A method to identify RNA A-to-I editing targets using I-specific cleavage and exon array analysis

Molecular and Cellular Probes 27 (2013) 38e45

Contents lists available at SciVerse ScienceDirect

Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr

A method to identify RNA A-to-I editing targets using I-specific cleavage and exon array analysis Chao-Neng Tseng a, b, d, *, Hsueh-Wei Chang a, b, e, Joel Stocker b, c, Hui-Chun Wang b, Chiu-Chin Lu f, Cheng-Hsuan Wu i, j, Jyuer-Ger Yang g, h, Chung-Lung Cho g, Hurng-Wern Huang f, ** a

Department of Biomedical Science and Environmental Biology, Kaohsiung Medical University, 100 Shih-Chuan 1st Road, Kaohsiung City 807, Taiwan Graduate Institute of Natural Products, Kaohsiung Medical University, 100 Shih-Chuan 1st Road, Kaohsiung City 807, Taiwan Graduate Institute of Gender Studies, Kaohsiung Medical University, 100 Shih-Chuan 1st Road, Kaohsiung City 807, Taiwan d Cancer Center, Kaohsiung Medical University Hospital, Kaohsiung Medical University, 100 Shih-Chuan 1st Road, Kaohsiung City 807, Taiwan e Center of Excellence for Environmental Medicine, Kaohsiung Medical University, 100 Shih-Chuan 1st Road, Kaohsiung City 807, Taiwan f Institute of Biomedical Sciences, National Sun Yat-Sen University, 70 Lienhai Road, Kaohsiung City 804, Taiwan g Department of Biological Sciences, National Sun Yat-Sen University, 70 Lienhai Road, Kaohsiung City 804, Taiwan h Department of Obstetrics and Gynecology, Changhua Christian Hospital, 135 Nanxiao Street, Changhua City 500, Taiwan i Reproductive Medicine Center, Changhua Christian Hospital, 135 Nanxiao Street, Changhua City 500, Taiwan j Institute of Medicine, Chung Shan Medical University, 110 Jianguo North Road, Taichung 402, Taiwan b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 5 April 2012 Accepted 20 August 2012 Available online 28 August 2012

RNA A-to-I editing is the most common single-base editing in the animal kingdom. Dysregulations of RNA A-to-I editing are associated with developmental defects in mouse and human diseases. Mouse knockout models deficient in ADAR activities show lethal phenotypes associated with defects in nervous system, failure of hematopoiesis and reduced tolerance to stress. While several methods of identifying RNA A-to-I editing sites are currently available, most of the critical editing targets responsible for the important biological functions of ADARs remain unknown. Here we report a method to systematically analyze RNA A-to-I editing targets by combining I-specific cleavage and exon array analysis. Our results show that I-specific cleavage on editing sites causes more than twofold signal reductions in edited exons of known targets such as Gria2, Htr2c, Gabra3 and Cyfip2 in mice. This method provides an experimental approach for genome-wide analysis of RNA A-to-I editing targets with exon-level resolution. We believe this method will help expedite inquiry into the roles of RNA A-to-I editing in various biological processes and diseases. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: RNA editing Inosine Adenosine deamination ADAR Exon array I-specific cleavage

1. Introduction RNA adenosine-to-inosine (A-to-I) editing mediated by the ADAR (adenosine deaminase that acts on RNA) protein family is the predominant form of single-base editing in the animal kingdom (Fig. 1A) [1e3]. ADAR1 and ADAR2 are ubiquitously expressed whereas ADAR3 is mainly found in the brain [4e6]. Since the base pairing property of inosine is similar to guanosine, RNA A-to-I editing has effects equivalent to A-to-G mutations at the DNA level

Abbreviations: ADAR, Adenine deaminase acting on RNA; A, adenosine; I, inosine. * Corresponding author. Graduate Institute of Natural Products, Kaohsiung Medical University, 100 Shih-Chuan 1st Road, Kaohsiung City 807, Taiwan. Tel.: þ886 7 3121101x2692; fax: þ886 7 3227508. ** Corresponding author. E-mail address: [email protected] (C.-N. Tseng). 0890-8508/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mcp.2012.08.008

(Fig. 1B) [7]. Depending on the position of the edited sequence, the effects of A-to-I editing include re-coding of protein sequence, changing splicing signals, modifying RNA secondary structure and stability, as well as altering the specificity of miRNAs [8]. A-to-I editing plays common and essential roles in normal biological processes such as neural transmission, erythropoiesis, immune response and energy metabolism. The nervous system contains the highest mRNA inosine content and expresses the majority of the known editing targets [9]. Gria2 encoding an AMPA receptor subunit GluRB contains one of the most prevalent editing sites, the Q/R site. A-to-I editing of the Q/R site recodes the glutamine in the pore-forming reentrant loop to an arginine at greater than 99% efficiency [10]. Editing of the Q/R site regulates the targeting, unitary conductance, and calcium permeability of AMPA receptors, as well as their neuronal susceptibility to hypoxiainduced excitotoxicity [11e14]. Lack of Q/R site editing in ADAR2
/
mice results in progressive seizures and death shortly after birth

C.-N. Tseng et al. / Molecular and Cellular Probes 27 (2013) 38e45

39

Fig. 1. Identification of A-to-I editing target by I-specific cleavage. (A) ADAR catalyzes the deamination reaction that converts adenosine-to-inosine. (B) A to I editing changes the original A:U pairing to I:C pairing. (C) The stable modification of guanidines with glyoxal and borate makes guanine residues resistant to RNase T1 digestion leaving only inosines susceptible to RNase T1 cleavage.

[15]. Under-editing of GluR2 in spinal motor neurons was also found in human cases of sporadic amyotrophic lateral sclerosis [16]. Another canonical editing target, Htr2c, encodes the serotonin 5-HT2C receptor which contains five closely spaced editing sites that recode three amino acids on the cytoplasmic loop and modulate the downstream G protein signaling [17,18]. Certain editing combinations of this region greatly reduce the activity, potency and ligand affinity of the 5-HT2C receptor [18,19]. In suicide victims who had suffered from depression, the editing patterns had changed so that serotonin signaling was greatly dampened [20]. Abnormal editing of serotonin 2C receptor and the rate-limiting enzyme of serotonin synthesis, TPH2, may also be relevant to neuropsychiatric disease such as schizophrenia [21,22]. Recently, Gabra3 encoding the a3 subunit of the GABAA receptor was also found to be highly edited [23]. The editing recodes an isoleucine at the 4th transmembrane region (TM4) to methionine to about 90% in the adult brain and is evolutionarily conserved. The non-edited form is predominant at embryonic brain and displays higher sensitivity, fast activation, slow inactivation and outward rectifying chloride current, presumably promoting embryonic excitatory GABA responses critical for synapse formation at this developmental stage [24,25]. In addition, as in Gria2, editing of Gabra3 also controls the expression and subcellular localization of the protein by reducing both surface levels and total number of GABAA receptors [26]. ADAR1
/
knockout mice embryos die at E13.5 with a failure of erythropoiesis and widespread apoptosis [27e29], most likely due to unchecked activation of the interferon pathway that induces apoptosis of hematopoitic stem cells [30,31]. Endotoxin-induced microvascular lung injury and systematic inflammation dramatically increases ADAR1 expression, causing 5% of adenosines in the thymic mRNA to be edited to inosines in mice [32,33]. ADAR2 expression is increased by a high fat diet and reduced by fasting in the pancreatic islets in mice [34]. Ubiquitous over-expression of ADAR2 results in adult onset hyperphagia-mediated obesity [35]. No abnormality has been reported in ADAR3
/
mice yet [36]. Aberrant RNA A-to-I editing has also been implicated in human diseases and cancer development. ADAR1 mutations have been found in human cases of dyscromatosis symmetrica hereditaria [37,38]. Reduced A-to-I editing activity has been reported in human

brain, prostate, kidney and testis tumors [39]. Reductions of ADAR2 activity are correlated with the malignancy of glioblastoma multiforme and pediatric astrocytomas [40]. ADAR1 appears to play opposite roles in cancer progression. Elevated expression of ADAR1 in astrocytoma cells interferes with ADAR2-specific editing activity [41]. ADAR1 also accelerates cell cycle by up-regulating CDK2 in HEK293 cells [42]. Deciphering these roles of RNA A-to-I editing requires identifying the editing targets and the consequential changes in cellular functions. Experimental approaches that can systematically identify and analyze A-to-I editing sites are critical in the effort to elucidate the function of RNA A-to-I editing during development and disease. Various systematic screening methods have been applied in an attempt to comprehensively identify editing targets. For example, 16 editing target genes of Drosophila nervous system were identified by comparative genomics and found to participate in fast electrical and chemical neurotransmission [43]. A similar approach identified 4 evolutionarily conserved human editing targets, FLNA, BLCAP, CYFIP2 and IGFBP7 [44]. Among them, FLNA and CYFIP2 are involved in proper central nervous system function [44]. Moreover, bioinformatic analysis of the mismatches between genomic and expressed sequences identified a novel editing target, BC10, which is implicated in two forms of cancer [45]. In addition, microarray analysis of Drosophila brain RNAs pulled down by the anti-inosine immunoaffinity column revealed 7 novel editing targets including nAcRbeta-64B [46]. A method of I-specific cleavage has been developed to identify A-to I editing targets by specifically cutting the I-containing mRNAs [47,48]. In this method, guanidine nucleosides are modified by the formation of stable glyoxal/borate adducts and therefore protected from RNase T1 digestion, leaving only inosines vulnerable to nuclease attack (Fig. 1C). Using differential display techniques to analyze RNA samples subjected to I-specific cleavage, 5 and 19 new editing sites in Caenorhabditis elegans and human brain were identified, respectively [49,50]. Sakurai et al. devised a similar method called inosine chemical erasing (ICE) based on cyanoethylation of inosine followed by RT-PCR and sequencing [59]. Cyanoethylated inosines prevent cDNA synthesis and reduce the G signals of edited bases on the cDNA sequencing chromatogram.

40

C.-N. Tseng et al. / Molecular and Cellular Probes 27 (2013) 38e45

Here we report a method of identifying A-to-I editing sites by combining exon array analysis and I-specific cleavage (Fig. 2). Our results show that I-specific cleavage resulted in more than twofold signal reductions in edited exons of known target genes such as Gria2, Htr2c, Gabra3 and Cyfip2, suggesting that microarray analysis of I-specifically cleaved RNA can be used to analyze global editing pattern and to identify novel RNA A-to-I editing genes. This method provides an experimental approach of systematically analyzing RNA A-to-I editing targets with exon-level resolution. We believe this method can greatly facilitate inquiry into the roles of RNA A-to-I editing in various biological processes. 2. Materials and methods 2.1. Mouse brain RNA Brain total RNA was extracted from one-month-old male ICR mice. Each mouse whole brain was homogenized in 10 volumes of TrizolÒ (Invitrogen) by 20 strokes in a Dounce homogenizer. Total

RNA from each brain was then purified by following the TrizolÒ protocol and dissolved in 100 ml water. An additional extraction step using 1 ml TrizolÒ was performed to ensure complete removal of any residual lipids or proteins. 2.2. I-specific cleavage I-specific cleavage was carried out as described before [47] with minor modifications. Ten mg mouse brain RNA was glyoxylated in 100 ml of 10 mM sodium phosphate (pH 7.5), 50% DMSO and 0.6% deionized glyoxal at 37  C for 45 min. The RNA was further modified with borate by mixing with equal volume of 1 M sodium borate (pH 7.5), then precipitated with 500 ml ethanol and redissolved in 15 ml of 1 M sodium borate buffered with 10 mM Tris (pH 7.5). RNA was digested with RNase T1 (Ambion) at indicated amount at 37  C for 30 min. RNase T1 was then inactivated and removed by extraction with Trizol. The resulting RNA pellet was dissolved in 400 ml nucleasefree water and subjected to two rounds of NaOAc/ethanol precipitation and centrifugation (12,000 rpm, 15 min on a microcentrifuge) at

Fig. 2. Schematic strategy for exon array identification of RNA A-to-I editing targets. The example editing target gene contains three exons each of which is detected by one probe set on the exon array. I-specific cleavage at editing site in the second compromises the integrity of RNA template for downstream cDNA synthesis and reduces the amount of hybridization probes targeting the edited exons. As a result of I-specific cleavage, the probe set targeting the second exons displays signal reduction in exon array analysis. The fold change in signal intensity of each probe set is represented by a grey column whose width indicates the targeting region.

C.-N. Tseng et al. / Molecular and Cellular Probes 27 (2013) 38e45

room temperature to wash away borate. To remove glyoxal, the RNA pellet was resuspended in 400 ml of 10 mM sodium phosphate (pH 7.5) containing 50% DMSO and incubated at 60  C for 2 h. Finally, the RNA was precipitated by NaOAc/ethanol and dissolved in 10 ml of nuclease-free water. 2.3. Verification of I-specific cleavage on known editing targets with RT-PCR One-step RT-PCR was performed using SuperScriptÒ III OneStep RT-PCR System with PlatinumÒ Taq (Invitrogen) with 10 ng RNA templates and 40 amplification cycles. Primers designed to cover the known editing sites of the mouse nervous system were as follows: Gria2 forward, 50 TGGACTTATATGAGGAGTGCAG30 ; Gria2 reverse, 50 GGATGTAGAATACTCCAGCAAC30 ; Htr2c forward, 50 GTCC CTAGCCATTGCTGATATG30 ; Htr2c reverse, 50 GCTTTCGTCCCTCAGT CCAATC30 ; Kcna1 forward, 50 GGGTCATCCGCTTGGTAAGG30 ; Kcna1 reverse, 50 CACTATCGGCAATGAGCGGTTCC30 , for negative controls of I-specific cleavage: b-actin forward, 50 CACTATCGGCAATGA GCGGTTCC30 ; b-actin reverse, 50 TGCATCCTGTCAGCAATGCCTG30 Gapdh forward, 50 GCACAGTCAAGGCCGAGAAT30 ; Gapdh reverse: 50 GCCTTCTCCATGGTGGTGAA30 . 2.4. Synthesis and amplification of double-stranded cDNA Double-stranded cDNA was synthesized from 200 ng total RNA and amplified by using Microarray Target Amplification Kit (Roche Applied Science). First and second strand cDNA was synthesized by using TAS-T7 Oligo(dT)24 primer and TAS-(dN)10 primer, respectively, resulting in ds-cDNA with TAS tags on both ends. The dscDNA was purified by Microarray Target Purification Kit. Onequarter of the purified product was used as the template for a 100 ml PCR reaction that underwent 21 cycles of amplification. 2.5. Exon array analysis Probe preparation, hybridization and image acquisition for Mouse Exon 1.0ST Arrays were carried out by the Affymetrix Gene

41

Expression Service Lab of Academica Sinica (http://ipmb.sinica. edu.tw/affy/). For each array, 10 mg mouse brain total RNAs recovered from I-specific cleavage or mock digestion with both 260/230 and 260/280 ratios over 2.0 were submitted. The chip images of exon arrays were processed by Affymetrix Expression Console and the probe set signals were further normalized and compared using dCHIP [51]. Fold change (FC) is defined as follows: fold increase after I-specific cleavage (T1 > NT), FC ¼ (T1
NT)/NT; fold reduction after I-specific cleavage (T1 < NT), FC ¼ (T1
NT)/ T1 where T1 and NT are expression value of RNA sample subjected to I-specific cleavage or mock digestion, respectively. Targeting sequences for probe sets were retrieved from NetAffixÔ Analysis center (http://www.affymetrix.com/analysis/index.affx).

3. Results 3.1. Glyoxal/borate modification of RNA and I-specific cleavage The I-specific cleavage protocol consists of three major steps: 1) modification of G with glyoxal and borate, 2) RNase T1 cleavage of inosine, and 3) removal of RNase T1, borate and glyoxal. The exposure of RNA to high concentrations of salt, heat, and nuclease during the process makes it difficult to recover high quality RNA that meets the requirements for microarray analysis. The quality and correct pH of glyoxal have been reported to be critical for the protocol [52]. We found a few minor adjustments necessary to further increase the yield and purity of the final product. Removing borate and glyoxal in two separate steps and performing multiple rounds of room temperature ethanol precipitation enhanced the removal of modifiers. To examine the efficiency of G-modification and the removal of borate and glyoxal, aliquots of RNA subjected to mock digestion were removed at different steps and analyzed by electrophoresis. The major bands of 18s and 28s rRNAs became single-stranded and difficult to be visualized by EtBr staining due to denaturation by glyoxal (Fig. 3A, lanes 1 and 2), and migrated slower after the additional modification by borate (Fig. 3A, lane 3). After removing borate and glyoxal, the two rRNA bands reappeared in about the same position but diffused, likely due to random

Fig. 3. I-specific cleavage of mouse brain RNA. (A) Glyoxal/borate modification of mouse brain total RNA. Aliquots of RNAs at different steps of the glyoxal/borate modification procedure were analyzed by 1% agarose gel electrophoresis. Lane 1: mouse brain total RNA; lane 2: total RNA denatured by glyoxal; lane 3: total RNA denatured by glyoxal and further modified with borate; lane 4: total RNA after the removal of borate and glyoxal. (B) RNase T1 cleavage of mouse brain RNA modified with glyoxal and borate slightly lowered the size distribution of RNA. (C) RT-PCR verification of I-specific cleavage of Gria2, Htr2c and Kcna1. The three known A-to-I editing targets showed clear reduction of RT-PCR products after I-specific cleavage but not the two housekeeping genes b-actin and Gapdh. (D)The total RNA subjected to I-specific cleavage or mock cleavage was reverse transcribed into cDNA and amplified by PCR. The resulting ds-cDNAs were resolved on a 1% agarose gel and showed an even distribution between 500 bp and 3 kb.

42

C.-N. Tseng et al. / Molecular and Cellular Probes 27 (2013) 38e45

duplex formation during renaturation (Fig. 3A, lane 4). In addition, the removal of RNase T1 after I-specific cleavage was simplified by using a single step of Trizol purification instead of proteinase K digestion followed by phenol extraction as stated in the original protocol [47]. The borate/glyoxal modification did not affect the recovery of RNA from Trizol extraction. I-specific cleavage with 1000 U RNase T1 slightly reduced the overall size of mouse brain mRNA compared to mock-digested RNA that simply went through modification and de-modification (Fig. 3B), indicating the modification on G residues effectively protected un-edited targets from RNase T1 digestion. We routinely recovered 50e80% of the starting RNAs with both 260/280 and 260/230 ratios above 1.9 at the end of I-specific cleavage protocol. The specific cleavage of known ADAR editing targets was verified by one-step RT-PCR using primers designed to cover the editing sites of each gene. With I-specific cleavage, no RT-PCR products were detected in highly edited genes such as Gria2 and Htr2c. In the case of Kcna1, which contains a single editing site with about 50% editing efficiency [53], the band of RT-PCR product was faint but still visible, whereas b-actin and GAPDH did not show any clear difference after I-specific cleavage (Fig. 3C). These results indicate the RNase T1 cleavage was specific to inosine-containing RNA. We further examined the efficiency of cDNA synthesis using the RNA subjected to I-specific cleavage as the template to ensure that the RNA samples were suitable for molecular biology manipulations. cDNAs reverse transcribed from I-specifically cleaved RNA were amplified by PCR as described in Materials and methods so their length distributions can be assessed by agarose gel electrophoresis. Both cleaved RNA and control mock-digested RNA yielded ds-cDNAs evenly distributed between 300 bp and 3 kb (Fig. 3D), indicating the quality of the RNA was acceptable for molecular biology reactions of the downstream microarray analysis.

3.2. Exon array analysis of I-specifically cleaved RNA During our first attempts at exon array analysis, we found that hybridization probes generated from cleaved RNAs were insufficient and shorter than the quality control requirements of exon array analysis as suggested by the manufacturer. Further optimization of the I-specific cleavage protocol by reducing the amount of RNase T1 from 1000 U to 100 U made the quality of downstream products of each step of probe synthesis acceptable, yielding 1st cycle cRNAs of about 300 nt and final ssDNA probes of about 70 nt. Results of three pairs of Mouse Exon 1.0ST Arrays using total RNAs extracted from the brains of three male ICR mice were analyzed as described in materials and methods. The I-specific cleavageinduced fold reductions of the probe set signals were calculated by dCHIP. The probe set signals for five known editing targets (Htr2C, Gria2, Gabra3, Cyfip2 and Kcna1) and a none-editing gene b-actin are plotted according to the targeting regions of each probe set (Fig. 4). Although the amount of RNase T1 had been reduced to improve the production of hybridization probes, prominent reductions of signals were still seen in the probe sets targeting the known editing sites or the adjacent regions. More than twofold reductions were seen in edited exons of Htr2c (7.14-fold reduction, Fig. 4A), Gria2 (Q/R site, 2.26 and 2.48 fold reductions in two closely situated probe sets, Fig. 4B), Gabra3 (2.12-fold reduction, Fig. 4D), and Cyfip2 (2.57-fold reduction, Fig. 4E). The R/G site of Gria2 and the editing site of Kcna1 did not show clear reductions of signals (Fig. 4B and D). It may be due to their relatively lower editing frequencies. In addition, the nearest probe sets of these two editing sites cover much larger regions and the averaged signals probably therefore fail to reflect the local reductions on these editing sites. The un-edited b-actin showed no obvious changes after I-specific cleavage as expected (Fig. 4F). Since Gria2, Htr2c and Knca1 had been checked by RT-PCR for successful I-specific cleavage before

Fig. 4. I-specific cleavage reduces signals of probe sets that target regions containing known editing sites in exon array analysis. Mouse brain RNA subjected to I-specific cleavage with or without RNase T1 was compared by using the mouse exon 1.0ST Array. The averaged fold changes of probe set signals of (A) Gria2, (B) Htr2c, (C) Gabra3, (D) Cyfip2, (E) Kcna1 and (F) Actb are presented. The open bar on the horizontal axis represents the full-length cDNA whose gene symbol, accession number and cDNA length are labeled at the top of each panel. The result of each probe set is shown by a grey column, whose height represents the mean change of signal intensities caused by I-specific cleavage. The targeting areas of each probe set are not of uniform length and are indicated by the widths of these grey columns. The 90% confidence intervals of fold change are indicated by error bars. The editing sites of Htr2c (located within 12,157e12,169 nt), Gabra3 (at 1301 nt) Kcna1 (at 3276 nt) and Cyfip2 (at 1107 nt) are marked by “I” and the two editing sites of Gria2 are indicated by Q/R and R/G (at 2526 nt and 2781 nt), respectively. In general, probe sets targeting the editing sites reported more than 2-fold signal reductions, with the exceptions in Kcna1 and the R/G site of Gria2. The actual values of the fold change of each probe set and the alignment of probe set targeting regions with the cDNA fragments are provided in the online supplementary material.

C.-N. Tseng et al. / Molecular and Cellular Probes 27 (2013) 38e45

the submission of RNA samples to exon array analysis in this study, they are expected to show clear reductions of signals. Other two known editing targets identified by this screening, Gabra3 and Cyfip2, were not included in the quality control. Correct identification of these editing targets by this screening therefore suggests that other target exons of I-specific cleavage can also be identified by this method. Based on the results of Fig. 4, we then filtered the core exons with the following criteria to estimate the number of edited exons: (1) the exon showed more than twofold reductions after I-specific cleavage and (2) the signal difference was higher than 100. The twofold criterion was tentative, chosen based on the results of known editing sites (see Fig. 4) in order to provide a preliminary estimate of the number of highly edited targets. It was not intended to be used as a well-tested criterion for distinguishing editing and non-editing sites. The full potential of this method shall be achieved by further optimization of the data analysis process, such as using signals from individual probes, and proper criteria will then be determined using results from large scale verification. In total, 949 exons satisfied the filtering criteria. Among them, the previously known editing targets rank from 55 to 865 in descending order of fold reduction (Fig. 5). Five of these 949 exons were arbitrarily chosen for further verification by RT-PCR using specific primers for each exon. I-specific cleavage reduced the amount of RT-PCR products in 4 of the 5 exons tested (Fig. 6, EC1-3 and 5). These results suggest that a large portion of the 949 exons contain editing sites. 4. Discussion RNA A-to-I editing plays important roles in numerous biological processes. Identification of the editing targets is critical for understanding the underlying molecular events regulated by RNA

43

Fig. 6. Verification of candidate RNA A-to-I editing exons. Five of the 949 candidate exons were selected for RT-PCR verification with primer pairs designed to amplify each exon using mouse brain RNA subjected to I-specific cleavage or mock digestion as templates. I-specific cleavage reduced the RT-PCR products for all but one (EC4) potential editing targets (For reference, the fold changes of signal intensity reported by the exon array analysis are
3.11,
2.72,
3.12,
3.56 and
2.22 for EC1-5, respectively.). EC, editing candidates; N, mock cleavage with no RNase T1; T, I-specific cleavage with RNase T1.

editing. Experimental and systematic methods are required to search comprehensively for editing events that are specific to particular tissue, certain stages of development, and pathogenesis of unique types of disease or cancer. Our method can achieve these goals by applying I-specific cleavage and exon array analysis to identify inosine-containing exons. It can be used to profile genomewide editing patterns or to search for novel editing sites. Our data demonstrate that targets of I-specific cleavage can be identified by exon array analysis. Known editing targets such as Gria2, Htr2c, Gabra3 and Cyfip2 showed reductions of signal intensities in edited exons after I-specific cleavage. In total, our analysis of mouse brain RNA filtered out 949 exons as potential editing targets. A-to-I editing has been shown to play a role in unwinding RNA duplex structures formed by inverted repeats [50,54]. We compared our list of 949 exons with the list of 833 mouse editing sites within repeats (http://www.tau.ac.il/welieis/

Fig. 5. Scatter plot of the log-transformed signal intensities of the 949 editing candidates. Editing candidates are represented by probe sets reporting higher than twofold reductions after I-specific cleavage and more than 100 in signal difference. The data points from the five known editing targets are indicated by their gene symbols and their ranks among the 949 editing candidates (numbered in descending order of fold reduction) are shown in parentheses. Thresholds for 2- and 5-fold reductions are marked by the solid and dashed lines, respectively.

44

C.-N. Tseng et al. / Molecular and Cellular Probes 27 (2013) 38e45

mouse_editing/ [54]) and found no overlap. It remains to be determined whether it is because most probes of exon array are designed to avoid repeated sequences, or if it is due to the low editing levels in these repeat sequences. It has been anticipated that the mammalian nervous system contains many not-yet identified editing targets. A systematic screening of Drosophila A-to-I editing targets applying comparative genomics identified 16 editing targets [53]. Surprisingly, all of them participate in electrical or chemical transmission in the nervous system. Most of these editing events take place in the highly conserved coding sequences (CDS) that are critical for protein functions, and therefore are believed to play critical roles in regulating the nervous system function of Drosophila. In contrast, a relatively low percentage of the human editing sites identified so far are located in the CDS. The most up-todate database of human RNA A-to-I editing sites, named DARNED (http://darned.ucc.ie), includes a total of 42,052 editing sites, 6918 of which are in transcribed regions and 437 sites are located in the CDS [55]. And aside from a few known canonical nervous system editing targets, how extensively the mammalian nervous system is regulated by RNA A-to-I editing is still unknown. Methods using 30 IVT expression microarrays to identify potential editing mRNAs pulled down by anti-ADAR or anti-inosine antibody have been reported before [46,56]. Thorough, full-length cDNA sequencing of the candidate transcripts identified by these methods is required to identify the editing sites within the transcripts. Because the exon arrays used in our method have higher resolution, users will only need to focus their efforts of identifying editing sites within the candidate exons, making verification of editing targets relatively easier. How strongly the I-specific cleavage reduces the signal of the Icontaining exon may depend on editing frequency, number of editing sites within this exon, distance of the editing site to the probe set sequence, as well as degrees of RNase T1 digestion. The power of this method is limited by the fact that certain probe sets of the exon array used in this study cover long stretches of sequences and consequently are less sensitive to localized signal changes on individual editing sites. For example, the R/G site of Gria2 and the editing site of Kcna1 are detected by probe sets longer than 1 kb and failed to show significant reductions of signals. We are exploring alternative analysis methods by analyzing the signal of each probe instead of the combined signal of a probe set. We anticipate it will further increase the sensitivity and resolution of the detecting power, thus unveiling a great number of exonic editing sites in the future. Additional enhancement of the method may also be achieved by engineering RNase T1 to redirect its specificity toward inosine. RNase T1 has been shown to be amenable to directed mutagenesis that alters its nucleotide specificity [57]. Using an I-specific RNase T1 will surely eliminate the trouble of modification and greatly improve the quality of RNA for microarray analysis. As an attempt at preliminary verification, we selected a limited number of sites that showed strong signal reduction after I-specific cleavage for preliminary verification. The results suggest that, using conventional exon array analysis procedure, highly edited exons can readily be identified. However, this method is not necessarily limited only to the detection of highly edited targets. The sensitivity of this method must be tested using optimized data analysis protocol and large scale verification. Our results show that I-specific cleavage combined with exon array analysis makes it possible to simultaneously profile a large number of exonic editing sites. Recently, Li et al. used massively parallel target capture and DNA sequencing method to sequence 36,208 computationally predicted A-to-I editing sites within the non-repetitive regions of the human genome, identifying 239 sites in 207 genes, including 10 previously known editing targets [58]. Of those sites, 53 were located in CDS and 38 resulted in changes of amino acid sequences. In addition, Sakurai et al., using the ICE-

based RT-PCR and sequencing method, selected 642 regions of human cDNA for analysis and found 4395 new A-to-I editing sites including 37 sites within the CDS regions [59]. These recent discoveries demonstrate the power of systematic experimental methods in identifying new editing targets, and suggest that there are still many editing sites in the human genome to be discovered [60]. We believe the addition of our method to current techniques will greatly accelerate the speed of inventorying all editing sites. It can be used to select candidate editing targets which can then be analyzed in detail using high resolution methods such as tiling arrays or deep sequencing. Our method also provides a novel strategy for simultaneous analysis of the dynamic pattern of the whole RNA “editome”. Acknowledgements We are grateful to Drs. Chung-Yu Lan and Wei-Yuan Chou for helpful comments. Affymetrix GeneChip assays were performed by the Affymetrix Gene Expression Service Lab (http://ipmb.sinica. edu.tw/affy/), supported by Academia Sinica. This work was supported in part by Kaohsiung Medical University Research Foundation under the grants KMU-M100001, KMU110010 (to C.N.T.), NSYSU-KMU Joint Research Project #NSYSUKMU 101-02 (to C.N.T. & C.L.C.), KMU-EM-99-1.4 (to H.W.C.); and by the Department of Health, Executive Yuan, R.O.C. (TAIWAN) under the grant DOH100TD-C-111-002 (to C.N.T.). Appendix A. Supplementary material Supplementary material associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.mcp. 2012.08.008. References [1] Bass BL. How does RNA editing affect dsRNA-mediated gene silencing? Cold Spring Harb Symp Quant Biol 2006;71:285e92. [2] Bass BL, Weintraub H. An unwinding activity that covalently modifies its double-stranded RNA substrate. Cell 1988;55:1089e98. [3] Wagner RW, Smith JE, Cooperman BS, Nishikura K. A double-stranded RNA unwinding activity introduces structural alterations by means of adenosine to inosine conversions in mammalian cells and Xenopus eggs. Proc Natl Acad Sci U S A 1989;86:2647e51. [4] Kim U, Wang Y, Sanford T, Zeng Y, Nishikura K. Molecular cloning of cDNA for double-stranded RNA adenosine deaminase, a candidate enzyme for nuclear RNA editing. Proc Natl Acad Sci U S A 1994;91:11457e61. [5] Kim U, Garner TL, Sanford T, Speicher D, Murray JM, Nishikura K. Purification and characterization of double-stranded RNA adenosine deaminase from bovine nuclear extracts. J Biol Chem 1994;269:13480e9. [6] Chen CX, Cho DS, Wang Q, Lai F, Carter KC, Nishikura K. A third member of the RNA-specific adenosine deaminase gene family, ADAR3, contains both singleand double-stranded RNA binding domains. RNA 2000;6:755e67. [7] Basilio C, Wahba AJ, Lengyel P, Speyer JF, Ochoa S. Synthetic polynucleotides and the amino acid code. V. Proc Natl Acad Sci U S A 1962;48:613e6. [8] Nishikura K. Editor meets silencer: crosstalk between RNA editing and RNA interference. Nat Rev Mol Cell Biol 2006;7:919e31. [9] Paul MS, Bass BL. Inosine exists in mRNA at tissue-specific levels and is most abundant in brain mRNA. EMBO J 1998;17:1120e7. [10] Sommer B, Kohler M, Sprengel R, Seeburg PH. RNA editing in brain controls a determinant of ion flow in glutamate-gated channels. Cell 1991;67:11e9. [11] Hume RI, Dingledine R, Heinemann SF. Identification of a site in glutamate receptor subunits that controls calcium permeability. Science 1991;253: 1028e31. [12] Burnashev N, Monyer H, Seeburg PH, Sakmann B. Divalent ion permeability of AMPA receptor channels is dominated by the edited form of a single subunit. Neuron 1992;8:189e98. [13] Peng PL, Zhong X, Tu W, Soundarapandian MM, Molner P, Zhu D, et al. ADAR2dependent RNA editing of AMPA receptor subunit GluR2 determines vulnerability of neurons in forebrain ischemia. Neuron 2006;49:719e33. [14] Liu S, Lau L, Wei J, Zhu D, Zou S, Sun HS, et al. Expression of Ca(2þ)-permeable AMPA receptor channels primes cell death in transient forebrain ischemia. Neuron 2004;43:43e55.

C.-N. Tseng et al. / Molecular and Cellular Probes 27 (2013) 38e45 [15] Higuchi M, Maas S, Single FN, Hartner J, Rozov A, Burnashev N, et al. Point mutation in an AMPA receptor gene rescues lethality in mice deficient in the RNA-editing enzyme ADAR2. Nature 2000;406:78e81. [16] Kawahara Y, Ito K, Sun H, Aizawa H, Kanazawa I, Kwak S. Glutamate receptors: RNA editing and death of motor neurons. Nature 2004;427:801. [17] Burns CM, Chu H, Rueter SM, Hutchinson LK, Canton H, Sanders-Bush E, et al. Regulation of serotonin-2C receptor G-protein coupling by RNA editing. Nature 1997;387:303e8. [18] Price RD, Weiner DM, Chang MS, Sanders-Bush E. RNA editing of the human serotonin 5-HT2C receptor alters receptor-mediated activation of G13 protein. J Biol Chem 2001;276:44663e8. [19] Niswender CM, Copeland SC, Herrick-Davis K, Emeson RB, Sanders-Bush E. RNA editing of the human serotonin 5-hydroxytryptamine 2C receptor silences constitutive activity. J Biol Chem 1999;274:9472e8. [20] Niswender CM, Herrick-Davis K, Dilley GE, Meltzer HY, Overholser JC, Stockmeier CA, et al. RNA editing of the human serotonin 5-HT2C receptor. alterations in suicide and implications for serotonergic pharmacotherapy. Neuropsychopharmacology 2001;24:478e91. [21] Schmauss C. Regulation of serotonin 2C receptor pre-mRNA editing by serotonin. Int Rev Neurobiol 2005;63:83e100. [22] Grohmann M, Hammer P, Walther M, Paulmann N, Buttner A, Eisenmenger W, et al. Alternative splicing and extensive RNA editing of human TPH2 transcripts. PLoS One 2010;5:e8956. [23] Ohlson J, Pedersen JS, Haussler D, Ohman M. Editing modifies the GABA(A) receptor subunit alpha3. RNA 2007;13:698e703. [24] Rula EY, Lagrange AH, Jacobs MM, Hu N, Macdonald RL, Emeson RB. Developmental modulation of GABA(A) receptor function by RNA editing. J Neurosci 2008;28:6196e201. [25] Nimmich ML, Heidelberg LS, Fisher JL. RNA editing of the GABA(A) receptor alpha3 subunit alters the functional properties of recombinant receptors. Neurosci Res 2009;63:288e93. [26] Daniel C, Wahlstedt H, Ohlson J, Bjork P, Ohman M. A-to-I RNA editing affects trafficking of the {gamma}-aminobutyric acid type A (GABAA) receptor. J Biol Chem 2010. [27] Hartner JC, Schmittwolf C, Kispert A, Muller AM, Higuchi M, Seeburg PH. Liver disintegration in the mouse embryo caused by deficiency in the RNA-editing enzyme ADAR1. J Biol Chem 2004;279:4894e902. [28] Wang Q, Khillan J, Gadue P, Nishikura K. Requirement of the RNA editing deaminase ADAR1 gene for embryonic erythropoiesis. Science 2000;290:1765e8. [29] Wang Q, Miyakoda M, Yang W, Khillan J, Stachura DL, Weiss MJ, et al. Stressinduced apoptosis associated with null mutation of ADAR1 RNA editing deaminase gene. J Biol Chem 2004;279:4952e61. [30] XuFeng R, Boyer MJ, Shen H, Li Y, Yu H, Gao Y, et al. ADAR1 is required for hematopoietic progenitor cell survival via RNA editing. Proc Natl Acad Sci U S A 2009;106:17763e8. [31] Iizasa H, Nishikura K. A new function for the RNA-editing enzyme ADAR1. Nat Immunol 2009;10:16e8. [32] Rabinovici R, Kabir K, Chen M, Su Y, Zhang D, Luo X, et al. ADAR1 is involved in the development of microvascular lung injury. Circ Res 2001;88:1066e71. [33] Yang JH, Luo X, Nie Y, Su Y, Zhao Q, Kabir K, et al. Widespread inosinecontaining mRNA in lymphocytes regulated by ADAR1 in response to inflammation. Immunology 2003;109:15e23. [34] Gan Z, Zhao L, Yang L, Huang P, Zhao F, Li W, et al. RNA editing by ADAR2 is metabolically regulated in pancreatic islets and beta-cells. J Biol Chem 2006; 281:33386e94. [35] Singh M, Kesterson RA, Jacobs MM, Joers JM, Gore JC, Emeson RB. Hyperphagia-mediated obesity in transgenic mice misexpressing the RNA-editing enzyme ADAR2. J Biol Chem 2007;282:22448e59. [36] Nishikura K. Functions and regulation of RNA editing by ADAR deaminases. Annu Rev Biochem 2010;79:321e49. [37] Xing Q, Wang M, Chen X, Qian X, Qin W, Gao J, et al. Identification of a novel ADAR mutation in a Chinese family with dyschromatosis symmetrica hereditaria (DSH). Arch Dermatol Res 2005;297:139e42.

45

[38] Miyamura Y, Suzuki T, Kono M, Inagaki K, Ito S, Suzuki N, et al. Mutations of the RNA-specific adenosine deaminase gene (DSRAD) are involved in dyschromatosis symmetrica hereditaria. Am J Hum Genet 2003;73:693e9. [39] Paz N, Levanon EY, Amariglio N, Heimberger AB, Ram Z, Constantini S, et al. Altered adenosine-to-inosine RNA editing in human cancer. Genome Res 2007;17:1586e95. [40] Maas S, Patt S, Schrey M, Rich A. Underediting of glutamate receptor GluR-B mRNA in malignant gliomas. Proc Natl Acad Sci U S A 2001;98:14687e92. [41] Cenci C, Barzotti R, Galeano F, Corbelli S, Rota R, Massimi L, et al. Downregulation of RNA editing in pediatric astrocytomas: ADAR2 editing activity inhibits cell migration and proliferation. J Biol Chem 2008;283:7251e60. [42] Zhang F, Rabinovici R. Adenosine deaminase acting on RNA 1 accelerates cell cycle through increased translation and activity of cyclin-dependent kinase 2. Shock 2007;27:214e9. [43] Hoopengardner B, Bhalla T, Staber C, Reenan R. Nervous system targets of RNA editing identified by comparative genomics. Science (New York, NY) 2003; 301:832e6. [44] Levanon EY, Hallegger M, Kinar Y, Shemesh R, Djinovic-Carugo K, Rechavi G, et al. Evolutionarily conserved human targets of adenosine to inosine RNA editing. Nucl Acids Res 2005;33:1162e8. [45] Clutterbuck DR, Leroy A, O’Connell MA, Semple CA. A bioinformatic screen for novel A-I RNA editing sites reveals recoding editing in BC10. Bioinformatics (Oxford, England) 2005;21:2590e5. [46] Xia S, Yang J, Su Y, Qian J, Ma E, Haddad GG. Identification of new targets of Drosophila pre-mRNA adenosine deaminase. Physiol Genomics 2005;20:195e 202. [47] Morse DP, Bass BL. Detection of inosine in messenger RNA by inosine-specific cleavage. Biochemistry 1997;36:8429e34. [48] Broude NE, Budowsky EI. The reaction of glyoxal with nucleic acid components. 3. Kinetics of the reaction with monomers. Biochim Biophys Acta 1971; 254:380e8. [49] Morse DP, Bass BL. Long RNA hairpins that contain inosine are present in Caenorhabditis elegans poly(A)þ RNA. Proc Natl Acad Sci U S A 1999;96: 6048e53. [50] Morse DP, Aruscavage PJ, Bass BL. RNA hairpins in noncoding regions of human brain and Caenorhabditis elegans mRNA are edited by adenosine deaminases that act on RNA. Proc Natl Acad Sci U S A 2002;99:7906e11. [51] Li C, Wong WH. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci U S A 2001;98: 31e6. [52] Morse DP. Identification of substrates for adenosine deaminases that act on RNA. Meth Mol Biol (Clifton, NJ) 2004;265:199e218. [53] Hoopengardner B, Bhalla T, Staber C, Reenan R. Nervous system targets of RNA editing identified by comparative genomics. Science 2003;301:832e6. [54] Neeman Y, Levanon EY, Jantsch MF, Eisenberg E. RNA editing level in the mouse is determined by the genomic repeat repertoire. RNA 2006;12:1802e9. [55] Kiran A, Baranov PV. DARNED: a database of RNA editing in humans. Bioinformatics 2010;26:1772e6. [56] Ohlson J, Enstero M, Sjoberg BM, Ohman M. A method to find tissue-specific novel sites of selective adenosine deamination. Nucl Acids Res 2005;33:e167. [57] Struhalla M, Czaja R, Hahn U. Addressing the challenge of changing the specificity of RNase T1 with rational and evolutionary approaches. Chembiochem 2004;5:200e5. [58] Li JB, Levanon EY, Yoon JK, Aach J, Xie B, Leproust E, et al. Genome-wide identification of human RNA editing sites by parallel DNA capturing and sequencing. Science 2009;324:1210e3. [59] Sakurai M, Yano T, Kawabata H, Ueda H, Suzuki T. Inosine cyanoethylation identifies A-to-I RNA editing sites in the human transcriptome. Nat Chem Biol 2010;6:733e40. [60] Li M, Wang IX, Li Y, Bruzel A, Richards AL, Toung JM, et al. Widespread RNA and DNA sequence differences in the human transcriptome. Science (New York, NY) 2011;333:53e8.