- Email: [email protected]
A multigene approach for assessing evolutionary relationships of Xenorhabdus spp. (γ-Proteobacteria), the bacterial symbionts of entomopathogenic Steinernema nematodes
Journal of Invertebrate Pathology 104 (2010) 67–74
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
A multigene approach for assessing evolutionary relationships of Xenorhabdus spp. (c-Proteobacteria), the bacterial symbionts of entomopathogenic Steinernema nematodes Ming-Min Lee, S. Patricia Stock * Department of Entomology, University of Arizona, 1140 E. South Campus Dr., Tucson, AZ 85721-0036, United States
a r t i c l e
i n f o
Article history: Received 1 September 2009 Accepted 21 January 2010 Available online 25 January 2010 Keywords: 16s rDNAs Housekeeping genes Evolution Entomopathogenic Nematode symbionts
a b s t r a c t Xenorhabdus spp., are gram-negative bacterial symbionts of entomopathogenic nematodes in the genus Steinernema. A specialized and intimate relationship exists between nematode and bacteria, affecting many of their life history traits, such as nutrition, dispersal, host-finding, foraging and defense from biotic and abiotic factors. Xenorhabdus currently comprises more than 20 species isolated from Steinernema spp. with diverse host range, host foraging behavior, reproductive modes and environmental tolerance. Xenorhabdus phylogenies have historically been based on 16s rDNA sequence analyses, and only recently has data from housekeeping genes been employed. The prevalence of lateral gene transfer among bacteria calls for a wider perspective when considering their phylogeny. With the increasing number of Xenorhabdus species and strains, various perspectives need to be considered for investigating the evolutionary history of these nematode bacterial symbionts, In this study, we reconstruct the evolutionary histories of 30 species of Xenorhabdus considering the traditional 16s rDNA gene region as well as the housekeeping genes recA and serC. Datasets were analyzed individually and then combined, using a variety of phylogenetic criteria. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Enteric bacteria in the genus Xenorhabdus (Thomas and Poinar, 1979) (c-Proteobacteria) are obligate mutualists of entomopathogenic nematodes in the genus Steinernema (Travassos, 1927) (Rhabditida: Steinernematidae). This nematode-bacterium association forms a potent insecticidal complex (Gaugler and Kaya, 1990) whereby Xenorhabdus are vectored between arthropod hosts by the infective juvenile (IJ) stage of Steinernema spp. The bacteria live inside IJs in a specialized intestinal structure known as the receptacle (Snyder et al., 2007) until the nematodes invade a susceptible insect host. Once in the hemocoel, the IJs release the bacteria which contribute to the killing of the insect host. Through the production of bacteriocins, antibiotics (Akhurst, 1982) and antimicrobials, the bacteria create an exclusive environment that favors their growth and proliferation, as well as that of their nematode host. Xenorhabdus currently comprises more than 20 species (Koppenhöfer, 2007) isolated from Steinernema spp. with diverse host range, host foraging behavior, reproductive modes and environmental tolerance. Although Steinernema hosts have been well characterized, many bacterial species and isolates are yet to be * Corresponding author. Fax: +1 520 621 1150. E-mail address: [email protected] (S.P. Stock). 0022-2011/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2010.01.005
identified and fully described. Identification methods have spanned from total protein and isozyme profiles to DNA/DNA hybridization and sequence analysis of the 16s rDNA region (Boemare and Akhurst, 2007; Akhurst and Boemare, 1990). Xenorhabdus phylogenies have thus far been based on 16s rDNA sequence analyses (Liu et al., 1997; Tailliez et al., 2006, 2009) have produced the most extensive surveys of Xenorhabdus species and isolates, with over 70 strains sampled using phenotypic characterization, ERIC and RAPD profiling, RFLP pattern analysis as well as nucleotide data from multiple genes. The 16s rDNA gene region has been extensively surveyed both for inferring phylogenetic relationships and for identification and characterization of bacterial species. (Christensen et al., 1998; Ibrahim et al., 1993; Leblond-Bourget et al., 1996). In spite of the widely accepted use of this gene for diagnostic purposes and phylogenetic inference, many studies have shown lack of variation between 16s rDNA sequences (Wertz et al., 2003; Dauga, 2002; Cilia et al., 1996). It follows that Tailliez et al. (2006) noted 16s rDNA sequence divergence between any two Xenorhabdus species was low (3–5%). Moreover, lateral gene transfer (LGT), especially among enteric bacteria, has become a confounding factor in determining phylogenies for prokaryotes. The exact level of gene transfer is not known for Xenorhabdus bacteria, but is thought to occur even at the deepest branches of the Enterobacteriaceae (Doolittle, 1999).
68
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
In this respect, and to expand the gene repertoire considered for phylogenetic studies in prokaryotes, Lan and Reeves (2001, 2000) suggested consideration of other genes such as core housekeeping genes. These genes are known to be resistant to high levels of LGT because there is little selective advantage to acquiring a novel function—unlike the high selective pressure for gaining genes such as pathogenicity islands and those that encode toxins, which may play an important role in adaptation to local environments. Housekeeping genes are being increasingly used to infer phylogenies because they are highly expressed and highly conserved, yet evolve at a rate faster than 16s rDNA, therefore making them useful for species level comparisons (Lawrence et al., 1991). Akhurst et al. (2004) considered the DNA gyrase subunit B (gyrB) gene to both clarify the taxonomic status and assess the evolutionary relationships between Photorhabdus species and strains, the bacterial symbionts of Heterorhabditis nematodes (Heterorhabditidae). In their study, gyrB gene sequences proved to be a useful marker for inferring relationships at the intraspecific level. Recently, Tailliez et al. (in press) used multilocus sequence analysis (MLSA) to infer evolutionary relationships among Xenorhabdus and Photorhabdus spp. In this study, five protein-coding genes (recA, gyrB, dnaN, rplB, gtlX) and 16s rDNA sequence datasets were analyzed singly and as a combined dataset primarily using distance methods. Although their data provides valuable information from a taxonomic perspective (i.e. nucleotide identity analysis for bacterial species), their phylogenetic hypotheses were highly unresolved, shedding limited insight onto Xenorhabdus evolutionary relationships. This background information clearly reflects one of the fundamental problems in phylogenetic inference, that analysis of a single gene may reflect the genealogy of the gene, but not of the species itself (Nei, 1987). Even in cases where multiple genes are under scrutiny, the topology and level of resolution in resultant trees are contingent on the method of analysis used. In this study, we investigated evolutionary histories of 30 Xenorhabdus species and strains, employing the traditional 16s rDNA gene region as well as two housekeeping genes: recA (encodes a recombinase protein) and serC (encodes the enzyme phosphoserine aminotransferase) in both single gene and combined dataset analysis. To date, the serC gene has not been used to infer phylogenetic relationships among Xenorhabdus bacteria, neither have Bayesian or maximum likelihood (ML) criteria been applied to these individual and combined datasets.
2. Materials and methods 2.1. Taxon sampling and bacterial isolation Xenorhabdus spp. considered in this study were isolated from the collection of Steinernema nematodes housed at the P. Stock Laboratory (Department of Entomology, University of Arizona). Bacterial isolates used in this study are listed in Table 1. Steinernema nematodes were propagated in vivo by passage through Galleria mellonella (L.) (Lepidoptera: Pyralidae) last instar larvae (Timberline Fisheries, Inc., IL) following procedures described by Kaya and Stock (1997). IJs were harvested from modified White Traps and stored in 15 °C incubators. Xenorhabdus strains were isolated from either (1) 48 h infected G. mellonella cadavers (modified from Akhurst, 1980), or (2) directly extracted from freshly harvested (<2 wk old) cultures of IJ (Heungens et al., 2002). In the first method, cadavers infected for 48 h with Steinernema sp. were surface-sterilized for 1 min each in 1% bleach and 70% ethanol, then rinsed in sterile water and blotted dry on UV treated filter paper. Sterile forceps were used to nip the cuticle behind the head capsule and a roughly 50 ll drop of hemolymph was gently squeezed into
500 ll of Luria–Bertani (LB) (Miller, 1972) broth. Broth was then streaked onto nutrient bromothymol blue agar (NBTA) (Akhurst, 1980; Woodring and Kaya, 1988), as described below. For the second bacterial isolation method, IJs (<2 wk old) were surface-sterilized in 0.5% bleach solution, followed by three rinses with sterile deionized water. IJs were then recovered and added to 2 ml LB broth and sonicated for 2 min. Sonicated suspension was then spread onto NBTA plates as described below. The two methods were used interchangeably when Xenorhabdus cultures failed to grow, or when contaminating bacteria (most commonly Proteus sp., Serratia sp. and Delftia sp.) were detected, preventing successful isolation of single Xenorhabdus colonies. Contaminating bacteria may be harbored between the cuticle layers of the nematode IJs or could be present in either the hemocoel or on surface of the infected cadaver (Gouge and Snyder, 2006). Bacteria were cultured on NBTA following procedures described by Akhurst (1980) and incubated in the dark at 28 °C for up to 3 days. Plates were supplemented with 0.1% (wt/vol) pyruvite (Xu and Hurlbert, 1990) and with antibiotics (Vivas and Goodrich-Blair, 2001) as needed. Single phase I colonies were isolated and grown in LB broth for subsequent DNA extraction and production of permanent glycerol stocks (1:1 LB:Glycerol), which were stored at 80 °C. 2.2. DNA extraction and PCR conditions Bacterial DNA was obtained from liquid LB cultures and extracted following a modified phenol–chloroform procedure (Maloy, 1990). Briefly, cells were lysed in a 54°C water bath overnight, a phenol–chloroform extraction was performed, DNA precipitated with molecular grade ethyl alcohol and 3 M sodium acetate, and subsequently resuspended in molecular grade water. Additionally, cells from bacterial colonies and LB broth were sequenced directly after an initial 8 min denaturing period. PCR primers and cycle conditions were described previously (Tailliez et al., 2006; Sergeant et al., 2006), except that a seminested PCR strategy was used to obtain serC sequences when Sergeant et al. methods did not work for the following species: Xenorhabdus stockiae, Xenorhabdus budapestensis, Xenorhabdus nematophila (Steinernema carpocapsae), Xenorhabdus bovienii (Steinernema puntauvense), Xenorhabdus hominickii, and Xenorhabdus cabanillasii. The primers used for the semi-nested approach are unique to this work, and cycle conditions were the same except that reactions only ran for 25 cycles. Primer information is given in Table 2. All PCR amplifications were performed in a MyCycler (BioRad) thermal cycler. The 16s rDNA conditions were as follows: 94 °C for 2 min, followed by 34 cycles of 94 °C/1 min, 52 °C/30 s, 72 °C/1 min with a final extension time of 10 min at 72 °C. The serC and recA genes were amplified with an initial denature period of 94 °C for 2 min, followed by 30 cycles of 94 °C/15 s, 52 °C/30 s and 72 °C/45 s with a final 72 °C extension period of 7 min. All products were examined by standard electrophoresis on a 1% agarose gel. The length of the 16s rDNA region was 1500 bps, recA 420 bps, and serC was 670 bps. 2.3. Sequence editing and alignment Contig assembly and sequence ambiguity resolution was performed with the aid of SeqEdit and EditSeq software (DNA Star Inc., Madison, WI) Multiple sequence alignments were performed using ClustalX v1.83.1 (Thompson et al., 1997) under default alignment parameters. Alignment inconsistencies were corrected by hand in Mesquite v2.6 (Maddison and Maddison, 2009). Sequences corresponding to the PCR amplification primers were removed prior to multiple sequence alignment and phylogenetic analysis. Protein translations were made for the two housekeeping genes
69
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74 Table 1 List of Xenorhabdus spp. and strains used in this study. Xenorhabdus sp.
Nematode host
Nematode isolate name/origin
GenBank accession numbers (16s, serC, recA)
X. beddingii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. budapestensis X. cabanillasii X. doucetiae X. griffiniae X. hominickii X. indica X. innexi X. kozodoii X. kozodoii X. nematophila X. nematophila X. nematophila X. poinarii X. stockiae X. szentirmaii X. szentirmaii Xenorhabdus sp. X. vietnamensis.
S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S.
B2/China Reading/UK Bodega Bay/CA, USA SN/France Florida/FL, USA Type isolate/SC, USA Type isolate/IL, USA Quebec/Quebec, Canada OS-10/OR, USA Bubbling ponds AZ, USA Li6/Costa Rica Turkey/Turkey Type isolate/Serbia, TX isolate, TX, USA Type isolate/FL, USA T87/Malaysia Mt. Jiri/Korea S01/India Type isolate/Uruguay, USA Type isolate/Italy Grand Travers/France Al-Jubiha/Jordan ALL/USA Peru/Peru NC1/USA T9/Thailand CR9/Costa Rica Sargento Cabral/Argentina R00I-293/South Africa Type isolate/Vietnam,
GU480984, GU480967, GU480975, GU480976, GU480977, GU480980, GU480981, GU480983, GU480986, GU480987, GU480988, GU480995, GU480970, GU480990, GU480974, GU480979, GU480985, GU480966, GU480992, GU480969, GU480971, GU480968, GU480972, GU480994, GU480978, GU480993, GU480973, GU480989,
longicaudum affine feltiae feltiae feltiae intermedium jollieti kraussei oregonense oregonense puntauvense weiseri bicornutum riobrave diaprepesi hermaphroditum monticolum abbasi scapterisci apuliae boemarei anatoliense carpocapsae websteri glaseri siamkayai costaricense rarum khoisanae sangi
GU481014, GU481044 GU480997, GU481027 GU481005, GU481035 GU481006, GU481036 GU481007, GU481037 GU481010, GU481040 GU481011, GU481041 GU481013, GU481043 GU481016, GU481046 GU481017, GU481047 GU481018, GU481048 GU481025, GU481055 GU481000, GU481030 GU481020, GU481050 GU481004, GU481034 GU481009, GU481039 GU481015, GU481045 GU480996, GU481026 GU481022, GU481052 GU480999, GU481029 GU481001, GU481031 GU480998, GU481028 GU481002, GU481032 GU481024, GU481054 GU481008, GU481038 GU481023, GU481053 GU481003, GU481033 GU481019, GU481049
GU480991, GU481021, GU481051
Genebank accession numbers will be provided upon acceptance of manuscript.
Table 2 Primers considered in this study. Primer
Region
Orientation
5–3 Sequence
16SP1a 16SP2a SP1a SP2a recAb recA-Rb serCb serC-Rb serC-F1 serC-F2 serC-F3 serC-R1 serC-R2
16s rDNA 16s rDNA 16s rDNA 16s rDNA recA recA serC serC serC serC serC serC serC
Fwd Rev Rev Rev Fwd Rev Fwd Rev Fwd Fwd Fwd Rev Rev
GAAGAGTTGATCATGGCTC AAGGAGGTGATCCAGCCGCA ACCGCGGCTGCTGGCACG CTCGTTGCGGGACTTAAC CCAATGGGCCGTATTGTTGA TCATACGGATCTGGTTGATGAA CCACCAGCAACTTTGTCCTTTC AAAGAAGCAGAAAAATATTGCAC CGTTTGCTGATTTCYTGTAA CAACRCGGTTGATATACA CCCTGCTCTTTCARCCA CCKGATTTTGGYGAYGATAA TATTGYCCTAATGAAAC
serc internal primers were designed for this study. a Tailliez et al. (2006). b Sergeant et al. (2006).
but only serC provided a sufficient number of phylogenetically informative characters. Finally, Xenorhabdus genes were concatenated into two matrices: (1) an all-nucleotide dataset, and (2) a mixed dataset containing nucleotide data for 16s rDNA and recA, and a protein translation of serC. All sequences generated in this study were deposited in GenBank. Accession numbers are listed in Table 1.
parsimonious trees per replicate. All most parsimonious trees were saved (data not shown). Bootstrap parsimony analyses were also performed using the heuristic search method (10,000 replicates with 10 random addition pseudoreplicates each). Maximum likelihood methods were conducted in RAxML v.7.0.4 (Stamatakis, 2006), running 100 search replicates per dataset. MrModeltest (Nylander, 2004) was used to determine the models used to analyze each gene in the concatenated datasets for Bayesian analysis. The data were partitioned accordingly and executed in MrBayes (Huelsenbeck and Ronquist, 2001) with two runs of Markov-Chain Monte-Carlo each containing one cold chain and three hot chains, sampling trees every 1000th generation for a total of 100,000,000 generations. In the case of the mixed dataset, runs were stopped when the convergence statistic stalled for 20 million generations, and runs for the all-nucleotide dataset were stopped when the convergence statistic (average standard deviation of split frequencies, r) fell below 0.01, as long as those values following r < 0.01 were seen to stabilize, as viewed graphically in Tracer v1.3 (Rambaut and Drummond, 2007). Burn-in trees (the first 25% of trees) from each run were discarded and the remaining trees combined to generate a 50% majority rule consensus tree in MrBayes. 3. Results 3.1. Gene trees
2.4. Phylogenetic analysis Each dataset was analyzed by unweighted maximum parsimony (MP) using PAUP* v4.0b10 (Swofford, 2002) for comparison with model based trees, except for the concatenated mixed dataset (for which only a Bayesian analysis was performed). In each case, tree searches were performed using heuristic methods consisting of 10,000 random addition replicates, saving no more than 10 most
Maximum parsimony and maximum likelihood trees inferred from the nucleotide sequence of all genes and from the protein translation of serC are given in Figs. 1–4. Of 1400 characters used in the 16s rDNA analysis, 109 were parsimony informative. The recA dataset contained 423 characters, of which 109 were parsimony informative. A total of 666 characters were analyzed in the serC nucleotide dataset, with 256 being informative. The protein
70
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
Fig. 1. Trees from 16s rDNA analysis. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
Fig. 2. Results of recA analyses. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
translation of the serC gene yielded 52 parsimony informative characters out of a total of 217.
In the individual tree reconstructions, most species formed tight clusters that were monophyletic in most cases. X. nematophila, the
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
71
Fig. 3. Results of serC nucleotide analyses. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
type species for Xenorhabdus, was always clustered closely, but did not form a monophyletic group in the serC protein analysis. The two isolates of Xenorhabdus kozodoii were consistently sister to one another, and in all cases except the maximum likelihood reconstruction for recA, X. bovienii isolates were grouped in one clade that also monophyletic. The most notable exception to species clustering is that the two Xenorhabdus szentirmaii representatives only form a clade in the 16s rDNA parsimony inference, but in all other cases they are considerably distant for bacteria considered the same species. Interestingly, the X. bovienii isolate from Steinernema feltiae (Bodega Bay, CA, USA) was always grouped with the two X. bovienii isolates originating from different strains of Steinernema oregonense instead of with the other X. bovienii isolates of S. feltiae. Regardless of the inference method used, topology of the trees did not change much for a given gene, however species topology between genes varied considerably. Of note is the position of the X. bovienii group. When rooted with E. coli, this group is less derived on the recA phylogeny, as well as the serC protein trees. However, they were considerably more derived on the 16s rDNA and serC nucleotide trees. A similar scenario occurred for the X. nematophila group. In fact, no two species relationships remain consistent between genes in these comparisons.
3.2. Combined analysis Because mixed datasets are difficult to analyze, except within the Bayesian framework, only those trees recovered by MrBayes were compared.
As with individual gene trees, the two combined Bayesian analyses of the concatenated data differed in topology, yet succeeded in clustering similar species together, except in the case of X. szentirmaii. In both the reconstructions (Fig. 5), two Xenorhabdus species from southeast Asia, Xenorhabdus griffiniae and the uncharacterized bacteria isolated from S. sangi, consistently formed a strongly supported clade, as did Xenorhabdus innexi/X. stockiae and X. budapestensis/X. cabanillasii. Lastly, the position of Xenorhabdus indica is not adequately supported in the combined datasets (<50% posterior probability), or in any of the gene trees. The posterior probabilities supporting the deep branches of the mixed dataset were considerably higher than those obtained for the nucleotide analysis and on average, terminal branching also had slightly higher posterior probabilities for the mixed data.
4. Discussion This work represents a multigene approach to inferring the evolutionary history of Xenorhabdus spp. It illuminates alternate phylogenies to those traditionally known from the 16s rDNA region, yet leaves much to be resolved. It also expands on another multigene approach recently published by Tailliez et al. (in press) where sequence data from 16s rDNA and five housekeeping genes were used to clarify the taxonomic status of Xenorhabdus and Photorhabdus spp. Although gene topologies were not in concurrence in our study, and two very different trees emerged from the combined analyses, this pattern is consistent with multi-gene phylogenies of enteric bacteria, especially when housekeeping genes were used in con-
72
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
Fig. 4. Trees from serC protein analysis. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
Fig. 5. Bayesian analysis of combined datasets from (A) nucleotide data and (B) mixed nucleotide and protein dataset (posterior probabilities shown). Clades labeled according Tailliez et al. (2009).
junction with 16s rDNA (Roggenkamp, 2007; Wertz et al., 2003; Dauga, 2002; Mollet et al., 1997). Additionally, trees obtained from our analysis present alternate topologies when compared with pre-
viously published results by Tailliez et al. (in press, 2006), echoing the current wisdom that species relationships cannot be inferred from the use of a single gene.
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
However, some similarities were observed between species groupings in the Bayesian analyses and the distance tree produced by Tailliez et al. (2006). Those are the X. innexi/X. stockiae group, called ‘G3’ in Tailliez’s analysis, and the clusters of X. kozodoii and X. bovienii isolates called ‘G4’ and ‘G8’, respectively. In the most recent study by Tailliez et al. (in press), distance analysis of the 16s rDNA and recA datasets show slightly different tree topologies and a lower level of resolution for all clades when compared to the trees generated in this study. For instance, Tailliez et al. (in press) depicted X. indica and X. cabanillasii as being sister in the 16s rDNA reconstruction, while they are quite distant in the phylogenies generated here by Bayesian and ML methods. The deepest levels of the Xenorhabdus recA tree remain unresolved in the 2009 analysis by Tailliez et al., but the phylogenetic methods used in their study posit X. bovienii to be the basal clade. The combined analysis of five housekeeping genes in the Tailliez et al. study roughly agree with our Bayesian analysis of concatenated data using the protein translation of serC. The two topologies show a clade containing X. stockiae, X. innexi, X. indica, X. cabanillasii and X. budapestensis as most basal (referred to as CX-IV in Tailliez et al., in press), followed by a clade containing all X. bovienii isolates. A slight difference between the two is that our ‘‘CX-IV” group also contains X. hominickii, though this species is not consistently grouped therein when examining single genes, or in the all-nucleotide concatenated dataset. As previously stated, mixed datasets are difficult to analyze, except within the Bayesian framework. Therefore, differences observed between our study and those by Tailliez et al. (in press) may be due not only to differences in taxon sampling and selection of a rather dissimilar suite of genes but also because of methods considered for phylogenetic inference (again, only distance analyses were considered by Tailliez et al. (2006, in press). Many possibilities exist to explain the discrepancy between genes, including the incidence of LGT among enteric bacteria. Although housekeeping genes are posited to be resistant to transfer, the occurrence of ancient transfers is unknown, as are the current barriers to LGT in Xenorhabdus bacteria. Another factor influencing gene histories is the level of evolutionary pressure placed on them. For instance, the recA gene is essential for DNA repair and replication, and its protein translation is extremely conserved (and phylogenetically uninformative for this group). In contrast, serC nucleotides and amino acid translations display a higher ratio of variable characters than recA suggesting more selective pressure. The serC gene plays an essential role in amino acid biosynthesis and has been implicated in receptacle colonization success in X. nematophila (Heungens et al., 2002). Although serC mutants have not been explored in other Xenorhabdus species, there is a possibility that it may play a different role in the colonization events of various Xenorhabdus species, whose associations with Steinernema are known to be highly specialized. The choice of serC in this study, and the disjunct phylogenies produced dependent on the level of analysis (nucleotide or amino acid datasets) highlight both its power when included in reconstruction of this group, and the need to examine the utility of other housekeeping genes on the protein level. Next, the phylogenetic signal of each individual gene may be too weak to infer robust evolutionary relationships. Low node values and a high incidence of unresolved branches in our bootstrap analyses may be an indication of low signal to noise ratio (data not shown). The number of informative sites increases as genes are concatenated together, and the use of combined datasets has been successful in recovering well-supported trees consistent with fossil records, rRNA based analyses and morphological data. Additional protein-coding genes may be useful in resolving the differences between the two concatenated datasets. Although the methods between our work and the prior studies by Tailliez et al.
73
(2006, in press) differ, the emergent commonalities between phylogenetic trees can only serve to form a clearer understanding of Xenorhabdus relationships. Lastly, the highly disparate position of the two X. szentirmaii representatives on the trees is puzzling. X. szentirmaii was originally isolated and characterized from Steinernema rarum (Lengyel et al., 2005). The second X. szentirmaii isolate comes from a Costa Rican nematode, Steinernema costaricense. Analysis of 16s rDNA sequences indicated this strain is only 95% similar to the X. szentirmaii type strain which is not conclusive evidence to support species identity (Uribe-Lorío et al., 2008). Although the symbiont of S. costaricense is currently considered to be X. szentirmaii, there is current evidence from molecular and phenotypic testing that points out the symbiont of S. costaricense is indeed a new uncharacterized Xenorhabdus sp. (Uribe-Lorío pers. comm.) Moreover, revision of the Xenorhabdus phylogeny must follow revision of their Steinernema hosts. It should be noted in Tailliez’s et al. study (in press) the identity of Xenorhabdus ehlersii is questionable, in light of its denoted host, Steinernema serratum, which is currently being considered a strain of Steinernema longicaudum (Qiu et al., 2004), and that Steinernema thermophilum is no longer a valid species (currently considered a junior synonym of Steinernema abbasi), such that both strains of X. indica are likely to arise from two isolates of S. abbasi. Therefore, we encourage careful identification and validation of current nematode hosts species names in future work in the field of Xenorhabdus phylogenetics.
Acknowledgments This research was funded by a National Science Foundation Grant to S.P. Stock (NSF-DEB award no. 060899 and REU supplements NSF-DEB – 0733729, 0918278, 0924125). We also acknowledge Rousel Orozco and Rachel Russell for assisting with bacterial rearing and in generating preliminary data for this study. We are also thankful to David Maddison, Wendy Moore, Kojun Kanda and Paul Marek (U. Arizona) for insightful discussion and advice provided for phylogenetic analyses. This study constituted partial fulfillment for Ming-Min Lee’s Masters degree.
References Akhurst, R.J., 1980. Morphological and functional dimorphism in Xenorhabdus spp., bacteria symbiotically associated with the insect pathogenic nematodes Neoaplectana and Heterorhabditis. Journal of General Microbiology 121, 303– 309. Akhurst, R.J., 1982. Antibiotic activity of Xenorhabdus spp., bacteria symbiotically associated with insect pathogenic nematodes of the families Heterorhabditidae and Steinernematidae. Journal of General Microbiology 128, 3061–3065. Akhurst, R.J., Boemare, N.E., 1990. Biology and taxonomy of Xenorhabdus. In: Gaugler, R., Kaya, H.K. (Eds.), Entomopathogenic Nematodes in Biological Control. Boca Raton, FL, CRC Press, pp. 75–90. Akhurst, R.J., Boemare, N.E., Janssen, P.H., Peel, M.M., Alfredson, D.A., Beard, C.E., 2004. Taxonomy of Australian clinical isolates of the genus Photorhabdus and proposal of Photorhabdus asymbiotica subsp. Asymbiotica subsp. nov. and P. asymbiotica subsp. australis subsp. nov. International Journal of Systematic and Evolutionary Microbiology 54, 1301–1310. Boemare, N.E., Akhurst, R.J., 2007. The Genera Photorhabdus and Xenorhabdus. In: Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.-H., Stackebrandt (Eds.), The Prokaryotes. New York, NY, Springer, pp. 473–488. Christensen, H., Nordentoft, S., Olsen, J.E., 1998. Phylogenetic relationships of Salmonella based on rRNA sequences. Journal of Systematic Bacteriology 48, 605–610. Cilia, V., Lafay, B., Christen, R., 1996. Sequence heterogeneities among 16S ribosomal RNA sequences, and their effect on phylogenetic analyses at the species level. Molecular Biology and Evolution 13, 451–461. Dauga, C., 2002. Evolution of the gyrB gene and the molecular phylogeny of Enterobacteriaceae: a model molecule for molecular studies. Journal of Systematic and Evolutionary Microbiology 52, 531–547. Doolittle, W.M., 1999. Lateral genomics. Trends in Biochemistry Science 24, M5– M8. Gaugler, R., Kaya, H.K., 1990. Entomopathogenic Nematodes in Biological Control. CRC Press, Boca Raton, FL.
74
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
Gouge, D.H., Snyder, J.L., 2006. Temporal association of entomopathogenic nematodes (Rhabditida: Steinernematidae and Heterorhabditidae) and bacteria. Journal of Invertebrate Pathology 91, 147–157. Heungens, K., Cowles, C.E., Goodrich-Blair, H., 2002. Identification of Xenorhabdus nematophila genes required for mutualistic colonization of Steinernema carpocapsae nematodes. Molecular Microbiology 45, 1337–1353. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17, 754–755. Ibrahim, A., Goebel, B.M., Liesack, W., Griffiths, M., Stackebrandt, E., 1993. The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiology Letters 114, 173–178. Kaya, H.K., Stock, S.P., 1997. Techniques in insect nematology. In: Lacey, L.A. (Ed.), Manual of Techniques in Insect Pathology. Academic Press, San Diego, pp. 281– 322. Koppenhöfer, H., 2007. Bacterial Symbionts of Steinernema and Heterorhabditis. In: Nguyen, K.B., Hunt, D.J. (Eds.), Entomopathogenic Nematodes: Systematics, Phylogeny and Bacterial Symbionts. Brill, Leiden-Boston, pp. 735–759. Lan, R.T., Reeves, P.R., 2000. Intraspecies variation in bacterial genomes: the need for a species genome concept. Trends in Microbiology 8, 396–401. Lan, R.T., Reeves, P.R., 2001. When does a clone deserve a name? A perspective on bacterial species based on population genetics. Trends in Microbiology 9, 419– 424. Lawrence, J.G., Ochman, H., Hartl, D.L., 1991. Molecular and evolutionary relationships among enteric bacteria. Journal of General Microbiology 137, 1911–1921. Leblond-Bourget, N., Philippe, H., Mangin, I., Decaris, B., 1996. 16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter and intraspecific Bifidobacterium phylogeny. International Journal of Systematic Bacteriology 46, 102–111. Lengyel, K., Lang, E., Fodor, A., Szallas, E., Schumann, P., Stackebrandt, E., 2005. Description of four novel species of Xenorhabdus, family Enterobacteriaceae: Xenorhabdus budapestensis sp. nov., Xenorhabdus ehlersii sp. nov., Xenorhabdus innexi sp. nov., Xenorhabdus szentirmaii sp. nov. Systematic and Applied Microbiology 28, 115–122. Liu, J., Berry, R., Poinar, G., Moldenke, A., 1997. Phylogeny of Photorhabdus and Xenorhabdus species and strains as determined by comparison of partial 16S rRNA gene sequences. International Journal of Systematic Bacteriology 47, 948– 951. Maddison, W.P., Maddison, D.R., 2009. Mesquite: a modular system for evolutionary analysis. Version 2.6.. Maloy, S.R., 1990. Experimental Techniques in Bacterial Genetics. Jones and Bartlett, Boston, MA. Miller, J.H., 1972. Experiments in Molecular Genetics. Cold Springs Harbor Laboratory Press, Cold Springs Harbor, NY. Mollet, C., Drancourt, M., Raoult, D., 1997. RpoB sequence analysis as a novel basis for bacterial identification. Molecular Microbiology 26, 1005–1011. Nei, M., 1987. Molecular Evolutionary Genetics. Columbia University Press, New York. Nylander, J.A.A., 2004. MrModeltest v2.3. Program Distributed by the Author. Evolutionary Biology Centre, Uppsala University. Qiu, L., Fang, Y., Zhou, Y., Pang, Y., Nguyen, Khuong B., 2004. Steinernema guangdongense sp. N. (Nematoda: Steinernematidae), a new entomopathogenic
nematode from southern China with a note on S. serratum (nomen nudum). Zootaxa 104, 1–20. Rambaut, A., Drummond, A.J., 2007. Tracer v1.4. Roggenkamp, A., 2007. Phylogenetic analysis of enteric species of the family Enterobacteriaceae using oriC-locus. Systematic and Applied Microbiology 30, 180–188. Sergeant, M., Baxter, L., Jarrett, P., Shaw, E., Ousley, M., Winstanley, C., Morgan, J.A.W., 2006. Identification, typing and insecticidal activity of Xenorhabdus isolates from entomopathogenic nematodes in United Kingdom soil and characterization of the xpt toxin loci. Applied and Environmental Microbiology 72, 5895–5907. Snyder, H., Stock, S.P., Flores-Lara, Y., Kim, S.K., Forst, S., 2007. New insights into the colonization and release process of Xenorhabdus nematophila and the morphology and ultrastructure of the bacterial receptacle of its nematode host, Steinernema carpocapsae. Applied and Environmental Microbiology 73, 5338–5346. Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688– 2690. Swofford, D.L., 2002. PAUP Phylogenetic Analysis Using Parsimony ( and Other Methods). Sinauer Associates, Sunderland, Massachusetts. Tailliez, P., Pages, S., Ginibre, N., Boemare, N., 2006. New insights into diversity in the genus Xenorhabdus, including the description of ten novel species. International Journal of Systematic and Evolutionary Microbiology 56, 2805– 2818. Tailliez, P., Laroui, C., Ginibre, N., Paule, A., Pages, S., Boemare, N., in press. Phylogeny of Photorhabdus and Xenorhabdus based on universally conserved proteincoding sequences and implications for the taxonomy of these two genera. International Journal of Systematic and Evolutionary Microbiology. Thomas, G.M., Poinar Jr., G.O., 1979. Xenorhabdus gen. nov., a genus of entornopathogenic, nematophilic bacteria of the family Enterobacteriuceme. International Journal of Systematic Bacteriology 29, 352–360. Thompson, J.D., Gibston, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface. Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24, 4876–4882. Travassos, L., 1927. Sobre o genera Oxysomatium. Boletim Biologico Sao 5, 20–21. Uribe-Lorío, L., Stock, S.P., Navarro, D., Castillo, E., Mora, M., 2008. Biochemical and molecular characterization of symbiotic bacteria of four Steinernema from Costa Rica, S. costaricense n.sp. (CR9), S. puntauvense n. sp. (Li6), S. websterii (CR5) and Steinernema sp. (T4) 41th Annual Meeting of the Society for Invertebrate Pathology, August 2008, University of Warwick, Coventry, UK. p. 34. Vivas, E.I., Goodrich-Blair, H., 2001. Xenorhabdus nematophilus as a model for hostbacterium interactions: rpoS is necessary for mutualism with nematodes. Journal of Bacteriology 183, 4687–4693. Wertz, J.E., Goldstone, C., Gordon, D.M., Riley, M.A., 2003. A molecular phylogeny of enteric bacteria and implications for bacterial species concept. Journal of Evolutionary Biology 16, 1236–1248. Woodring, J.L., Kaya, H.K., 1988. Steinernematid and Heterorhabditid Nematodes: a Handbook of Biology and Techniques. Arkansas Agricultural Experiment Station Nematode Subcommittee of the Southern Regional Project S-135 Entomopathogens for use in Pest-Management Systems, Fayetteville, Arkansas. Xu, J., Hurlbert, J.A., 1990. Toxicity of irradiated media for Xenorhabdus spp. Applied and Environmental Microbiology 56, 815–818.
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
A multigene approach for assessing evolutionary relationships of Xenorhabdus spp. (c-Proteobacteria), the bacterial symbionts of entomopathogenic Steinernema nematodes Ming-Min Lee, S. Patricia Stock * Department of Entomology, University of Arizona, 1140 E. South Campus Dr., Tucson, AZ 85721-0036, United States
a r t i c l e
i n f o
Article history: Received 1 September 2009 Accepted 21 January 2010 Available online 25 January 2010 Keywords: 16s rDNAs Housekeeping genes Evolution Entomopathogenic Nematode symbionts
a b s t r a c t Xenorhabdus spp., are gram-negative bacterial symbionts of entomopathogenic nematodes in the genus Steinernema. A specialized and intimate relationship exists between nematode and bacteria, affecting many of their life history traits, such as nutrition, dispersal, host-finding, foraging and defense from biotic and abiotic factors. Xenorhabdus currently comprises more than 20 species isolated from Steinernema spp. with diverse host range, host foraging behavior, reproductive modes and environmental tolerance. Xenorhabdus phylogenies have historically been based on 16s rDNA sequence analyses, and only recently has data from housekeeping genes been employed. The prevalence of lateral gene transfer among bacteria calls for a wider perspective when considering their phylogeny. With the increasing number of Xenorhabdus species and strains, various perspectives need to be considered for investigating the evolutionary history of these nematode bacterial symbionts, In this study, we reconstruct the evolutionary histories of 30 species of Xenorhabdus considering the traditional 16s rDNA gene region as well as the housekeeping genes recA and serC. Datasets were analyzed individually and then combined, using a variety of phylogenetic criteria. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Enteric bacteria in the genus Xenorhabdus (Thomas and Poinar, 1979) (c-Proteobacteria) are obligate mutualists of entomopathogenic nematodes in the genus Steinernema (Travassos, 1927) (Rhabditida: Steinernematidae). This nematode-bacterium association forms a potent insecticidal complex (Gaugler and Kaya, 1990) whereby Xenorhabdus are vectored between arthropod hosts by the infective juvenile (IJ) stage of Steinernema spp. The bacteria live inside IJs in a specialized intestinal structure known as the receptacle (Snyder et al., 2007) until the nematodes invade a susceptible insect host. Once in the hemocoel, the IJs release the bacteria which contribute to the killing of the insect host. Through the production of bacteriocins, antibiotics (Akhurst, 1982) and antimicrobials, the bacteria create an exclusive environment that favors their growth and proliferation, as well as that of their nematode host. Xenorhabdus currently comprises more than 20 species (Koppenhöfer, 2007) isolated from Steinernema spp. with diverse host range, host foraging behavior, reproductive modes and environmental tolerance. Although Steinernema hosts have been well characterized, many bacterial species and isolates are yet to be * Corresponding author. Fax: +1 520 621 1150. E-mail address: [email protected] (S.P. Stock). 0022-2011/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2010.01.005
identified and fully described. Identification methods have spanned from total protein and isozyme profiles to DNA/DNA hybridization and sequence analysis of the 16s rDNA region (Boemare and Akhurst, 2007; Akhurst and Boemare, 1990). Xenorhabdus phylogenies have thus far been based on 16s rDNA sequence analyses (Liu et al., 1997; Tailliez et al., 2006, 2009) have produced the most extensive surveys of Xenorhabdus species and isolates, with over 70 strains sampled using phenotypic characterization, ERIC and RAPD profiling, RFLP pattern analysis as well as nucleotide data from multiple genes. The 16s rDNA gene region has been extensively surveyed both for inferring phylogenetic relationships and for identification and characterization of bacterial species. (Christensen et al., 1998; Ibrahim et al., 1993; Leblond-Bourget et al., 1996). In spite of the widely accepted use of this gene for diagnostic purposes and phylogenetic inference, many studies have shown lack of variation between 16s rDNA sequences (Wertz et al., 2003; Dauga, 2002; Cilia et al., 1996). It follows that Tailliez et al. (2006) noted 16s rDNA sequence divergence between any two Xenorhabdus species was low (3–5%). Moreover, lateral gene transfer (LGT), especially among enteric bacteria, has become a confounding factor in determining phylogenies for prokaryotes. The exact level of gene transfer is not known for Xenorhabdus bacteria, but is thought to occur even at the deepest branches of the Enterobacteriaceae (Doolittle, 1999).
68
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
In this respect, and to expand the gene repertoire considered for phylogenetic studies in prokaryotes, Lan and Reeves (2001, 2000) suggested consideration of other genes such as core housekeeping genes. These genes are known to be resistant to high levels of LGT because there is little selective advantage to acquiring a novel function—unlike the high selective pressure for gaining genes such as pathogenicity islands and those that encode toxins, which may play an important role in adaptation to local environments. Housekeeping genes are being increasingly used to infer phylogenies because they are highly expressed and highly conserved, yet evolve at a rate faster than 16s rDNA, therefore making them useful for species level comparisons (Lawrence et al., 1991). Akhurst et al. (2004) considered the DNA gyrase subunit B (gyrB) gene to both clarify the taxonomic status and assess the evolutionary relationships between Photorhabdus species and strains, the bacterial symbionts of Heterorhabditis nematodes (Heterorhabditidae). In their study, gyrB gene sequences proved to be a useful marker for inferring relationships at the intraspecific level. Recently, Tailliez et al. (in press) used multilocus sequence analysis (MLSA) to infer evolutionary relationships among Xenorhabdus and Photorhabdus spp. In this study, five protein-coding genes (recA, gyrB, dnaN, rplB, gtlX) and 16s rDNA sequence datasets were analyzed singly and as a combined dataset primarily using distance methods. Although their data provides valuable information from a taxonomic perspective (i.e. nucleotide identity analysis for bacterial species), their phylogenetic hypotheses were highly unresolved, shedding limited insight onto Xenorhabdus evolutionary relationships. This background information clearly reflects one of the fundamental problems in phylogenetic inference, that analysis of a single gene may reflect the genealogy of the gene, but not of the species itself (Nei, 1987). Even in cases where multiple genes are under scrutiny, the topology and level of resolution in resultant trees are contingent on the method of analysis used. In this study, we investigated evolutionary histories of 30 Xenorhabdus species and strains, employing the traditional 16s rDNA gene region as well as two housekeeping genes: recA (encodes a recombinase protein) and serC (encodes the enzyme phosphoserine aminotransferase) in both single gene and combined dataset analysis. To date, the serC gene has not been used to infer phylogenetic relationships among Xenorhabdus bacteria, neither have Bayesian or maximum likelihood (ML) criteria been applied to these individual and combined datasets.
2. Materials and methods 2.1. Taxon sampling and bacterial isolation Xenorhabdus spp. considered in this study were isolated from the collection of Steinernema nematodes housed at the P. Stock Laboratory (Department of Entomology, University of Arizona). Bacterial isolates used in this study are listed in Table 1. Steinernema nematodes were propagated in vivo by passage through Galleria mellonella (L.) (Lepidoptera: Pyralidae) last instar larvae (Timberline Fisheries, Inc., IL) following procedures described by Kaya and Stock (1997). IJs were harvested from modified White Traps and stored in 15 °C incubators. Xenorhabdus strains were isolated from either (1) 48 h infected G. mellonella cadavers (modified from Akhurst, 1980), or (2) directly extracted from freshly harvested (<2 wk old) cultures of IJ (Heungens et al., 2002). In the first method, cadavers infected for 48 h with Steinernema sp. were surface-sterilized for 1 min each in 1% bleach and 70% ethanol, then rinsed in sterile water and blotted dry on UV treated filter paper. Sterile forceps were used to nip the cuticle behind the head capsule and a roughly 50 ll drop of hemolymph was gently squeezed into
500 ll of Luria–Bertani (LB) (Miller, 1972) broth. Broth was then streaked onto nutrient bromothymol blue agar (NBTA) (Akhurst, 1980; Woodring and Kaya, 1988), as described below. For the second bacterial isolation method, IJs (<2 wk old) were surface-sterilized in 0.5% bleach solution, followed by three rinses with sterile deionized water. IJs were then recovered and added to 2 ml LB broth and sonicated for 2 min. Sonicated suspension was then spread onto NBTA plates as described below. The two methods were used interchangeably when Xenorhabdus cultures failed to grow, or when contaminating bacteria (most commonly Proteus sp., Serratia sp. and Delftia sp.) were detected, preventing successful isolation of single Xenorhabdus colonies. Contaminating bacteria may be harbored between the cuticle layers of the nematode IJs or could be present in either the hemocoel or on surface of the infected cadaver (Gouge and Snyder, 2006). Bacteria were cultured on NBTA following procedures described by Akhurst (1980) and incubated in the dark at 28 °C for up to 3 days. Plates were supplemented with 0.1% (wt/vol) pyruvite (Xu and Hurlbert, 1990) and with antibiotics (Vivas and Goodrich-Blair, 2001) as needed. Single phase I colonies were isolated and grown in LB broth for subsequent DNA extraction and production of permanent glycerol stocks (1:1 LB:Glycerol), which were stored at 80 °C. 2.2. DNA extraction and PCR conditions Bacterial DNA was obtained from liquid LB cultures and extracted following a modified phenol–chloroform procedure (Maloy, 1990). Briefly, cells were lysed in a 54°C water bath overnight, a phenol–chloroform extraction was performed, DNA precipitated with molecular grade ethyl alcohol and 3 M sodium acetate, and subsequently resuspended in molecular grade water. Additionally, cells from bacterial colonies and LB broth were sequenced directly after an initial 8 min denaturing period. PCR primers and cycle conditions were described previously (Tailliez et al., 2006; Sergeant et al., 2006), except that a seminested PCR strategy was used to obtain serC sequences when Sergeant et al. methods did not work for the following species: Xenorhabdus stockiae, Xenorhabdus budapestensis, Xenorhabdus nematophila (Steinernema carpocapsae), Xenorhabdus bovienii (Steinernema puntauvense), Xenorhabdus hominickii, and Xenorhabdus cabanillasii. The primers used for the semi-nested approach are unique to this work, and cycle conditions were the same except that reactions only ran for 25 cycles. Primer information is given in Table 2. All PCR amplifications were performed in a MyCycler (BioRad) thermal cycler. The 16s rDNA conditions were as follows: 94 °C for 2 min, followed by 34 cycles of 94 °C/1 min, 52 °C/30 s, 72 °C/1 min with a final extension time of 10 min at 72 °C. The serC and recA genes were amplified with an initial denature period of 94 °C for 2 min, followed by 30 cycles of 94 °C/15 s, 52 °C/30 s and 72 °C/45 s with a final 72 °C extension period of 7 min. All products were examined by standard electrophoresis on a 1% agarose gel. The length of the 16s rDNA region was 1500 bps, recA 420 bps, and serC was 670 bps. 2.3. Sequence editing and alignment Contig assembly and sequence ambiguity resolution was performed with the aid of SeqEdit and EditSeq software (DNA Star Inc., Madison, WI) Multiple sequence alignments were performed using ClustalX v1.83.1 (Thompson et al., 1997) under default alignment parameters. Alignment inconsistencies were corrected by hand in Mesquite v2.6 (Maddison and Maddison, 2009). Sequences corresponding to the PCR amplification primers were removed prior to multiple sequence alignment and phylogenetic analysis. Protein translations were made for the two housekeeping genes
69
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74 Table 1 List of Xenorhabdus spp. and strains used in this study. Xenorhabdus sp.
Nematode host
Nematode isolate name/origin
GenBank accession numbers (16s, serC, recA)
X. beddingii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. bovienii X. budapestensis X. cabanillasii X. doucetiae X. griffiniae X. hominickii X. indica X. innexi X. kozodoii X. kozodoii X. nematophila X. nematophila X. nematophila X. poinarii X. stockiae X. szentirmaii X. szentirmaii Xenorhabdus sp. X. vietnamensis.
S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S. S.
B2/China Reading/UK Bodega Bay/CA, USA SN/France Florida/FL, USA Type isolate/SC, USA Type isolate/IL, USA Quebec/Quebec, Canada OS-10/OR, USA Bubbling ponds AZ, USA Li6/Costa Rica Turkey/Turkey Type isolate/Serbia, TX isolate, TX, USA Type isolate/FL, USA T87/Malaysia Mt. Jiri/Korea S01/India Type isolate/Uruguay, USA Type isolate/Italy Grand Travers/France Al-Jubiha/Jordan ALL/USA Peru/Peru NC1/USA T9/Thailand CR9/Costa Rica Sargento Cabral/Argentina R00I-293/South Africa Type isolate/Vietnam,
GU480984, GU480967, GU480975, GU480976, GU480977, GU480980, GU480981, GU480983, GU480986, GU480987, GU480988, GU480995, GU480970, GU480990, GU480974, GU480979, GU480985, GU480966, GU480992, GU480969, GU480971, GU480968, GU480972, GU480994, GU480978, GU480993, GU480973, GU480989,
longicaudum affine feltiae feltiae feltiae intermedium jollieti kraussei oregonense oregonense puntauvense weiseri bicornutum riobrave diaprepesi hermaphroditum monticolum abbasi scapterisci apuliae boemarei anatoliense carpocapsae websteri glaseri siamkayai costaricense rarum khoisanae sangi
GU481014, GU481044 GU480997, GU481027 GU481005, GU481035 GU481006, GU481036 GU481007, GU481037 GU481010, GU481040 GU481011, GU481041 GU481013, GU481043 GU481016, GU481046 GU481017, GU481047 GU481018, GU481048 GU481025, GU481055 GU481000, GU481030 GU481020, GU481050 GU481004, GU481034 GU481009, GU481039 GU481015, GU481045 GU480996, GU481026 GU481022, GU481052 GU480999, GU481029 GU481001, GU481031 GU480998, GU481028 GU481002, GU481032 GU481024, GU481054 GU481008, GU481038 GU481023, GU481053 GU481003, GU481033 GU481019, GU481049
GU480991, GU481021, GU481051
Genebank accession numbers will be provided upon acceptance of manuscript.
Table 2 Primers considered in this study. Primer
Region
Orientation
5–3 Sequence
16SP1a 16SP2a SP1a SP2a recAb recA-Rb serCb serC-Rb serC-F1 serC-F2 serC-F3 serC-R1 serC-R2
16s rDNA 16s rDNA 16s rDNA 16s rDNA recA recA serC serC serC serC serC serC serC
Fwd Rev Rev Rev Fwd Rev Fwd Rev Fwd Fwd Fwd Rev Rev
GAAGAGTTGATCATGGCTC AAGGAGGTGATCCAGCCGCA ACCGCGGCTGCTGGCACG CTCGTTGCGGGACTTAAC CCAATGGGCCGTATTGTTGA TCATACGGATCTGGTTGATGAA CCACCAGCAACTTTGTCCTTTC AAAGAAGCAGAAAAATATTGCAC CGTTTGCTGATTTCYTGTAA CAACRCGGTTGATATACA CCCTGCTCTTTCARCCA CCKGATTTTGGYGAYGATAA TATTGYCCTAATGAAAC
serc internal primers were designed for this study. a Tailliez et al. (2006). b Sergeant et al. (2006).
but only serC provided a sufficient number of phylogenetically informative characters. Finally, Xenorhabdus genes were concatenated into two matrices: (1) an all-nucleotide dataset, and (2) a mixed dataset containing nucleotide data for 16s rDNA and recA, and a protein translation of serC. All sequences generated in this study were deposited in GenBank. Accession numbers are listed in Table 1.
parsimonious trees per replicate. All most parsimonious trees were saved (data not shown). Bootstrap parsimony analyses were also performed using the heuristic search method (10,000 replicates with 10 random addition pseudoreplicates each). Maximum likelihood methods were conducted in RAxML v.7.0.4 (Stamatakis, 2006), running 100 search replicates per dataset. MrModeltest (Nylander, 2004) was used to determine the models used to analyze each gene in the concatenated datasets for Bayesian analysis. The data were partitioned accordingly and executed in MrBayes (Huelsenbeck and Ronquist, 2001) with two runs of Markov-Chain Monte-Carlo each containing one cold chain and three hot chains, sampling trees every 1000th generation for a total of 100,000,000 generations. In the case of the mixed dataset, runs were stopped when the convergence statistic stalled for 20 million generations, and runs for the all-nucleotide dataset were stopped when the convergence statistic (average standard deviation of split frequencies, r) fell below 0.01, as long as those values following r < 0.01 were seen to stabilize, as viewed graphically in Tracer v1.3 (Rambaut and Drummond, 2007). Burn-in trees (the first 25% of trees) from each run were discarded and the remaining trees combined to generate a 50% majority rule consensus tree in MrBayes. 3. Results 3.1. Gene trees
2.4. Phylogenetic analysis Each dataset was analyzed by unweighted maximum parsimony (MP) using PAUP* v4.0b10 (Swofford, 2002) for comparison with model based trees, except for the concatenated mixed dataset (for which only a Bayesian analysis was performed). In each case, tree searches were performed using heuristic methods consisting of 10,000 random addition replicates, saving no more than 10 most
Maximum parsimony and maximum likelihood trees inferred from the nucleotide sequence of all genes and from the protein translation of serC are given in Figs. 1–4. Of 1400 characters used in the 16s rDNA analysis, 109 were parsimony informative. The recA dataset contained 423 characters, of which 109 were parsimony informative. A total of 666 characters were analyzed in the serC nucleotide dataset, with 256 being informative. The protein
70
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
Fig. 1. Trees from 16s rDNA analysis. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
Fig. 2. Results of recA analyses. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
translation of the serC gene yielded 52 parsimony informative characters out of a total of 217.
In the individual tree reconstructions, most species formed tight clusters that were monophyletic in most cases. X. nematophila, the
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
71
Fig. 3. Results of serC nucleotide analyses. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
type species for Xenorhabdus, was always clustered closely, but did not form a monophyletic group in the serC protein analysis. The two isolates of Xenorhabdus kozodoii were consistently sister to one another, and in all cases except the maximum likelihood reconstruction for recA, X. bovienii isolates were grouped in one clade that also monophyletic. The most notable exception to species clustering is that the two Xenorhabdus szentirmaii representatives only form a clade in the 16s rDNA parsimony inference, but in all other cases they are considerably distant for bacteria considered the same species. Interestingly, the X. bovienii isolate from Steinernema feltiae (Bodega Bay, CA, USA) was always grouped with the two X. bovienii isolates originating from different strains of Steinernema oregonense instead of with the other X. bovienii isolates of S. feltiae. Regardless of the inference method used, topology of the trees did not change much for a given gene, however species topology between genes varied considerably. Of note is the position of the X. bovienii group. When rooted with E. coli, this group is less derived on the recA phylogeny, as well as the serC protein trees. However, they were considerably more derived on the 16s rDNA and serC nucleotide trees. A similar scenario occurred for the X. nematophila group. In fact, no two species relationships remain consistent between genes in these comparisons.
3.2. Combined analysis Because mixed datasets are difficult to analyze, except within the Bayesian framework, only those trees recovered by MrBayes were compared.
As with individual gene trees, the two combined Bayesian analyses of the concatenated data differed in topology, yet succeeded in clustering similar species together, except in the case of X. szentirmaii. In both the reconstructions (Fig. 5), two Xenorhabdus species from southeast Asia, Xenorhabdus griffiniae and the uncharacterized bacteria isolated from S. sangi, consistently formed a strongly supported clade, as did Xenorhabdus innexi/X. stockiae and X. budapestensis/X. cabanillasii. Lastly, the position of Xenorhabdus indica is not adequately supported in the combined datasets (<50% posterior probability), or in any of the gene trees. The posterior probabilities supporting the deep branches of the mixed dataset were considerably higher than those obtained for the nucleotide analysis and on average, terminal branching also had slightly higher posterior probabilities for the mixed data.
4. Discussion This work represents a multigene approach to inferring the evolutionary history of Xenorhabdus spp. It illuminates alternate phylogenies to those traditionally known from the 16s rDNA region, yet leaves much to be resolved. It also expands on another multigene approach recently published by Tailliez et al. (in press) where sequence data from 16s rDNA and five housekeeping genes were used to clarify the taxonomic status of Xenorhabdus and Photorhabdus spp. Although gene topologies were not in concurrence in our study, and two very different trees emerged from the combined analyses, this pattern is consistent with multi-gene phylogenies of enteric bacteria, especially when housekeeping genes were used in con-
72
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
Fig. 4. Trees from serC protein analysis. (A) Bayesian analysis showing posterior probabilities and (B) best maximum likelihood tree. Numbers on branches indicate bootstrap values.
Fig. 5. Bayesian analysis of combined datasets from (A) nucleotide data and (B) mixed nucleotide and protein dataset (posterior probabilities shown). Clades labeled according Tailliez et al. (2009).
junction with 16s rDNA (Roggenkamp, 2007; Wertz et al., 2003; Dauga, 2002; Mollet et al., 1997). Additionally, trees obtained from our analysis present alternate topologies when compared with pre-
viously published results by Tailliez et al. (in press, 2006), echoing the current wisdom that species relationships cannot be inferred from the use of a single gene.
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
However, some similarities were observed between species groupings in the Bayesian analyses and the distance tree produced by Tailliez et al. (2006). Those are the X. innexi/X. stockiae group, called ‘G3’ in Tailliez’s analysis, and the clusters of X. kozodoii and X. bovienii isolates called ‘G4’ and ‘G8’, respectively. In the most recent study by Tailliez et al. (in press), distance analysis of the 16s rDNA and recA datasets show slightly different tree topologies and a lower level of resolution for all clades when compared to the trees generated in this study. For instance, Tailliez et al. (in press) depicted X. indica and X. cabanillasii as being sister in the 16s rDNA reconstruction, while they are quite distant in the phylogenies generated here by Bayesian and ML methods. The deepest levels of the Xenorhabdus recA tree remain unresolved in the 2009 analysis by Tailliez et al., but the phylogenetic methods used in their study posit X. bovienii to be the basal clade. The combined analysis of five housekeeping genes in the Tailliez et al. study roughly agree with our Bayesian analysis of concatenated data using the protein translation of serC. The two topologies show a clade containing X. stockiae, X. innexi, X. indica, X. cabanillasii and X. budapestensis as most basal (referred to as CX-IV in Tailliez et al., in press), followed by a clade containing all X. bovienii isolates. A slight difference between the two is that our ‘‘CX-IV” group also contains X. hominickii, though this species is not consistently grouped therein when examining single genes, or in the all-nucleotide concatenated dataset. As previously stated, mixed datasets are difficult to analyze, except within the Bayesian framework. Therefore, differences observed between our study and those by Tailliez et al. (in press) may be due not only to differences in taxon sampling and selection of a rather dissimilar suite of genes but also because of methods considered for phylogenetic inference (again, only distance analyses were considered by Tailliez et al. (2006, in press). Many possibilities exist to explain the discrepancy between genes, including the incidence of LGT among enteric bacteria. Although housekeeping genes are posited to be resistant to transfer, the occurrence of ancient transfers is unknown, as are the current barriers to LGT in Xenorhabdus bacteria. Another factor influencing gene histories is the level of evolutionary pressure placed on them. For instance, the recA gene is essential for DNA repair and replication, and its protein translation is extremely conserved (and phylogenetically uninformative for this group). In contrast, serC nucleotides and amino acid translations display a higher ratio of variable characters than recA suggesting more selective pressure. The serC gene plays an essential role in amino acid biosynthesis and has been implicated in receptacle colonization success in X. nematophila (Heungens et al., 2002). Although serC mutants have not been explored in other Xenorhabdus species, there is a possibility that it may play a different role in the colonization events of various Xenorhabdus species, whose associations with Steinernema are known to be highly specialized. The choice of serC in this study, and the disjunct phylogenies produced dependent on the level of analysis (nucleotide or amino acid datasets) highlight both its power when included in reconstruction of this group, and the need to examine the utility of other housekeeping genes on the protein level. Next, the phylogenetic signal of each individual gene may be too weak to infer robust evolutionary relationships. Low node values and a high incidence of unresolved branches in our bootstrap analyses may be an indication of low signal to noise ratio (data not shown). The number of informative sites increases as genes are concatenated together, and the use of combined datasets has been successful in recovering well-supported trees consistent with fossil records, rRNA based analyses and morphological data. Additional protein-coding genes may be useful in resolving the differences between the two concatenated datasets. Although the methods between our work and the prior studies by Tailliez et al.
73
(2006, in press) differ, the emergent commonalities between phylogenetic trees can only serve to form a clearer understanding of Xenorhabdus relationships. Lastly, the highly disparate position of the two X. szentirmaii representatives on the trees is puzzling. X. szentirmaii was originally isolated and characterized from Steinernema rarum (Lengyel et al., 2005). The second X. szentirmaii isolate comes from a Costa Rican nematode, Steinernema costaricense. Analysis of 16s rDNA sequences indicated this strain is only 95% similar to the X. szentirmaii type strain which is not conclusive evidence to support species identity (Uribe-Lorío et al., 2008). Although the symbiont of S. costaricense is currently considered to be X. szentirmaii, there is current evidence from molecular and phenotypic testing that points out the symbiont of S. costaricense is indeed a new uncharacterized Xenorhabdus sp. (Uribe-Lorío pers. comm.) Moreover, revision of the Xenorhabdus phylogeny must follow revision of their Steinernema hosts. It should be noted in Tailliez’s et al. study (in press) the identity of Xenorhabdus ehlersii is questionable, in light of its denoted host, Steinernema serratum, which is currently being considered a strain of Steinernema longicaudum (Qiu et al., 2004), and that Steinernema thermophilum is no longer a valid species (currently considered a junior synonym of Steinernema abbasi), such that both strains of X. indica are likely to arise from two isolates of S. abbasi. Therefore, we encourage careful identification and validation of current nematode hosts species names in future work in the field of Xenorhabdus phylogenetics.
Acknowledgments This research was funded by a National Science Foundation Grant to S.P. Stock (NSF-DEB award no. 060899 and REU supplements NSF-DEB – 0733729, 0918278, 0924125). We also acknowledge Rousel Orozco and Rachel Russell for assisting with bacterial rearing and in generating preliminary data for this study. We are also thankful to David Maddison, Wendy Moore, Kojun Kanda and Paul Marek (U. Arizona) for insightful discussion and advice provided for phylogenetic analyses. This study constituted partial fulfillment for Ming-Min Lee’s Masters degree.
References Akhurst, R.J., 1980. Morphological and functional dimorphism in Xenorhabdus spp., bacteria symbiotically associated with the insect pathogenic nematodes Neoaplectana and Heterorhabditis. Journal of General Microbiology 121, 303– 309. Akhurst, R.J., 1982. Antibiotic activity of Xenorhabdus spp., bacteria symbiotically associated with insect pathogenic nematodes of the families Heterorhabditidae and Steinernematidae. Journal of General Microbiology 128, 3061–3065. Akhurst, R.J., Boemare, N.E., 1990. Biology and taxonomy of Xenorhabdus. In: Gaugler, R., Kaya, H.K. (Eds.), Entomopathogenic Nematodes in Biological Control. Boca Raton, FL, CRC Press, pp. 75–90. Akhurst, R.J., Boemare, N.E., Janssen, P.H., Peel, M.M., Alfredson, D.A., Beard, C.E., 2004. Taxonomy of Australian clinical isolates of the genus Photorhabdus and proposal of Photorhabdus asymbiotica subsp. Asymbiotica subsp. nov. and P. asymbiotica subsp. australis subsp. nov. International Journal of Systematic and Evolutionary Microbiology 54, 1301–1310. Boemare, N.E., Akhurst, R.J., 2007. The Genera Photorhabdus and Xenorhabdus. In: Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.-H., Stackebrandt (Eds.), The Prokaryotes. New York, NY, Springer, pp. 473–488. Christensen, H., Nordentoft, S., Olsen, J.E., 1998. Phylogenetic relationships of Salmonella based on rRNA sequences. Journal of Systematic Bacteriology 48, 605–610. Cilia, V., Lafay, B., Christen, R., 1996. Sequence heterogeneities among 16S ribosomal RNA sequences, and their effect on phylogenetic analyses at the species level. Molecular Biology and Evolution 13, 451–461. Dauga, C., 2002. Evolution of the gyrB gene and the molecular phylogeny of Enterobacteriaceae: a model molecule for molecular studies. Journal of Systematic and Evolutionary Microbiology 52, 531–547. Doolittle, W.M., 1999. Lateral genomics. Trends in Biochemistry Science 24, M5– M8. Gaugler, R., Kaya, H.K., 1990. Entomopathogenic Nematodes in Biological Control. CRC Press, Boca Raton, FL.
74
M.-M. Lee, S.P. Stock / Journal of Invertebrate Pathology 104 (2010) 67–74
Gouge, D.H., Snyder, J.L., 2006. Temporal association of entomopathogenic nematodes (Rhabditida: Steinernematidae and Heterorhabditidae) and bacteria. Journal of Invertebrate Pathology 91, 147–157. Heungens, K., Cowles, C.E., Goodrich-Blair, H., 2002. Identification of Xenorhabdus nematophila genes required for mutualistic colonization of Steinernema carpocapsae nematodes. Molecular Microbiology 45, 1337–1353. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17, 754–755. Ibrahim, A., Goebel, B.M., Liesack, W., Griffiths, M., Stackebrandt, E., 1993. The phylogeny of the genus Yersinia based on 16S rDNA sequences. FEMS Microbiology Letters 114, 173–178. Kaya, H.K., Stock, S.P., 1997. Techniques in insect nematology. In: Lacey, L.A. (Ed.), Manual of Techniques in Insect Pathology. Academic Press, San Diego, pp. 281– 322. Koppenhöfer, H., 2007. Bacterial Symbionts of Steinernema and Heterorhabditis. In: Nguyen, K.B., Hunt, D.J. (Eds.), Entomopathogenic Nematodes: Systematics, Phylogeny and Bacterial Symbionts. Brill, Leiden-Boston, pp. 735–759. Lan, R.T., Reeves, P.R., 2000. Intraspecies variation in bacterial genomes: the need for a species genome concept. Trends in Microbiology 8, 396–401. Lan, R.T., Reeves, P.R., 2001. When does a clone deserve a name? A perspective on bacterial species based on population genetics. Trends in Microbiology 9, 419– 424. Lawrence, J.G., Ochman, H., Hartl, D.L., 1991. Molecular and evolutionary relationships among enteric bacteria. Journal of General Microbiology 137, 1911–1921. Leblond-Bourget, N., Philippe, H., Mangin, I., Decaris, B., 1996. 16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter and intraspecific Bifidobacterium phylogeny. International Journal of Systematic Bacteriology 46, 102–111. Lengyel, K., Lang, E., Fodor, A., Szallas, E., Schumann, P., Stackebrandt, E., 2005. Description of four novel species of Xenorhabdus, family Enterobacteriaceae: Xenorhabdus budapestensis sp. nov., Xenorhabdus ehlersii sp. nov., Xenorhabdus innexi sp. nov., Xenorhabdus szentirmaii sp. nov. Systematic and Applied Microbiology 28, 115–122. Liu, J., Berry, R., Poinar, G., Moldenke, A., 1997. Phylogeny of Photorhabdus and Xenorhabdus species and strains as determined by comparison of partial 16S rRNA gene sequences. International Journal of Systematic Bacteriology 47, 948– 951. Maddison, W.P., Maddison, D.R., 2009. Mesquite: a modular system for evolutionary analysis. Version 2.6.
nematode from southern China with a note on S. serratum (nomen nudum). Zootaxa 104, 1–20. Rambaut, A., Drummond, A.J., 2007. Tracer v1.4.