A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes

Article

A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes Graphical Abstract

Authors Yitai An, Gang Wang, Yarui Diao, ..., Hao Sun, Huating Wang, Zhenguo Wu

Correspondence [email protected]

In Brief An, Wang, Diao et al. show that the MyoD/ Myf5-E2F4/p107/p130 axis functions as a molecular switch in the Pax7+ embryonic progenitor cells or postnatal myoblasts to regulate the choice between myoblast and brown adipocyte cell fate. Turning off this switch transcriptionally upregulates Prdm16 and promotes the formation of brown adipocytes.

Highlights d

Deletion of Pax7 in muscle progenitor cells (MPCs) promotes brown fat development

d

Knockdown of MyoD or Myf5 in MPCs promotes a cell fate change to brown adipocytes

d

MyoD/Myf5 transcriptionally repress Prdm16 in MPCs via E2F4/pocket proteins

d

E2F4/pocket proteins directly bind and repress Prdm16

An et al., 2017, Developmental Cell 41, 382–391 May 22, 2017 ª 2017 Elsevier Inc. http://dx.doi.org/10.1016/j.devcel.2017.04.012

Developmental Cell

Article A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes Yitai An,1,3 Gang Wang,1,3 Yarui Diao,1,3,4 Yanyang Long,1 Xinrong Fu,1 Mingxi Weng,1 Liang Zhou,2 Kun Sun,2 Tom H. Cheung,1 Nancy Y. Ip,1 Hao Sun,2 Huating Wang,2 and Zhenguo Wu1,5,* 1Division of Life Science, Center for Stem Cell Research, Center of Systems Biology and Human Health, State Key Laboratory in Molecular Neuroscience, Hong Kong University of Science & Technology, Clearwater Bay, Kowloon, Hong Kong, China 2Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong, Hong Kong, China 3These authors contributed equally 4Present address: Ludwig Institute for Cancer Research, University of California, San Diego, La Jolla, CA 92093-0653, USA 5Lead Contact *Correspondence: [email protected] http://dx.doi.org/10.1016/j.devcel.2017.04.012

SUMMARY

During mouse embryo development, both muscle progenitor cells (MPCs) and brown adipocytes (BAs) are known to derive from the same Pax7+/ Myf5+ progenitor cells. However, the underlying mechanisms for the cell fate control remain unclear. In Pax7-null MPCs from young mice, several BA-specific genes, including Prdm16 and Ucp1 and many other adipocyte-related genes, were upregulated with a concomitant reduction of Myod and Myf5, two muscle lineage-determining genes. This suggests a cell fate switch from MPC to BA. Consistently, freshly isolated Pax7-null but not wild-type MPCs formed lipid-droplet-containing UCP1+ BA in culture. Mechanistically, MyoD and Myf5, both known transcription targets of Pax7 in MPC, potently repress Prdm16, a BA-specific lineagedetermining gene, via the E2F4/p107/p130 transcription repressor complex. Importantly, inducible Pax7 ablation in developing mouse embryos promoted brown fat development. Thus, the MyoD/Myf5E2F4/p107/p130 axis functions in both the Pax7+/ Myf5+ embryonic progenitor cells and postnatal myoblasts to repress the alternative BA fate.

INTRODUCTION In multicellular organisms, different progenitor cells generate multiple distinct cell lineages in a precisely controlled temporal and spatial manner, which ultimately forms different types of adult tissues. Although different cell types of an organism all contain the same genome and express a common set of housekeeping genes, each distinct cell type also uniquely expresses a subset of genes that are characteristic of that particular cell type. Both transcriptional and epigenetic regulation contributes to differential gene expression in distinct cell lineages. Expres-

sion of certain lineage-determining transcription factors in progenitor cells is often associated with the cell fate choices. The development of multiple cell lineages (e.g., B and T lymphocytes) from the same hematopoietic stem cells exemplifies how this is achieved during hematopoiesis (Orkin and Zon, 2008). Mammalian skeletal muscles and fat tissues are two distinct types of tissues with very different cellular compositions and morphologies, anatomical locations, transcriptome profiles, and physiological functions. While skeletal muscles can be grouped into slow and fast muscles, fat tissues can be subdivided into white, beige, and brown fat (Peirce et al., 2014; Schiaffino and Reggiani, 2011). Interestingly, by lineage-tracing experiments, it has been shown that brown adipocytes (BAs), skeletal muscle cells, and dorsal dermal cells all derive from the Engrailed 1+/Pax7+ multi-potential progenitor cells that originate from the central dermomyotome (Atit et al., 2006; Ben-Yair and Kalcheim, 2005; Lepper and Fan, 2010). Pax7 is a homeodomain- and paired-domain-containing transcription factor (Buckingham and Relaix, 2015; Christ et al., 2007; Kalcheim, 2015). While Pax7 ceases to be expressed in either dermal cells or BAs (Lepper and Fan, 2010), it continues to be expressed in both proliferative muscle progenitor cells (MPCs, defined as Pax7+/MyoD+ cells) in embryonic and young postnatal muscles and the quiescent muscle satellite cells (MuSC, defined as Pax7+/MyoD
cells) in adult muscles (Buckingham and Relaix, 2015; Christ et al., 2007; Kalcheim, 2015; Yin et al., 2013a). In addition, the lineage-tracing studies also revealed that both BAs and skeletal muscle cells derive from progenitor cells that express Myf5, one of the four muscle-specific lineage-determining genes for myogenesis that also include Myod (Seale et al., 2008; Tapscott, 2005). In contrast, both white and beige adipocytes are thought to derive mainly from the Myf5
progen€hbeck et al., 2009; Harms and Seale, 2013; Kajimura itors (Fru et al., 2010; Peirce et al., 2014). Among the three types of adipocytes, brown and beige adipocytes are unique in that they can dissipate the chemical energy generated in mitochondria via fat and sugar metabolism to produce heat instead of ATP. Therefore, they play key roles in regulating the energy balance and have been intensively studied

382 Developmental Cell 41, 382–391, May 22, 2017 ª 2017 Elsevier Inc.

Figure 1. Inducible Deletion of Pax7 in MPCs Resulted in Upregulation of Multiple Brown Adipocyte-Related Genes and a Cell Fate Change to Brown Adipocytes in Culture (A) Experimental scheme for (B) and (C). (B) MPCs were isolated from P12 Pax7CreER/+ (control) and Pax7CreER/flox (KO) mice and cultured for 2 days before harvest. Total RNAs were isolated and subjected to RNA-seq. Selected genes with differential expression levels in MPCs from the control and Pax7-KO mice are shown. (C) MPCs from the control and Pax7-KO mice were isolated by FACS and cultured in growth media for 36 hr. The relative expression of selected genes was measured by qRT-PCR. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001. (D) Experimental scheme for (E) and (F). MPCs were isolated by FACS from P21 Pax7CreER/+: Rosa-stop-YFP (control) and Pax7CreER/flox:Rosastop-YFP (KO) mice. (E and F) Cells were cultured in the pro-adipogenic media for 5 days followed by oil red O staining (E) or UCP1 immunostaining (F). In (F), the right panels are enlarged images of the areas in the white boxes in the left panels. Scale bars, 50 mm.

in recent years due to their potentials in therapies against obesity and type 2 diabetes (Harms and Seale, 2013; Kajimura et al., 2010; Peirce et al., 2014). As both Pax7 and Myf5 are co-expressed in a majority of MPC/MuSC (Buckingham and Relaix, 2015; Yin et al., 2013a), MPCs appear to represent the default cell fate for the Pax7+/Myf5+ embryonic progenitor cells. For such cells to adopt the BA fate, both Pax7 and Myf5 have to be downregulated. It remains unclear how different cell fate choices (i.e., MPC versus BA) are determined at the molecular levels in the Pax7+/Myf5+ multi-potential embryonic progenitor cells. Moreover, once such progenitor cells adopt the myoblast fate (i.e., Myf5+/MyoD+ with or without Pax7 expression), it is also unclear how the alternative BA fate is suppressed. Here, we provide evidence showing that MyoD and Myf5, the two muscle lineage-determining factors acting downstream of Pax7, transcriptionally repress Prdm16, a known lineage-determining factor for the brown adipogenic program, via a transcription repressor complex consisting of E2F4/p107/p130 (Julian and Blais, 2015; Seale et al., 2007, 2008; Trimarchi and Lees, 2002). We show that the Pax7-MyoD/Myf5-E2F4/p107/p130 axis serves as a key molecular switch in both the Pax7+ embryonic progenitor cells and postnatal myoblasts to repress the BA fate. RESULTS Inducible Deletion of Pax7 in MPCs Resulted in a Cell Fate Change to Brown Adipocytes in Culture Pax7 is indispensable for MuSC maintenance and injury-induced € nther et al., 2013; Lepper et al., 2009; muscle regeneration (Gu von Maltzahn et al., 2013). However, the exact functions of Pax7 in MPCs remain poorly defined. To address the issue, we

sought to identify Pax7 target genes in MPCs. We took postnatal day 5 (P5) Pax7CreER/flox and Pax7CreER/+ (i.e., the heterozygous control) mice of the same litters and induced Pax7 deletion by tamoxifen injection (Lepper et al., 2009) (Figure 1A). The tamoxifen-induced Pax7 knockout (KO) was efficient as judged by the lack of Pax7 staining on muscle sections from the mutant mice (Figure S1A). MPCs from the heterozygous control and Pax7KO mice were enriched from dissected muscles by differential plating and cultured for 2 days before harvest. Total RNAs were extracted and subjected to RNA sequencing (RNA-seq) analysis. In Pax7-KO MPC, Myod and Myf5, two muscle lineage-determining genes (Tapscott, 2005), were downregulated, while several BA-specific genes including Prdm16, Cidea, and Ucp1 and many other general adipocyte-related genes including Pparg, Cebpa, Fabp4, and Adipoq were unexpectedly upregulated (Figure 1B), suggesting a cell fate change from MPC to BA. The results from RNA-seq were further confirmed by qRTPCR using MPCs freshly isolated from the control and Pax7KO mice by fluorescence-activated cell sorting (FACS) (Figure 1C). To further determine whether Pax7 ablation indeed changed the fate of MPC to BA at the cellular level, we used two Pax7/yellow fluorescent protein (YFP) reporter mouse lines (i.e., Pax7CreER/flox:Rosa-stop-YFP and Pax7CreER/+:Rosa-stopYFP) that would allow us to permanently mark Pax7-expressing cells even after Pax7 deletion. We treated P9 mice with tamoxifen (Figure 1D), isolated YFP+ MPC with or without Pax7 by FACS (Figure S1B), and cultured them in pro-adipogenic media for 5 days. Only the Pax7-KO, but not the control, MPCs efficiently formed lipid droplet-containing adipocytes as evidenced by the appearance of many oil red O+ cells (Figure 1E). Moreover, by staining for BA-specific UCP1, we confirmed that those oil red O+ cells were indeed BA (Figure 1F). Developmental Cell 41, 382–391, May 22, 2017 383

Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate C2C12 cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Knockdown of Myod/Myf5 in MPCs Promoted BA Fate Conversion by Transcriptionally Upregulating Prdm16 Our data above indicate that Pax7 in MPC suppresses the BA fate. To identify key molecules downstream of Pax7 that are involved in suppression of the BA fate, we turned to MyoD and Myf5, as both Myf5 and Myod are known direct Pax7 target genes in MPCs (Bajard et al., 2006; Hu et al., 2008; McKinnell et al., 2008). Consistently, they were indeed downregulated in Pax7-KO MPCs (Figures 1B and 1C). To directly test our hypothesis, we knocked down Myod or Myf5 with specific small interfering RNAs (siRNAs) using FACS-isolated MPCs. After 4 days of culturing in pro-adipogenic media, only MPCs transfected with siMyoD or siMyf5 but not a control siRNA (i.e., siGFP) were converted to oil red O+ adipocytes (Figure 2A, top panels). Importantly, we showed that these adipocytes were UCP1+ BAs (Figure 2A, bottom panels). Knockdown of both Myod and Myf5 together was more efficient than that of a single gene alone in converting MPCs to UCP1+ BAs (Fig384 Developmental Cell 41, 382–391, May 22, 2017

ure 2A). Similar results were also obtained in C2C12 myoblasts, a commonly used immortalized mouse myoblast cell line (Figures S2A and S2B). To understand how MyoD and Myf5 suppress the BA fate, we turned to several key transcription factors involved in brown adipose tissue (BAT) formation including Prdm16, a well-established lineage-determining factor for the development of BAT (Seale et al., 2007, 2008). We infected FACS-isolated MPC with an adenovirus that expresses a small hairpin RNA (shRNA) specifically targeting Myod and found that knockdown of Myod alone in MPCs already obviously induced the expression of Prdm16 and Cebpa as judged by qRT-PCR analysis (Figure 2B). Similarly, induction of Prdm16 mRNA by knockdown of both Myod and Myf5 was also seen in C2C12 myoblasts (Figure S2C). By western blotting, we further confirmed that knockdown of either Myod, Myf5, or both in C2C12 myoblasts induced the expression of Prdm16 protein (Figure S2D). To ascertain that induction of Prdm16 was indispensable for MPC to BA conversion, we knocked down Prdm16

Figure 3. E2f4 Is a Direct Transcription Target of MyoD/Myf5 MPCs used below Were Isolated by FACS from 2-Month-Old Wild-Type Mice (A) Sorted cells were fixed after either 1 hr of plating (i.e., quiescent satellite cells or QSC) or 1 day of culturing (i.e., activated satellite cells or ASC) followed by immunostaining for E2F4 (green). (B) MPCs from three mice were separately infected with adenoviruses expressing indicated shRNAs; 36 h later, the E2f4 mRNA levels were measured by qRT-PCR. (C) MPCs were transfected with siRNAs as indicated. E2F4 protein levels were measured by western blotting. (D) Top: schematic of the E2f4 promoter. TSS, transcription start site; blue boxes, exons; black box, the E box. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with a MyoD antibody or an immunoglobulin G control. The fold enrichment of MyoD on the specific E box in the E2f4 promoter is shown. NS, non-specific site. (E and F) MPCs (E) and C2C12 myoblasts (F) were transfected with siRNAs as indicated; 24 hr post transfection, cells were cultured in the pro-adipogenic media for 4 days followed by oil red O staining. Data are presented as mean ± SD. **p < 0.01, ***p < 0.001. Scale bars, 30 mm.

together with Myod and Myf5 in C2C12 myoblasts. We found that siMyoD/siMyf5-induced BA conversion was indeed severely compromised when Prdm16 was also knocked down (Figure 2C). Together, our data indicated that MyoD/Myf5 in MPCs suppress the BA fate by transcriptionally repressing the expression of Prdm16. E2f4 Is a Direct Transcriptional Target of MyoD/Myf5 As MyoD/Myf5 usually function as strong transcription activators (Tapscott, 2005), it is likely that MyoD/Myf5 indirectly suppressed Prdm16 via a transcription repressor. To identify such repressors, we turned to a list of MyoD-bound genes that encode known transcription regulators by analyzing the MyoD chromatin immunoprecipitation sequencing (ChIP-seq) data (Cao et al., 2010). To examine whether these genes were indeed transcriptionally regulated by MyoD, we first knocked down Myod in FACS-isolated MPCs and then examined the mRNA

levels of these genes by qRT-PCR (Figure S3A). Among them, E2f4 caught our attention as it encodes a well-characterized transcription repressor (Trimarchi and Lees, 2002). We found that E2f4 was expressed in the quiescent MuSC and activated MPCs and C2C12 myoblasts, and that knockdown of Myod in either FACS-isolated MPCs or C2C12 myoblasts led to a drastic reduction of E2F4 at both the mRNA and protein levels (Figures 3A–3C, S3B, and S3C). To further confirm direct binding of MyoD to the E2f4 promoter in myoblasts, we analyzed two sets of MyoD ChIP-seq data (i.e., GSM915816 from ENCODE; Cao et al., 2010) and identified a common MyoD binding site (i.e., an E box) 50 to exon 4 of the E2f4 gene in proliferating myoblasts (Figures 3D [top] and S3D) (Cao et al., 2010). We then performed ChIP assays using proliferating C2C12 myoblasts. We confirmed that MyoD was indeed specifically enriched at this E box but not at a non-specific site (Figure 3D, bottom). To confirm that this E box was indeed functional for Developmental Cell 41, 382–391, May 22, 2017 385

Figure 4. Prdm16 Is a Direct Transcription Target of the E2F4/p107/p130 Repressive Complex (A) FACS-isolated MPCs in triplicate were transfected with siRNAs as indicated. Relative gene expression was measured by qRT-PCR 24 hr after transfection. (B) Top: schematic of the Prdm16 promoter. #1 and #2 indicate the predicted E2F4 binding sites (black boxes). Blue box, exons. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with specific antibodies as indicated. The fold enrichment of E2F4, p107, or p130 on two potential E2F4 binding sites in the Prdm16 promoter and a known E2F4 binding site in the PPARg promoter (control) is shown. (C–F) C2C12 cells in triplicate were co-transfected with various luciferase reporters, siRNAs, and/or cDNA expression vectors as indicated. Cells were harvested 24 hr after transfection and luciferase activities were measured. In (C) and (D), a luciferase reporter construct carrying a 1.5-kb mouse Prdm16 proximal promoter was used. In (E), two luciferase reporter constructs were used, each carrying a short fragment of the Prdm16 promoter with one of the two (i.e., #1, #2) potential E2F4 binding sites. In (F), two luciferase reporter constructs were used, one carrying three copies of the wild-type E2F4 binding site (CGCAGC) found in site #2 and the other three copies of the mutated E2F4 binding site (CTCCTC). In (A)–(F), Fold changes were calculated. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

MyoD binding and transactivation, we cloned this E-box-containing DNA fragment (500 bp) into a luciferase reporter construct with a minimal SV40 promoter (i.e., pGL3 promoter). When we transfected C2C12 myoblasts with this reporter construct together with siGFP or siMyoD, we found that only cells transfected with siMyoD displayed reduced reporter activity (Figure S3E, left). Conversely, when we transfected this reporter construct into 10T1/2 cells, a multi-potential mesodermal progenitor-like mouse embryonic cell line (Pinney and Emerson, 1989), together with either an empty or MyoDexpressing vector, we found that MyoD potently activated this reporter (Figure S3E, right). Importantly, we showed that knockdown of E2f4 in either FACS-isolated MPCs or C2C12 myoblasts converted them to BAs in culture (Figures 3E and 3F). Moreover, as E2F4 is known to exert its transcriptional repressive activity by binding to pocket proteins p107 and/or p130 (Julian and Blais, 2015; Trimarchi and Lees, 2002), knockdown of p107 or p130 in myoblasts would also be expected to 386 Developmental Cell 41, 382–391, May 22, 2017

promote a cell fate change to BA. Indeed, this was the case (Figure 3F, bottom panels). Consistently both E2F4 and p107 were found to be abundantly expressed in C2C12 myoblasts but absent in BAT (Figure S3F). Prdm16 Is a Direct Transcription Target of the E2F4/ p107/p130 Repressive Complex in MPCs Next, we tested whether E2F4/p107 regulates Prdm16 expression. We first knocked down E2f4 or p107 individually in FACS-isolated MPCs with siMyoD as a positive control. We found that knockdown of Myod, E2f4, or p107 all resulted in induction of Prdm16, as well as Pgc1a, another BA-enriched gene (Figure 4A) (Puigserver et al., 1998). Similar results were also obtained in C2C12 myoblasts (Figure S4A). As induction of Prdm16 in myoblasts interferes with the expression of myogenic genes (Seale et al., 2008), we also examined the impact of E2f4 knockdown on myogenic differentiation. In FACS-isolated MPCs, E2f4 knockdown reduced the ratio of Myog+ cells (Figures S4B and S4C), indicative of partial

Figure 5. Knockdown of Myod Postnatally Promoted MPC to BA Conversion In Vivo at Low Efficiency (A) Experimental scheme for (B). CTX, cardiotoxin. (B) Representative TA muscle sections from Pax7CreER(Gaka):Rosa-stop-YFP mice infected with shLacZ- or shMyoD-expressing adenoviruses following the scheme in (A) were subjected to immunostaining for UCP1 (red) and YFP (green). Nuclei were counterstained by DAPI (blue). The UCP1+/YFP+ cells are indicated by white arrowheads. Scale bar, 20 mm. (C) Quantification of UCP1+/YFP+ cells on TA sections from (B). Sixteen sections from four pairs of TA muscles were counted. Data are presented as means ± SD. ***p < 0.001.

inhibition of myogenic differentiation. Consistently, by qRT-PCR, we found that siE2F4 partially inhibited the expression of Myog without affecting that of Myod (Figure S4D). Next, we tested whether E2F4/p107/p130 directly bind to the Prdm16 promoter. Analysis of the DNA sequences near the transcription start site (TSS) of the Prdm16 gene revealed the existence of two potential E2F4 binding sites (Lee et al., 2011) (Figure 4B, top). We performed ChIP assays in C2C12 myoblasts using Pparg as a positive control (Calo et al., 2010; Fajas et al., 2002). We found that E2F4 was indeed enriched at its binding site in the Pparg promoter as well as the two potential binding sites in the Prdm16 promoter, with the fold enrichment at site 2 the highest. p107 and p130, the two members of the pocket proteins that intimately associate with E2F4, were also enriched at these sites (Figure 4B, bottom). Furthermore, we also subcloned a 1.5-kb fragment of the Prdm16 proximal promoter containing the E2F4 binding sites into a promoterless luciferase reporter construct (i.e., pGL3-basic). We then co-transfected C2C12 myoblasts with the reporter together with siMyoD, siE2F4, or siGFP. Only myoblasts transfected with siE2F4 or siMyoD displayed enhanced reporter activity (Figure 4C). Co-expression of exogenous E2F4 with siMyoD totally abolished the latter’s stimulatory effect (Figure 4D), which supported our hypothesis that MyoD represses Prdm16 expression via E2F4. To further assess the contribution of two E2F4 binding sites to Prdm16 repression, we separately cloned two Prdm16 promoter fragments, one containing each E2F4 binding site, into a luciferase reporter construct, and tested their responses to the siE2F4/sip107 treatment in C2C12 cells. We found that site 2 responded better (Figure 4E). A close inspection of site 2 revealed a consensus E2F4 binding site that is conserved in both human and mouse Prdm16 proximal promoters (Figure S4E). Consistently, a luciferase reporter with three copies of this consensus E2F4 binding site was obviously repressed by the exogenous E2F4. In contrast, another luciferase reporter with three copies of a mutated E2F4 binding site failed to be repressed by E2F4 (Figure 4F).

Knockdown of Myod or Deletion of Pax7 in MPCs Postnatally Converted Them to BAs In Vivo at Low Efficiency Our studies above showed that deletion of Pax7 or knockdown of key components in the MyoD/Myf5-E2F4/p107/p130 axis in MPCs promoted a cell fate change to BAs in culture. It remained unclear whether such a cell fate change could occur in vivo. To address this issue, we turned to a Pax7/YFP reporter line (i.e., Pax7CreER(Gaka):Rosa-stop-YFP). We first induced YFP expression in MPCs in adult mice with three doses of tamoxifen injection, then injured tibialis anterior (TA) muscles on both legs of the reporter mice with cardiotoxin (CTX), followed by infecting the regenerating TA muscles of both legs separately with recombinant adenoviruses expressing shLacZ (control) and shMyoD (one for each side of TA muscle) (Figure 5A). Two weeks after the CTX-induced injury, more UCP1+/YFP+ cells were detected in the interstitial regions of the TA muscles infected with shMyoD-expressing adenovirus (Figures 5B and 5C). However, the absolute number of such UCP1+/YFP+ cells was low. Similar results were also obtained in the Pax7CreER/flox:Rosa-stop-YFP reporter mice when Pax7 was inducibly deleted by tamoxifen (Figures S5A–S5C). Ablation of Pax7 in Embryos Promoted BAT Development Between embryonic day 9.5 (E9.5) and E11.5, Pax7+ progenitors contribute to dermal, BAT, and muscle lineages in sequential but overlapping waves (Lepper and Fan, 2010). By E12.5, Pax7+ progenitor cells exclusively contribute to the muscle lineage (Lepper and Fan, 2010). While the expression of Pax7 is retained in MPCs, it is no longer expressed in the committed brown preadipocytes (our unpublished data). Therefore, by deliberately manipulating the expression of Pax7 between E9.5 and E11.5, we might alter the cell fate choices and consequently the proportion of cells entering a specific lineage. To test this hypothesis, we induced Pax7 deletion at E10.5 in the Developmental Cell 41, 382–391, May 22, 2017 387

Figure 6. Inducible Ablation of Pax7 in Embryos Promoted BAT Development Tamoxifen was injected into pregnant mice (Pax7CreER/+ 3 Pax7flox/+:Rosa-stop-YFP) to induce Pax7 deletion in E10.5 embryos. Embryos or YFP+ cells were isolated at various time points as indicated. (A and B) YFP+ progenitor cells were isolated by FACS from the control (i.e., Pax7CreER/+:Rosa-stop-YFP) and KO (i.e., Pax7CreER/flox:Rosa-stop-YFP) embryos at E12.5 (A) or E13.5 (B). In (A), the relative mRNA levels of selected genes were determined by qRT-PCR (n = 3 pairs of embryos). In (B), YFP+ cells were allowed to attach to the culture plates overnight and then subjected to immunostaining for MyoD (green). Nuclei were counterstained with DAPI (blue). Representative images (left) and the ratio of MyoD+ cells (right) are shown (cells in ten random fields from two pairs of embryos were counted). Scale bar, 20 mm. (C and D) The control and Pax7-KO embryos were isolated at E16.5 and the corresponding transverse sections of the interscapular regions were subjected to immunostaining (C) for UCP1 (red) and YFP (green) or H&E staining (D). The interscapular BAT (iBAT) is marked by black dotted lines. Number (#) denotes different embryos. Scale bars, 50 mm (C) and 200 mm (D). (E) Quantification of the size of the iBAT from (D) by SPOT5.0. (F) The control and Pax7-KO P1 pups were examined. The iBAT was dissected from individual pups and weighed. Representative images (top) and the weight of the iBAT from individual pups (bottom) are shown (n = 9 pairs). In all quantifications, data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

pregnant female Pax7/YFP reporter mice (i.e., Pax7CreER/flox: Rosa-stop-YFP and Pax7CreER/+:Rosa-stop-YFP) followed by various assays at different time points. At E12.5, we isolated YFP+ progenitor cells by FACS from both the heterozygous control and Pax7-KO embryos, and determined the relative mRNA levels of Myod, E2f4, and Prdm16 by qRT-PCR. Compared with the control, the mRNA levels of Myod and E2f4 were downregulated and that of Prdm16 were upregulated in Pax7-KO progenitor cells (Figure 6A), suggesting that deliberate deletion of Pax7 in Pax7-expressing progenitor cells increased the proportion of cells toward the BA lineage. Consistently, in YFP+ progenitor cells isolated from E13.5 control and Pax7-KO embryos, the proportion of MyoD+ myogenic cells was decreased in the progenitor cells without Pax7 (Figure 6B). Moreover, by immunostaining for YFP and UCP1, we found more YFP+ cells in the interscapular BAT (iBAT) in E16.5 Pax7-KO embryos (Figure 6C), suggesting that more Pax7-KO progenitor cells contributed to the BA lineage. Consistently, by H&E staining of the transverse sections of E16.5 embryos around the interscapular region, we found 388 Developmental Cell 41, 382–391, May 22, 2017

enlarged iBAT in Pax7-KO embryos (Figures 6D and 6E). When we dissected the whole iBAT from P1 control and Pax7-KO pups, we found that the iBAT from Pax7-KO pups were generally bigger in size (Figure 6F). These results demonstrated that the Pax7-MyoD/Myf5-E2F4 axis regulates the cell fate choices between BA and MPC during normal embryonic development. DISCUSSION Dual Roles of MyoD/Myf5 in MPCs In hematopoiesis, several lineage-determining factors are known to possess dual functions: they not only promote the development of a particular cell lineage but also simultaneously suppress an alternative cell fate via distinct mechanisms (Orkin and Zon, 2008). For example, in common myeloid progenitors, GATA-1 and PU.1 specify the fates of megakaryocyte/erythroid progenitors and granulocyte/macrophage progenitors, respectively. GATA-1 and PU.1 physically bind to each other and directly inhibit each other’s functions (Orkin and Zon, 2008).

Consequently, upregulation of one such factor is sufficient to promote the development of one cell lineage at the expense of the alternative cell fate. In our current study, MyoD/Myf5 and Prdm16 are well-established lineage-determining factors for the development of myoblasts and BA, respectively (Farmer, €hbeck et al., 2009; Harms and Seale, 2013; Kajimura 2008; Fru et al., 2010; Tapscott, 2005). The existing data and our own work here show that they antagonize each other mainly by inhibiting each other’s expression. Ectopic expression of Prdm16 in myoblasts converted them to BA by suppressing the expression of Myod, while that of Myod in primary brown preadipocytes converted them to myocytes via suppression of Prdm16 (Seale et al., 2008; Wang et al., 2017). The precise mechanism for Prdm16-mediated Myod suppression remains unclear. A recent study suggested that euchromatic histone lysine methyltransferase 1 (EHMT1), which preferentially catalyzes di- and trimethylation of H3K9, is implicated in the process (Ohno et al., 2013). As to the mechanism underlying Prdm16 suppression by MyoD/ Myf5, we showed here that MyoD/Myf5 transcriptionally repress Prdm16 via the E2F4/p107/p130 repressor complex. The critical role of MyoD/Myf5 in suppressing the BA fate is also supported by existing data in literature. In a most recent study, deletion of Myod in myoblasts was also found to promote the cell fate change to BA in culture (Wang et al., 2017). In addition, in Myod/Myf5 double-KO mouse embryos, excessive fat tissues were found in the muscle-forming regions at the expense of muscles (Kablar et al., 2003). However, it remains unclear whether such fat tissues are white adipose tissue (WAT) or BAT and whether they actually derive from the MyoD/Myf5 double-null progenitor cells. In another Myod/Igf2 double-KO mice, enlarged iBAT was observed, which was attributed to increased proliferation and differentiation of brown preadipocytes (Borensztein et al., 2012). Unlike what we found in MPCs, knockdown of Myod alone in brown preadipocytes was found to be ineffective in inducing Prdm16 or Ucp1. No mechanism was provided to explain the role of MyoD and IGF2 (insulin-like growth factor 2) in BAT development. Based on our work here, it is likely that loss of both Myod and Igf2 in the Pax7+ progenitor cells may tip the cell fate balance to favor the development of the BA lineage. Several recent reports demonstrated that Prdm16 could also be suppressed post-transcriptionally in both myoblasts and white preadipocytes by miR-133, a cardiac and skeletal muscle-enriched microRNA (i.e., MyomiR) (Liu et al., 2013b; Pasut et al., 2016; Trajkovski et al., 2012; Yin et al., 2013b). Interestingly, miR-133 was also shown to be a direct transcriptional target of MyoD in cultured myoblasts (Pasut et al., 2016; Rao et al., 2006; Wang et al., 2017). In freshly isolated MPCs, we confirmed that miR-133 was indeed transcriptionally regulated by both MyoD and Myf5 (Figure S6A). Moreover, suppression of miR-133 function with a miR-133 inhibitor in C2C12 myoblasts increased Prdm16 mRNA levels without affecting the expression of Myod, Myf5, or E2f4 (Figure S6B), suggesting that miR-133 represses Prdm16 independently of the MyoD/Myf5-E2F4/p107/ p130 axis. Thus, MyoD/Myf5 can suppress the alternative BA fate by inhibiting Prdm16 expression through two distinct mechanisms: one involving transcriptional repression of Prdm16 via E2F4/p107/p130, and the other involving post-transcriptional repression of Prdm16 via miR-133 (Figure S6C).

The Roles of the E2F4/p107/p130 Complex in Embryonic and Postnatal MPCs Unlike E2F1-3, E2F4 is a well-established transcription repressor (Trimarchi and Lees, 2002). It functions by associating with members of the pocket protein family and other transcription co-repressors including histone deacetylases and lysine demethylases (Beshiri et al., 2012; Trimarchi and Lees, 2002). Both E2F4 and pocket proteins are known negative regulators of adipogenesis (Calo et al., 2010; Fajas et al., 2002; Hansen et al., 2004; Landsberg et al., 2003; Scime` et al., 2005). In particular, Rb and p107 have been shown to negatively regulate BAT and beige fat formation in mice, respectively (Calo et al., 2010; Scime` et al., 2005). Due to early lethality of E2f4-KO mice (Humbert et al., 2000; Rempel et al., 2000), the development and functions of BAT and beige fat in E2f4-KO mice have not so far been directly characterized. Our work here shows that the E2F4/ p107/p130 complex can function at different developmental stages by targeting and repressing Prdm16: during embryonic development, it acts as a switch in the Pax7+ progenitor cells to regulate the cell fate choices between BAs and MPCs. Turning off this switch is required for the development of BAT. In postnatal MPCs, the E2F4/p107/p130 complex mainly functions as an intrinsic brake to suppress the alternative BA fate and stably maintain the muscle lineage. Removal of such a brake is necessary but not sufficient for BA conversion either in culture or in vivo. Clearly, additional signals are also required. Moreover, conversion of postnatal MPC/MuSC to BA is more difficult and inefficient in vivo (Figures 5 and S5), which is likely due to the distinct transcriptome profile and epigenetic modifications in postnatal MuSC, and incompatible extrinsic signals in vivo (Liu et al., 2013a; Pallafacchina et al., 2010). Potential Applications Due to the obvious beneficial effects of BAT and its scarcity in adult human, it would be highly desirable to find effective ways to increase the number of human BA. However, it is impractical to try to convert the endogenous MuSC to BA as adult MuSC themselves are not only scarce and quiescent but also indispensable for injury-induced muscle regeneration. In addition, as stated above, it is very inefficient to convert MuSC to BA in postnatal muscles. Nevertheless, our findings here may be useful in the future for cell-based therapies: for example, a small number of patient-derived MuSC can be expanded in culture to large quantities (Charville et al., 2015), then induced to form BA by targeting the MyoD/Myf5-E2F4/p107/p130 axis. Such reprogrammed BA can be transplanted back to the same individuals without the concerns of graft rejection. As a proof of principle, such transplantation-based approaches have already been shown to be effective in helping recipient mice resist high fat diet-induced obesity (Liu et al., 2013c). Furthermore, our findings may have additional applications in white fat ‘‘browning’’ as the repression of Prdm16 by E2F4/p107/ p130 is likely conserved in beige fat progenitors as well. This hypothesis is strongly supported by the study of p107-KO mice in which enhanced WAT browning was observed (Scime` et al., 2005). Moreover, our own preliminary study also showed that knockdown of E2f4 in 10T1/2 fibroblasts or primary white/beige preadipocytes also resulted in induction of Prdm16 and UCP1 (our unpublished data). More detailed studies are needed to Developmental Cell 41, 382–391, May 22, 2017 389

rigorously test this hypothesis. If this is indeed the case, the E2F4/p107/p130 complex could be an attractive drug target to promote white fat browning in patients suffering from obesity and type 2 diabetes. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

d d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Mouse Models B Cell Lines and Primary Cultures METHOD DETAILS B Cardiotoxin Injection B Histology B Isolation of Embryonic and Postnatal Muscle Progenitor Cells (MPC) by FACS B RNA-Seq and Data Analysis B Immunostaining B Immunoblotting B siRNA & miR-Inhibitor Transfection B RNA Extraction and qRT-PCR B Chromatin Immunoprecipitation B Adenoviral Infection B Luciferase Reporter Assay QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information includes six figures and one table and can be found with this article online at http://dx.doi.org/10.1016/j.devcel.2017.04.012. AUTHOR CONTRIBUTIONS

and sufficient to specify the dorsal dermal fate in the mouse. Dev. Biol. 296, 164–176. Bajard, L., Relaix, F., Lagha, M., Rocancourt, D., Daubas, P., and Buckingham, M.E. (2006). A novel genetic hierarchy functions during hypaxial myogenesis: pax3 directly activates Myf5 in muscle progenitor cells in the limb. Genes Dev. 20, 2450–2464. Ben-Yair, R., and Kalcheim, C. (2005). Lineage analysis of the avian dermomyotome sheet reveals the existence of single cells with both dermal and muscle progenitor fates. Dev. Camb. Engl. 132, 689–701. Beshiri, M.L., Holmes, K.B., Richter, W.F., Hess, S., Islam, A.B.M.M.K., Yan, Q., Plante, L., Litovchick, L., Ge´vry, N., Lopez-Bigas, N., et al. (2012). Coordinated repression of cell cycle genes by KDM5A and E2F4 during differentiation. Proc. Natl. Acad. Sci. USA 109, 18499–18504. Borensztein, M., Viengchareun, S., Montarras, D., Journot, L., Binart, N., Lombe`s, M., and Dandolo, L. (2012). Double Myod and Igf2 inactivation promotes brown adipose tissue development by increasing Prdm16 expression. FASEB J. 26, 4584–4591. Buckingham, M., and Relaix, F. (2015). PAX3 and PAX7 as upstream regulators of myogenesis. Semin. Cell Dev. Biol. 44, 115–125. Calo, E., Quintero-Estades, J.A., Danielian, P.S., Nedelcu, S., Berman, S.D., and Lees, J.A. (2010). Rb regulates fate choice and lineage commitment in vivo. Nature 466, 1110–1114. Cao, Y., Yao, Z., Sarkar, D., Lawrence, M., Sanchez, G.J., Parker, M.H., MacQuarrie, K.L., Davison, J., Morgan, M.T., Ruzzo, W.L., et al. (2010). Genome-wide MyoD binding in skeletal muscle cells: a potential for broad cellular reprogramming. Dev. Cell 18, 662–674. Charville, G.W., Cheung, T.H., Yoo, B., Santos, P.J., Lee, G.K., Shrager, J.B., and Rando, T.A. (2015). Ex vivo expansion and in vivo self-renewal of human muscle stem cells. Stem Cell Reports 5, 621–632. Christ, B., Huang, R., and Scaal, M. (2007). Amniote somite derivatives. Dev. Dyn. 236, 2382–2396. Fajas, L., Landsberg, R.L., Huss-Garcia, Y., Sardet, C., Lees, J.A., and Auwerx, J. (2002). E2Fs regulate adipocyte differentiation. Dev. Cell 3, 39–49. Farmer, S.R. (2008). Molecular determinants of brown adipocyte formation and function. Genes Dev. 22, 1269–1275. €hbeck, G., Sesma, P., and Burrell, M.A. (2009). PRDM16: the interconvertFru ible adipo-myocyte switch. Trends Cell Biol. 19, 141–146. €nther, S., Kim, J., Kostin, S., Lepper, C., Fan, C.M., and Braun, T. (2013). Gu Myf5-positive satellite cells contribute to Pax7-dependent long-term maintenance of adult muscle stem cells. Cell Stem Cell 13, 590–601.

Y.A., G.W., Y.D., and Z.W. designed all the experiments, analyzed data, and wrote the manuscript. Y.A., G.W., and Y.D. performed most of the experiments and contributed equally to this study. Y.L., M.W., and X.F. cloned constructs and performed reporter assays. L.Z., K.S., H.S., and H.W. helped with RNA-seq and data analysis. T.H.C. helped with cell sorting. N.I. supplied YFP reporter mice. All authors discussed the data and commented on the manuscript.

Hansen, J.B., Jørgensen, C., Petersen, R.K., Hallenborg, P., De Matteis, R., €ck, S., Nedergaard, J., Cinti, S., et al. (2004). Bøye, H.A., Petrovic, N., Enerba Retinoblastoma protein functions as a molecular switch determining white versus brown adipocyte differentiation. Proc. Natl. Acad. Sci. USA 101, 4112–4117.

ACKNOWLEDGMENTS

Harms, M., and Seale, P. (2013). Brown and beige fat: development, function and therapeutic potential. Nat. Med. 19, 1252–1263.

The work was supported by grants from the Hong Kong Research Grant Council (C6015-14G, AoE/M-09/12, T13-607/12R), the National Natural Science Foundation of China (31301126), the State Key Laboratory of Molecular Neuroscience at HKUST (ITCPD/17-9), and a long-term postdoctoral fellowship (to Y.D.) from the Human Frontier Science Program. Received: March 15, 2016 Revised: February 16, 2017 Accepted: April 19, 2017 Published: May 22, 2017

Hu, P., Geles, K.G., Paik, J.-H., DePinho, R.A., and Tjian, R. (2008). Codependent activators direct myoblast-specific MyoD transcription. Dev. Cell 15, 534–546. Humbert, P.O., Rogers, C., Ganiatsas, S., Landsberg, R.L., Trimarchi, J.M., Dandapani, S., Brugnara, C., Erdman, S., Schrenzel, M., Bronson, R.T., et al. (2000). E2F4 is essential for normal erythrocyte maturation and neonatal viability. Mol. Cell 6, 281–291. Julian, L.M., and Blais, A. (2015). Transcriptional control of stem cell fate by E2Fs and pocket proteins. Front. Genet. 6, 161.

REFERENCES

Kablar, B., Krastel, K., Tajbakhsh, S., and Rudnicki, M.A. (2003). Myf5 and MyoD activation define independent myogenic compartments during embryonic development. Dev. Biol. 258, 307–318.

Atit, R., Sgaier, S.K., Mohamed, O.A., Taketo, M.M., Dufort, D., Joyner, A.L., Niswander, L., and Conlon, R.A. (2006). Beta-catenin activation is necessary

Kajimura, S., Seale, P., and Spiegelman, B.M. (2010). Transcriptional control of brown fat development. Cell Metab. 11, 257–262.

390 Developmental Cell 41, 382–391, May 22, 2017

Kalcheim, C. (2015). Epithelial-mesenchymal transitions during neural crest and somite development. J. Clin. Med. 5, http://dx.doi.org/10.3390/ jcm5010001.

Pinney, D.F., and Emerson, C.P. (1989). 10T1/2 cells: an in vitro model for molecular genetic analysis of mesodermal determination and differentiation. Environ. Health Perspect. 80, 221–227.

Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14, R36.

Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., and Spiegelman, B.M. (1998). A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92, 829–839.

Landsberg, R.L., Sero, J.E., Danielian, P.S., Yuan, T.L., Lee, E.Y., and Lees, J.A. (2003). The role of E2F4 in adipogenesis is independent of its cell cycle regulatory activity. Proc. Natl. Acad. Sci. USA 100, 2456–2461.

Rao, P.K., Kumar, R.M., Farkhondeh, M., Baskerville, S., and Lodish, H.F. (2006). Myogenic factors that regulate expression of muscle-specific microRNAs. Proc. Natl. Acad. Sci. USA 103, 8721–8726.

Lee, B.K., Bhinge, A.A., and Iyer, V.R. (2011). Wide-ranging functions of E2F4 in transcriptional activation and repression revealed by genome-wide analysis. Nucleic Acids Res. 39, 3558–3573.

Rempel, R.E., Saenz-Robles, M.T., Storms, R., Morham, S., Ishida, S., Engel, A., Jakoi, L., Melhem, M.F., Pipas, J.M., Smith, C., et al. (2000). Loss of E2F4 activity leads to abnormal development of multiple cellular lineages. Mol. Cell 6, 293–306.

Lepper, C., and Fan, C.M. (2010). Inducible lineage tracing of Pax7-descendant cells reveals embryonic origin of adult satellite cells. Genesis 48, 424–436.

Schiaffino, S., and Reggiani, C. (2011). Fiber types in mammalian skeletal muscles. Physiol. Rev. 91, 1447–1531.

Lepper, C., Conway, S.J., and Fan, C.M. (2009). Adult satellite cells and embryonic muscle progenitors have distinct genetic requirements. Nature 460, 627–631.

Scime`, A., Grenier, G., Huh, M.S., Gillespie, M.A., Bevilacqua, L., Harper, M.-E., and Rudnicki, M.A. (2005). Rb and p107 regulate preadipocyte differentiation into white versus brown fat through repression of PGC-1alpha. Cell Metab. 2, 283–295.

Liu, L., Cheung, T.H., Charville, G.W., Hurgo, B.M.C., Leavitt, T., Shih, J., Brunet, A., and Rando, T.A. (2013a). Chromatin modifications as determinants of muscle stem cell quiescence and chronological aging. Cell Rep. 4, 189–204.

Seale, P., Kajimura, S., Yang, W., Chin, S., Rohas, L.M., Uldry, M., Tavernier, G., Langin, D., and Spiegelman, B.M. (2007). Transcriptional control of brown fat determination by PRDM16. Cell Metab. 6, 38–54.

Liu, W., Bi, P., Shan, T., Yang, X., Yin, H., Wang, Y.X., Liu, N., Rudnicki, M.A., and Kuang, S. (2013b). miR-133a regulates adipocyte browning in vivo. PLoS Genet. 9, e1003626.

Seale, P., Bjork, B., Yang, W., Kajimura, S., Chin, S., Kuang, S., Scime`, A., Devarakonda, S., Conroe, H.M., Erdjument-Bromage, H., et al. (2008). PRDM16 controls a brown fat/skeletal muscle switch. Nature 454, 961–967.

Liu, X., Zheng, Z., Zhu, X., Meng, M., Li, L., Shen, Y., Chi, Q., Wang, D., Zhang, Z., Li, C., et al. (2013c). Brown adipose tissue transplantation improves wholebody energy metabolism. Cell Res. 23, 851–854.

Tapscott, S.J. (2005). The circuitry of a master switch: Myod and the regulation of skeletal muscle gene transcription. Dev. Camb. Engl. 132, 2685–2695.

McKinnell, I.W., Ishibashi, J., Le Grand, F., Punch, V.G.J., Addicks, G.C., Greenblatt, J.F., Dilworth, F.J., and Rudnicki, M.A. (2008). Pax7 activates myogenic genes by recruitment of a histone methyltransferase complex. Nat. Cell Biol. 10, 77–84. Ohno, H., Shinoda, K., Ohyama, K., Sharp, L.Z., and Kajimura, S. (2013). EHMT1 controls brown adipose cell fate and thermogenesis through the PRDM16 complex. Nature 504, 163–167. Orkin, S.H., and Zon, L.I. (2008). Hematopoiesis: an evolving paradigm for stem cell biology. Cell 132, 631–644. Pallafacchina, G., Franc¸ois, S., Regnault, B., Czarny, B., Dive, V., Cumano, A., Montarras, D., and Buckingham, M. (2010). An adult tissue-specific stem cell in its niche: a gene profiling analysis of in vivo quiescent and activated muscle satellite cells. Stem Cell Res. 4, 77–91. Pasut, A., Chang, N.C., Rodriguez, U.G., Faulkes, S., Yin, H., Lacaria, M., Ming, H., and Rudnicki, M.A. (2016). Notch signaling Rescues loss of satellite cells lacking Pax7 and promotes brown adipogenic differentiation. Cell Rep. 16, 333–343. Peirce, V., Carobbio, S., and Vidal-Puig, A. (2014). The different shades of fat. Nature 510, 76–83.

Trajkovski, M., Ahmed, K., Esau, C.C., and Stoffel, M. (2012). MyomiR-133 regulates brown fat differentiation through Prdm16. Nat. Cell Biol. 14, 1330–1335. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., and Pachter, L. (2010). Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 28, 511–515. Trimarchi, J.M., and Lees, J.A. (2002). Sibling rivalry in the E2F family. Nat. Rev. Mol. Cell Biol. 3, 11–20. von Maltzahn, J., Jones, A.E., Parks, R.J., and Rudnicki, M.A. (2013). Pax7 is critical for the normal function of satellite cells in adult skeletal muscle. Proc. Natl. Acad. Sci. USA 110, 16474–16479. Wang, C., Liu, W., Nie, Y., Qaher, M., Horton, H.E., Yue, F., Asakura, A., and Kuang, S. (2017). Loss of MyoD promotes fate transdifferentiation of myoblasts into brown adipocytes. EBioMedicine 16, 212–223. Yin, H., Price, F., and Rudnicki, M.A. (2013a). Satellite cells and the muscle stem cell niche. Physiol. Rev. 93, 23–67. Yin, H., Pasut, A., Soleimani, V.D., Bentzinger, C.F., Antoun, G., Thorn, S., Seale, P., Fernando, P., van Ijcken, W., Grosveld, F., et al. (2013b). MicroRNA-133 controls brown adipose determination in skeletal muscle satellite cells by targeting Prdm16. Cell Metab. 17, 210–224.

Developmental Cell 41, 382–391, May 22, 2017 391

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Mouse monoclonal FITC anti-CD31

BioLegend

Cat#102506; RRID: AB_312913

Mouse monoclonal FITC anti-CD45

BioLegend

Cat#553080; RRID: AB_394610

Mouse monoclonal Alexa 647 anti-Sca1

BioLegend

Cat#108118; RRID: AB_493271

Antibodies

Mouse monoclonal biotin anti-Vcam1

BD Biosciences

Cat#553331; RRID: AB_394787

Rabbit polyclonal anti-UCP1

Abcam

Cat#ab10983; RRID: AB_2241462

Goat polyclonal anti-GFP

Abcam

Cat#ab6658; RRID: AB_305631

Mouse monoclonal anti-Pax7

Developmental Studies Hybridoma Bank

N/A

Rabbit polyclonal anti-E2F4

Santa Cruz

Cat#sc-1082x; RRID: AB_2097104

Mouse monoclonal anti-MyoD

Dako

Cat#M3512; RRID: AB_2148874

Rabbit polyclonal anti-Prdm16

Abcam

Cat#ab106410; RRID: AB_10866455

Mouse monoclonal anti-GAPDH

Ambion

Cat#AM4300; RRID: AB_2536381

Rabbit polyclonal anti-MyoD

Santa Cruz

Cat#sc-760; RRID: AB_2148870

Rabbit polyclonal anti-Myf5

Santa Cruz

Cat#sc-302; RRID: AB_631994

Rabbit polyclonal anti-p107

Santa Cruz

Cat#sc-318x; RRID: AB_2175428

Rabbit polyclonal anti-p130

Santa Cruz

Cat#sc-317x; RRID: AB_632093

Mouse monoclonal anti-Myogenin

Santa Cruz

Cat#sc-12732; RRID: AB_627980

This paper

N/A

Biological Samples Freshly-sorted muscle satellite cells or muscle progenitor cells Chemicals, Peptides, and Recombinant Proteins PE/Cy7 Streptavidin

BioLegend

Cat#405206

Tamoxifen

Sigma

Cat#T5648

2,2,2-Tribromoethanol(Avertin)

Sigma

Cat#T48402

Cardiotoxin

Latoxan

Cat#L8102

Gelatin

Sigma

Cat#G2500

oil red O

Sigma

Cat#O0625

Collagenase II

Gibco

Cat#17101015

Dispase

Gibco

Cat#17105041

IgG-free BSA

Jacson Lab

Cat#105696

Indomethacin

Sigma

Cat#I8280

Isobutylmethylxanthine

Sigma

Cat#I7018

Dexamethasone

Sigma

Cat#D4902

Insulin

Sigma

Cat#91077C

Triiodothyronine

Sigma

Cat#T2877

Rosiglitazone

Sigma

Cat#R2408

Lipofectamine RNAiMax

Invitrogen

Cat#13778150

Lipofectamine

Invitrogen

Cat#18324012

Critical Commercial Assays BLOCK-iT Adenoviral RNAi Expression System

ThermoFisher

Cat#K494100

ImProm-II Reverse Transcription System

Promega

Cat#A3800

LightCycler 480 SYBR Green I Master

Roche

Cat#04707516001

ViraBind Adenovirus Purification Kit

Cell Biolabs, Inc

Cat#VPK-100

Dual-Luciferase Reporter Assay System kit

Promega

Cat#E1980 (Continued on next page)

e1 Developmental Cell 41, 382–391.e1–e5, May 22, 2017

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Deposited Data Pax7 RNA-seq in MPC

This paper

GEO: GSE97690

ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency

Cao et al., 2010

SRA: SRS010090

MyoD ChIP-seq on mouse C2C12

ENCODE

ENCSR000AIG

ATCC

CRL-1772

Experimental Models: Cell Lines Mouse: C2C12 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J

Jackson Laboratory

JAX: 012476

Mouse: Pax7tm1.1Fan/J

Jackson Laboratory

JAX: 012653

Jackson Laboratory

JAX: 017763

Jackson Laboratory

JAX: 006148

Mouse: Pax7tm1(cre/ERT2)Gaka/J Mouse: Gt(ROSA)26Sor

tm1(EYFP)Cos

/J

Oligonucleotides qPCR primers for gene expression

This paper

See Table S1

ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG

This paper

N/A

ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC

This paper

N/A

ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC

This paper

N/A

ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA

This paper

N/A

ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG

This paper

N/A

ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC

This paper

N/A

ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG

This paper

N/A

ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG

This paper

N/A

siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC

This paper

N/A

siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU

This paper

N/A

siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU

This paper

N/A

siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU

This paper

N/A

siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA

This paper

N/A

siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU

This paper

N/A

siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA

This paper

N/A

siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU

This paper

N/A

Negative control miRNA inhibitor

Ribobio

Cat#miR02201-1-5

Mir-133a inhibitor

Ribobio

Cat#miR20003473-1-5

pGL3-Basic Vector

Promega

Cat#E1751

pGL3-Promoter Vector

Promega

Cat#E1761

pAd/BLOCK-iT-DEST RNAi Gateway Vector

ThermoFisher

Cat#V49220

Recombinant DNA

(Continued on next page)

Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Photoshop CS5

Adobe

http://www.adobe.com

TopHat2

Kim et al., 2013

http://www.ccb.jhu.edu/software/tophat

Cufflinks

Trapnell et al., 2010

https://github.com/cole-trapnell-lab/cufflinks

CryoStar NX70 cryostat

Thermo Scientific

N/A

BD FACSAria II cell sorter

BD Biosciences

N/A

Software and Algorithms

Other

Upright fluorescent microscope (Ni-U)

Nikon

N/A

DS-Qi2 Camera

Nikon

N/A

Lumat LB9507 luminometer

Berthold Technologies

N/A

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Zhenguo Wu ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Mouse Models Pax7CreER/+ (stock #: 012476), Pax7flox/flox (stock #: 012653), Pax7CreER(Gaka) (stock #: 017763) and Rosa-stop-YFP (stock #: 006148) mice were from the Jackson Laboratory (Bar Harbor, ME, USA). All mice were maintained in accordance with the guidelines of the Animal and Plant Care Facility at HKUST. For in vivo experiments, unless stated otherwise, 2-3 month-old adult mice of the same gender were used. No obvious gender-specific effects were seen in our studies. To induce Pax7 deletion in neonatal or adult mice, 75 mg of tamoxifen (in corn oil)/g of body weight were subcutaneously or intraperitoneally injected into mice of different ages for 5 consecutive days. To induce Pax7 deletion in developing embryos, a single dose of tamoxifen (1.5 mg/mouse) was injected into pregnant mice intraperitoneally. All animal-handling procedures and protocols were approved by the Animal Ethics Committee at HKUST. Cell Lines and Primary Cultures C2C12 myoblasts were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 20% fetal bovine serum (FBS) and 1% antibiotics in 37 C incubator with 5% CO2. Muscle satellite cells (MuSC) or muscle progenitor cells (MPC) were isolated by FACS and maintained in Ham’s F10 medium with 10% horse serum (HS) and 1% antibiotics in 37 C incubator with 5% CO2. For induction of adipogenic differentiation, cells were first cultured in media I (DMEM with 10% FBS, 125 mM indomethacin, 500 mM isobutylmethylxanthine, 1 mM dexamethasone, 850 nM insulin, 1 nM triiodothyronine, and 1 mM rosiglitazone) for two days and then in media II (DMEM with 10% FBS, 1 mM rosiglitazone, 850 nM insulin, and 1 nM triiodothyronine) for another two or three days. METHOD DETAILS Cardiotoxin Injection Mice were anaesthetized by intraperitoneal injection of Avertin (0.5 mg/g of body weight). The tibialis anterior (TA) muscles were injected with 20-30 ml of 10 mM cardiotoxin (CTX) to induce acute muscle injury. The TA muscles were dissected at various times after injury for subsequent histological or immunofluorescent staining. Histology Muscles from adult mice were dissected and directly embedded in optimum cutting temperature compound. E16.5 mouse embryos were isolated and fixed in 4% paraformaldehyde for 3 h followed by dehydration overnight in 15% sucrose solution. Embryos were embedded in gelatin-based supporting material (7.5% gelatin, 15% sucrose in PBS). Embedded muscles or embryos were then sectioned into 8 mm sections on a CryoStar NX70 cryostat (Thermo Scientific). For hematoxylin-eosin staining, sections were fixed with 10% formaldehyde for 10 min and washed with ddH2O twice. Fixed sections were then stained with hematoxylin and eosin followed by sequential dehydration in 100% ethanol, 50% ethanol with 50% xylene and 100% xylene. For oil red O staining, cultured cells were fixed with 10% formaldehyde for 1 h, dehydrated in 60% isopropanol, and stained with oil red O (2.1 mg/ml in 60% isopropanol) for 10 min. Then the cells were washed with ddH2O for image acquiring.

e3 Developmental Cell 41, 382–391.e1–e5, May 22, 2017

Isolation of Embryonic and Postnatal Muscle Progenitor Cells (MPC) by FACS To obtain embryonic MPC, mouse embryos were isolated and minced by surgical scissors. Minced embryos were digested in Ham’s F10 with 10% horse serum and Collagenase II (400 U/ml, Gibco) at 37  C for 60 min. Digested embryos were washed in the washing medium (Ham’s F10 with 10% horse serum) and filtered with a 40 mm cell strainer (BD Falcon) for cell sorting. To obtain postnatal MPC, mice were sacrificed by cervical dislocation and hindlimb muscles were dissected and carefully minced with a scalpel followed by dissociation with Collagenase II (800 U/ml) (Thermo Fisher Scientific) in the washing medium at 37  C for 90 min. Digested muscles were triturated and washed in the washing medium before being subjected to further digestion with Collagenase II (80 U/ml) and Dispase (1 U/ml) (Thermo Fisher Scientific) for 30 min. The resulting suspensions were passed through a 20-Gauge needle attached to a syringe 15 times and filtered with a 40 mm cell strainer (BD Biosciences). Single cells were incubated with the following antibodies: FITC anti-CD31 (BioLegend), FITC anti-CD45 (BioLegend), Alexa 647 anti-Sca1 (BioLegend), Biotin anti-Vcam1 (BD Biosciences) and PE/Cy7 Streptavidin (BioLegend). MPC (CD31
/CD45
/Sca1
/Vcam1+) were sorted by a BD FACSAria II cell sorter (BD Biosciences). MPC marked with EYFP or GFP were sorted based on their autofluorescence. RNA-Seq and Data Analysis For library construction, briefly, purified RNA was fragmented via incubation for 5 min at 94 C with the Illumina-supplied fragmentation buffer. The first-strand of cDNA was synthesized by reverse transcription using random oligo primers. The second-strand synthesis was conducted by incubation with RNase H and DNA polymerase I. The resulting double-stranded DNA fragments were subsequently end-repaired, and PCR-amplified using Illumina-supplied primers. The purified library products were evaluated using a Bioanalyzer and SYBR qPCR and sequenced on an Illumina GAIIx sequencer (pair-end with 50 bp). The sequenced fragments were then mapped to the reference mouse genome using TopHat. Cufflinks was then used to estimate transcript abundance. Immunostaining 0.1% triton in phosphate-buffered saline (0.1% PBST) was used for all washing steps for cultured cells and muscle sections. Samples were fixed with 4% paraformaldehyde (PFA) for 5 min and permeabilized with 0.5% PBST for 20 min then blocked with 4% IgG-free BSA (Jackson Lab, 105696) in PBST for 1 h. For Pax7 staining, sections were boiled in 0.01 M citric acid at 90 C for antigen retrieval before blocking. Primary antibodies were applied to samples with indicated dilution factors and the samples were kept at 4 C overnight. Samples were washed 3 times and incubated with an appropriate secondary antibody for 1 h. The nuclei were counterstained with 100ng/ml 4’,6-diamidino-2-phenylindole (DAPI). After 3 times of washing, the samples were observed under a Nikon Upright fluorescent microscope (Ni-U). Images were captured with a DS-Qi2 Camera (Nikon). Primary antibodies and the dilution factors used were listed below: anti-UCP1 (ab10983, Abcam, 1:200); anti-GFP (ab6658, Abcam, 1:200); anti-Pax7 (Hybridoma Bank, 1:100); anti-E2F4 (sc-1082x, Santa Cruz, 1:200); anti-MyoD (M3512, Dako, 1:200). Immunoblotting Cells were lysed in the lysis buffer (50 mM Tris at pH 7.4, 10% glycerol, 1% Triton X-100, 150 mM NaCl, 1 mM EGTA, 1.5 mM MgCl2, 100 mM NaF, 20 mM PNPP, 20 mM b-glycerol phosphate, 2 mM dithiothreitol (DTT), 50 mM sodium vanadate, 0.5 mM phenylmethylsulfonyl fluoride, 2 mg/ml aprotinin, 0.5 mg/ml leupeptin, 0.7 mg/ml pepstatin). Cell lysate was separated on SDS-PAGE and the separated proteins from the gel were transferred to a PVDF membrane using a liquid transfer system (Bio-Rad). The membrane was blocked with 5% non-fat milk in TBST (1x TBS with 1% Tween-20) for 1 h at room temperature. The membrane was incubated with a primary antibody for 3 h at room temperature or overnight at 4 C with continuously shaking. After repeated washing, the membrane was then incubated in 5% non-fat milk containing a horseradish peroxidase conjugated secondary antibody for 1-2 h. The resultant bands were visualized by enhanced chemiluminesence (ECL) reagents. Primary antibodies and the dilution factors used were listed below: anti-Prdm16 (ab106410, Abcam, 1:1000), anti-GAPDH (AM4300, Ambion, 1:20000), anti-MyoD (sc-760, Santa Cruz, 1:1000), anti-Myf5 (sc-302, Santa Cruz, 1:1000), anti-E2F4 (sc-1082x, Santa Cruz, 1:2000), anti-p107 (sc-318x, Santa Cruz, 1:2000), anti-UCP1 (ab10983, Abcam, 1:2000). siRNA & miR-Inhibitor Transfection siRNAs or miR-inhibitors (30 nM final) were transiently transfected into C2C12 or FACS-isolated MPC by Lipofectamine RNAiMax reagent following manufacturer’s instructions. RNA Extraction and qRT-PCR Total RNA were extracted from cells with the TRIzol reagent. The ImProm-II Reverse Transcription System was used to reverse transcribe the total RNA into cDNA with an oligo-dT primer. Selected genes were amplified and detected by the 7500 Fast Real-Time PCR System with the SYBR Green dye and the relative gene expression was determined with the 2
DDCt method. All qPCR primers were listed in Table S1. Chromatin Immunoprecipitation About 3 million of C2C12 cells were harvested and fixed by 1% formaldehyde for 10 min. Nuclear fraction was extracted by hypotonic buffer and sonicated to generate 500 bp chromatin fragments. Immunoprecipitation was performed with 5 mg of the appropriate antibody bound to Protein G-Sepharose beads. After repeated washing with RIPA buffer, the immunoprecipitated chromatin fragments Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e4

were de-crosslinked and the associated proteins and RNAs were digested by Proteinase K and RNase A respectively. Free DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. qPCR was performed to measure the amount of the DNA. Adenoviral Infection For adenovirus production, 293A packaging cells were transfected at 100% confluence by Lipofectamine with 1 mg of pAd/BLOCKiT-DEST vectors carrying specific shRNA sequence. After 10 days, the viral supernatant was harvested for subsequent amplification and concentration. Cells were infected with the adenovirus-containing medium for 6 h. For intramuscular injection, crude viral supernatant was purified and concentrated by ViraBind Adenovirus Purification Kit. 50 ml of purified adenovirus (1.4x109 pfu/ml) was injected into TA muscles of 6-week-old mice to knock down intended target genes. Luciferase Reporter Assay The E-box-containing fragment (481 bp) in E2F4 promoter (+1176+1657) and the 1.5 kb fragment of Prdm16 promoter (-480+1060) containing two potential E2F4-binding sites were cloned into pGL3-promoter and pGL3-basic vectors (Promega) respectively. Two short fragments (Figure 4E) of Prdm16 promoter (#1:-6050;#2:580820) were cloned into pGL3-promoter vector. Three copies of the E2F4 binding sequences used in Figure 4F (WT: 5’CGGCCGCAGCCGCT; Mut: 5’CGGCCTCCTCCGCT) were cloned into pGL3-promoter vector. Luciferase activities were measured in a Lumat LB9507 luminometer (Berthold Technologies) using Dual-Luciferase Reporter Assay System kit (Promega). QUANTIFICATION AND STATISTICAL ANALYSIS Error bars in all figures represented standard deviation (s.d.). The Student’s t-test was employed to evaluate statistical significance with p<0.05 considered statistically significant. DATA AND SOFTWARE AVAILABILITY The accession number for the RNA-seq data reported in this paper is GEO: GSE97690. All datasets used in this paper are publically available and can be accessed through the accession numbers listed in the Key Resources Table. In addition, a list of software used in this study can also be found there.

e5 Developmental Cell 41, 382–391.e1–e5, May 22, 2017