTTAGGA GGGAGGGGAAGGGTTCAGTT R: Tag1 AATCAAGCTGCTGCTCCAAA U: Tag2 ATAGCATACAGGTTACTCTT LDP: p GTTGGGTTCTGGATGTTAGGA (N)397Tag1 F: pAATGGAACAAGGAAACTCT GTGCTTTGTGATGCTGAGGTG R: Tag1 CGTTTGTGGAAGGATAGAGG U: Tag2TATGAAATCCGCAAGCATCCA LDP: pAATGGAACAAGGAAACTCT(N)501Tag1 F: pTTCTACTTGGAAACATCATT GGGAGGGGAAGGGTTCAGTT R: Tag1 CGTTTGTGGAAGGATAGAGG U: Tag2GAGTTTAGCCTAGAGCCCCAC LDP: pTTCTACTTGGAAACATCATT(N)569Tag1 F: pCATCAGCATTTGGTTCGGTCT GGAGGGGAAGGGTTCAGTT R: Tag1 GGCAGGAGTACTGCATTGGCT U: Tag2CCGTGACCTTATGGGCAAT LDP: pCATCAGCATTTGGTTCGGTCT(N)716Tag1
Amplicons size (bp) 163 204 269 312 358 398 433 474 537 578 606 647 754 793
The underlined sections are the universal tag sequences. The target matching sequence in probes are indicated in bold; The specific primer sections for the amplification of LDPs are unmodified. (N)n indicate the long stuffers; U, the sequences of the upstream probes; p, 50 phosphorylation; Tag1 ¼ CAGGCAGGTTGGCAGAC; Tag2 ¼ TGCTTATGTTATGCGATGCC.
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
7
using the same method as in the simplex LDRePCR except that the individual plasmid or cDNA template was replaced by the pooled plasmids or cDNA templates for LDR. The MLP was optimized by varying the concentration of LDR probe (5 101 to 5 104 pmol), the LDR annealing temperature (65 C), the quantity of Taq DNA ligase (10e1 U), the total LDR cycles (50e10), the concentration of universal primer (3.5e0.4 mM), and the quantity of rTaq polymerase (3.5e0.5 U). Data analysis The relative densities of the target bands were estimated by using the densitometry analysis software Gel-Pro Analyzer 4.0 (Media Cybernetics, Rockville, MD, USA) and quantified by reference to the standard loading. The relative density data were imported to Excel 2003 for further statistical analysis. The sensitivity measurements and electrophoretic analysis were repeated three times. Results and discussion Design strategy The design strategy for the MLP is schematically illustrated in two stages: an asymmetric PCR step for ssLDP generation (Fig. 1A) and an LDRePCR step for target detection (Fig. 1B). Introduction of ssLDPs and upstream LDR probes in the ligation reaction improved the detection accuracy. Optimization of the protocol was achieved by ligation and amplification adjustments. Each set of MLP probe consists of two universal tags: target-specific probes and a stuffer sequence unique for the ligated product. Thus, the specificity of probes, the tag sequences, and the selectivity of the ligation reaction are combined to increase the discrimination power in the LDRePCR. To achieve similar results, other ligation-based methods would require fluorescently labeled probes or synthesized long probes, which would significantly increase the assay cost as the plex level increases. In the asymmetric PCR step, two primers with unequal amounts were used to generate the 50 phosphorylated ssLDP from a subjective template (Fig. 1). The design was to have the length of ssLDPs increasing from a minimum of 163 nt to a maximum of 754 nt with a least increment of 69 nt to simplify the capturing and identification in the electrophoresis. The ssLDPs inherited a phosphoryl group at the 50 end from the forward primers. This ensured a successful ssLDP ligation with the corresponding LDR probes in the next step when they were annealed onto the detected template without gaps (Fig. 1, Table 1, and Table 1S). Evaluation of assay specificity The specificity of MLP detection mainly depends on the selection of universal tags, stuffer sequences, and design of probes. The LDR technique introduced in this study confers detection specificity [20]. All oligos were designed and inspected (e.g., BLAST analyses) to minimize the chances of hybridizing with other genes. The LDR probe pairs went with the target sequences, with the nucleotides around the nicking site at the junction being perfectly base-paired. The probe sequence was intentionally designed to have a higher theoretical melting temperature of 65 C with 50e60% GC composition. This reduced or prevented the potential problems caused by secondary structures of the targets. In addition, the seven ligated products contain sequences complementary to the universal primers, allowing them to be amplified with similar efficiency. All of the LDR probes from the seven species yielded unique bands with expected sizes (Fig. 2A and B), whereas the negative controls
Fig.2. Detection specificity in the presence of single template and multiplex templates in the MLP reaction using electrophoretic analysis. (A) Electrophoresis results with following single template: 16kDaTRV, 2bCMV, P0BWYV, 19kDaTRSV, HcProPVY, P25PVX, and P0PLRV in the even lanes of 2, 4, 6, 8, 10, 12, and 14, respectively, using the corresponding specific probes. The odd-numbered lanes correspond to the results with healthy potato leaves in the LDR and serve as controls to the left lanes. (B) The results of multiplex LDRePCR in the presence of single suppressor. Lanes 1 to 10 match with the healthy potato leaves, VPg, W19K, 16kDaTRV, 2bCMV, P0BWYV, 19kDaTRSV, HcProPVY, P25PVX, and P0PLRV, respectively. (C) The results of multiplex LDRePCR in the presence of one or several templates. The templates in lanes 1 to 16 are the healthy potato leaves (lane 1), VPg (lane 2), W19K (lane 3), 16kDaTRV (lane 4), P0PLRV (lane 5), 16kDaTRV þ 2bCMV (lane 6), P25PVX þ P0PLRV (lane 7), 16kDaTRV þ 2bCMV þ P0BWYV (lane 8), HcProPVY þ P25PVX þ P0PLRV (lane 9), 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 10), 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY (lane 11), P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 12), 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX (lane 13), 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 14), 2bCMVþP0BWYVþ19kDaTRSVþHcProPVYþP25PVXþP0PLRV(lane 15), and 16kDaTRV þ 2bCMV þ P0BWYV þ 19kDaTRSV þ HcProPVY þ P25PVX þ P0PLRV (lane 16). M refers to the DL1000 ladder size standard.
gave no band at all (Fig. 2A, lanes with odd numbers, and Fig. 2B, lanes 1e3). These results strongly suggested that the designed LDR probes and the protocol possessed an excellent specificity for the detection of the suppressors and 18S rRNA. Capability of MLP capturing Ligase-based methods are ideal for multiplexing because several probe sets can be ligated along a gene without the interference encountered in the polymerase-based assays [20]. To determine the efficiency of the MLP-based ssLDP method, we generated seven mixed templates to mimic the complex molecular targets. Each mixture contained one to seven parent templates,
8
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
respectively. They were individually subjected to a multiplex ligation reaction primed with the pooled seven LDR probe pairs in a single reaction. As seen in Fig. 2C, all of the expected bands were well detected and well separated, indicating that the MLP achieved higher level multiplexing by performing ligation and amplification in separate steps. It is noteworthy that the amount of LDR products was amplified evenly without obvious bias toward the product lengths. Sensitivity of MLP Plant viruses are distributed randomly, often with low titers in the tissues [21], thereby requiring higher detection sensitivity. This could be achieved through amplifying LDR products by using universal primers after the ligation step. The sensitivity of the method was evaluated by using different concentrations of templates and probes. The concentration was attenuated in 10-fold dilution. In the presence of 1.2 104 copies of templates, the probes were diluted
Table 2 Comparison microarray and gel electrophoresis analysis using for field samples. Suppressor
TRV
16 kDa 2bCMV P0BWYV 19kDaTRSV HcProPVY P25PVX P0PLRV a b
Number of field samples with the following electrophoresis and microarray resulta Eþ/Mþ
E/Mþ
Eþ/M
E/M
19 7 7 17 24 34 23
1 0 1 1 0 1 1
0 0 0 0 0 0 0
59 72 71 61 55 44 55
Concordance rate (%)b
98.73 100 98.73 98.73 100 98.73 98.73
E, Electrophoresis; M, Microarray; þ, positive result; , negative result. Concordance rate ¼ (PCRþ/Mþ þ PCR/M) ÷ Sample Size.
from 5 101 to 5 104 pmol. In the presence of 0.1 pmol mixed probes, the templates were diluted from 1.2 106 to 1.2 102 copies. As shown in Fig. 3A (see also Fig. 1S in supplementary material), the assay could detect as low as 1200 copies of templates easily with a minimal amount of 5 104 pmol probes (Figs. 3A and 1S). The results in the presence of two templates (Fig. 3B and C) were similar to the results in the presence of one template (Fig. 3A). Current detection sensitivity can be raised 10fold reliably if a more sensitive dye were used, for example, SYBRO Green dye [22]. Thus, the detectable number of copies could be decreased to two digits. Performance of MLP with field samples To test the accuracy and reliability of the platform, a panel of 79 potato samples was analyzed with the MLP assay. The results obtained using the current method and those obtained previously using microarray analysis are summarized in Table 2. Overall, the two methods are compatible with each other except for five samples, that is, one from each of following groups: 16kDaTRV, P0BWYV, 19kDaTRSV, P25PVX, and P0PLRV, which were detected by microarray but not by electrophoresis. When compared with the microarray assay, electrophoresis detected all seven suppressors with a concordance rate of 98.73e100% (Table 2).
Conclusion The described ssLDP platform is specific, yielding unequivocal identification of the seven suppressors. Thus, it is amenable to the analysis of complex samples. The sensitivity is high given that it could detect as low as 1.2 103 copies of single or mixed templates. The platform has great potential and could be widely used as a tool for the monitoring of field or clinical samples. Acknowledgments
Fig.3. Quantitative agarose electrophoresis to show the detection sensitivity for the templates. Mixtures (0.1 pmol) of the seven pairs of probes were used as the primers in the presence of single template (A) and a pair of templates (B,C). The seven individual plasmid (A), 2bCMV (B), and 19kDaTRSV (C) were diluted at 10-fold from 6 107 to 6 102 copies. In addition, 6 107 copies of 16kDaTRV were also included in panels B and C. The loading marker was used as a reference to measure the amount of the amplicons. Three PCRs were performed, and the standard deviations are shown by the error bars.
This work was supported by the Initiation Project from the Ministry of Science and Technology of China (2011CB111500), the National Natural Science Foundation of China (31270715), and the Foundation from Zhejiang Agriculture and Forestry University (2010FR072). The authors thank Wei Deng (National Center for Protein Science Shanghai) for help with article revision.
Appendix A. Supplementary material Supplementary material related to this article can be found at http://dx.doi.org/10.1016/j.ab.2015.08.029.
P. Wang et al. / Analytical Biochemistry 491 (2015) 4e9
References [1] J. Han, F. Niu, M. Jin, L. Wang, J. Liu, P. Zhang, B. Xie, X. Wu, D. Wen, L. Ji, Clinical presentation and sequence analyses of HA and NA antigens of the novel H7N9 viruses, Emerg. Microbes Infect. 2 (2013) e23. [2] J. Tilsner, K.J. Oparka, Missing links? The connection between replication and movement of plant RNA viruses, Curr. Opin. Virol. 2 (2012) 705e711. [3] Q. Meng, C. Wong, A. Rangachari, S. Tamatsukuri, M. Sasaki, E. Fiss, L. Cheng, T. Ramankutty, D. Clarke, H. Yawata, Y. Sakakura, T. Hirose, C. Impraim, Automated multiplex assay system for simultaneous detection of hepatitis B virus DNA, hepatitis C virus RNA, and human immunodeficiency virus type 1 RNA, J. Clin. Microbiol. 39 (2001) 2937e2945. [4] T.A. Clegg, A. Duignan, C. Whelan, E. Gormley, M. Good, J. Clarke, N. Toft, S.J. More, Using latent class analysis to estimate the test characteristics of the g-interferon test, the single intradermal comparative tuberculin test, and a multiplex immunoassay under Irish conditions, Vet. Microbiol. 151 (2011) 68e76. [5] C. Song, X. Yang, K. Wang, Q. Wang, J. Huang, J. Liu, W. Liu, P. Liu, Label-free and non-enzymatic detection of DNA based on hybridization chain reaction amplification and dsDNA-templated copper nanoparticles, Anal. Chim. Acta 827 (2015) 74e79. [6] C. Strauss, A. Endimiani, V. Perreten, A novel universal DNA labeling and amplification system for rapid microarray-based detection of 117 antibiotic resistance genes in gram-positive bacteria, J. Microbiol. Methods 108 (2015) 25e30. [7] L. Li, X. Wang, X. Zhang, J. Wang, W. Jin, Single-cell multiple gene expression analysis based on single-molecule detection microarray assay for multi-DNA determination, Anal. Chim. Acta 854 (2015) 122e128. [8] P. Markoulatos, N. Siafakas, M. Moncany, Multiplex polymerase chain reaction: a practical approach, J. Clin. Lab. Anal. 16 (2002) 47e51. [9] B. Hou, X. Meng, L. Zhang, J. Guo, S. Li, H. Jin, Development of a sensitive and specific multiplex PCR method for the simultaneous detection of chicken, duck, and goose DNA in meat products, Meat Sci. 101 (2015) 90e94. [10] T.T. Hsern Malcolm, Y.K. Cheah, C.W.J.W.M. Radzi, F.A. Kasim, H.K. Kantilal, T.Y. Huat John, J. Martinez-Urtaza, Y. Nakaguchi, M. Nishibuchi, R. Son, Detection and quantification of pathogenic Vibrio parahaemolyticus in shellfish by using multiplex PCR and loop-mediated isothermal amplification assay, Food Control 47 (2015) 664e671. [11] J.P. Schouten, C.J. McElgunn, R. Waaijer, D. Zwijnenburg, F. Diepvens, G. Pals, Relative quantification of 40 nucleic acid sequences by multiplex ligationdependent probe amplification, Nucleic Acids Res. 30 (2002) e57.
9
[12] A. Deshpande, J. Gans, S.W. Graves, L. Green, L. Taylor, H.B. Kim, Y.A. Kunde, P.M. Leonard, P.E. Li, J. Mark, J. Song, M. Vuyisich, P.S. White, A rapid multiplex assay for nucleic acid-based diagnostics, J. Microbiol. Methods 80 (2009) 155e163. [13] X. Zhang, Y. Xu, D. Liu, J. Geng, S. Chen, Z. Jiang, Q. Fu, K. Sun, A modified multiplex ligation-dependent probe amplification method for the detection of 22q11.2 copy number variations in patients with congenital heart disease, BMC Genom. 16 (2015) 364. [14] A.J. Soitamo, B. Jada, K. Lehto, HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers, BMC Plant Biol. 11 (2011) 68. [15] I. Mahmood-ur-Rahman, T. Ali, S. Husnain, Riazuddin, RNA interference: the story of gene silencing in plants and humans, Biotechnol. Adv. 26 (2008) 202e209. [16] A.F. Fusaro, R.L. Correa, K. Nakasugi, C. Jackson, L. Kawchuk, M.F.S. Vaslin, P.M. Waterhouse, The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation, Virology 426 (2012) 178e187. [17] M.H. Chiu, I.H. Chen, D.C. Baulcombe, C.H. Tsai, The silencing suppressor P25 of Potato virus X interacts with Argonaute 1 and mediates its degradation through the proteasome pathway, Mol. Plant Pathol. 11 (2010) 641e649. [18] B. Ghoshal, H. Sanfacon, Temperature-dependent symptom recovery in Nicotiana benthamiana plants infected with tomato ringspot virus is associated with reduced translation of viral RNA2 and requires argonaute 1, Virology 456e457 (2014) 188e197. [19] P. Wang, Y. Guo, J.H. Cheng, Q. Dong, X. Ding, J. Guo, Y. Jiang, Application of multiplex reverse transcriptioneligase detection reactionepolymerase chain reaction (MRLP) mediated universal DNA microarray for detecting potato viruses in field samples, Eur. J. Plant Pathol. 132 (2012) 217e227. [20] P. Wang, Y. Guo, J. Cheng, Q. Dong, X. Ding, J. Guo, Y. Jiang, Development of multiplex reverse transcriptioneligase detection reactionepolymerase chain reaction (MRLP) mediated universal DNA microarray for diagnostic platform, Biosens. Bioelectron. 26 (2011) 3719e3724. [21] E.A. Engel, P.F. Escobar, L.A. Rojas, P.A. Rivera, N. Fiore, P.D. Valenzuela, A diagnostic oligonucleotide microarray for simultaneous detection of grapevine viruses, J. Virol. Methods 163 (2009) 445e451. [22] V.L. Singer, T.E. Lawlor, S. Yue, Comparison of SYBR Green I nucleic acid gel stain mutagenicity and ethidium bromide mutagenicity in the Salmonella/ mammalian microsome reverse mutation assay (Ames test), Mutat. Res. 439 (1999) 37e47.