A multiple single nucleotide polymorphisms interrogation assay for reliable Potato virus Y group and variant characterization

Available online at www.sciencedirect.com

Journal of Virological Methods 147 (2008) 108–117

A multiple single nucleotide polymorphisms interrogation assay for reliable Potato virus Y group and variant characterization Mathieu Rolland a,b , Laurent Glais a , Camille Kerlan a , Emmanuel Jacquot a,∗ a

INRA, Agrocampus Rennes, UMR1099 BiO3P (Biology of Organisms and Populations Applied to Plant Protection), F-35653 Le Rheu, France b FNPPPT (F´ ed´eration Nationale des Producteurs de Plants de Pomme de Terre), 9 rue d’Ath`enes, 75009 Paris, France Received 4 April 2007; received in revised form 6 August 2007; accepted 22 August 2007 Available online 10 October 2007

Abstract The complex Potato virus Y classification, including groups (PVYN and PVYO ) and variants (PVYNTN and PVYN -W), is based mainly on biological properties of isolates. Published PVY detection tools targeting markers not associated with biological properties could fail to assign correctly isolates in the current classification. To improve PVY detection tools, a single nucleotide polymorphism (SNaPshot) detection assay was developed. The technique was adapted to target the T/C9259 , A/C2271 , G/C8573 and A/G2213 PVY polymorphic nucleotides. The “TAGA”, “CCCG”, “CACA” and “CAGA” four-digit codes associated with tested samples allowed identification of PVYN , PVYO , PVYN -W and PVYNTN isolates, respectively. The PVY SNaPshot procedure is efficient and reliable for PVY detection and characterization in samples containing as few as 102 viral RNA copies. Moreover, PVY group assignment is possible for fractions containing only 10 copies of a PVY RNA genome. Finally, the SNaPshot assay allows PVYN /PVYO dual characterization for mixed samples containing PVYN /PVYO quantity ratios in the range of 0.1–10. This innovative SNaPshot tool improved clearly PVY diagnostic assays described previously by targeting simultaneously major functional markers and sequence unlinked to biological properties used separately in PVY detection tools available currently. © 2007 Elsevier B.V. All rights reserved. Keywords: Potyvirus; Tetraplex detection; Single nucleotide extension; SNP

1. Introduction Potato virus Y (PVY) is the type member of the genus Potyvirus (family Potyviridae). The PVY genome is composed of a single-stranded, positive-sense RNA molecule of about 10 kb in length, with a VPg protein attached covalently to its 5 -end and a poly-A tail at its 3 -end (Shukla et al., 1994). The viral RNA encodes a single large polypeptide, which is cleaved by three virus encoded proteases into nine products (Dougherty and Carrington, 1988). This plant virus, transmitted by aphids in a non-persistent manner (Sigvald, 1984), is one of the five most economically damaging plant viruses (Milne, 1988; Shukla et al., 1994). Indeed, PVY presents a wide host range including Solanaceae family members (e.g. tobacco, tomato, pepper and potato) and can induce high yield losses of crops important economically (Latorre et al., 1984; Van der Zaag, 1987).

∗

Corresponding author. Tel.: +33 2 23 48 58 17; fax: +33 2 23 48 51 80. E-mail address: [email protected] (E. Jacquot).

0166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2007.08.022

The extensive biological, serological and molecular variability of PVY isolates supports the complex classification of PVY isolates into strains (according to the infected host sampled originally), groups (based mainly on symptoms induced in indicator hosts and on abilities to overcome selected resistance sources) and putative variants (grouping isolates with particular properties). The PVY potato strain includes three groups corresponding to PVYN , PVYO and PVYC (De Bokx and Hunttinga, 1981). Isolates belonging to PVYN induce systemic veinal necrosis symptoms on Nicotiana tabacum cv. Xanthi leaves and very mild mottling with occasional necrotic leaves on potato. PVYO isolates induce mottling and mosaic symptoms on tobacco plants, and mild to severe mosaic and leaf drop on potato. Finally, PVYC isolates induce stipple streak symptoms on some potato cultivars. Based on such different biological properties, PVY surveys in potato-growing areas have been carried efficiently out for more than 50 years. The development in the early 1980s of serological techniques specific for PVYN or PVYO isolates has also improved the biologically based PVY diagnostic procedures by reducing time and space required for virus detection

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

and group characterization (Gugerli and Fries, 1983). However, PVY became, for potato growers, a major agronomical problem in the 1980s with the emergence and the spread of the PVYN -W (Chrzanowska, 1991) and PVYNTN (Le Romancer et al., 1994) variants. Indeed, PVYN -W isolates, characterized as PVYO group members by serological tools, present biological properties close to those of PVYN isolates while PVYNTN variants possess the capacity to induce the potato tuber necrotic ringspot disease (PTNRD) (Beczner et al., 1984). Due to the unreliable serological results associated with PVYN -W isolates and to the enhanced necrotic property of the PVYNTN isolates, one of the main challenges in PVY research programs is the development of efficient and reliable tool(s) for PVY group and variant identification. The development of molecular technologies allowed the study of the genetic diversity of PVY isolates. Complete or partial sequencing of PVY genomic RNA were carried out. These studies have shown the presence of recombination site(s) between PVYN and PVYO sequences in the PVYN -W and PVYNTN variants (Glais et al., 1998, 2002). As an alternative to serological assays and according to the steady improvement of molecular methods, more specific and sensitive molecular tools were developed progressively (Glais et al., 2005; Lorenzen et al., 2006; Moravec et al., 2003; Nie and Singh, 2002, 2003b; Rosner and Maslenin, 1999; Szemes et al., 2002). Almost all published tests use recombination sites within the PVY genome as targets for specific detection of PVYN , PVYN -W, PVYNTN and/or PVYO isolates by reverse transcription polymerase chain reaction (RT-PCR). However, as these targeted molecular markers are not known to be linked to the biological properties used for PVY classification (i.e. necrosis capacity), these tools could fail in assignment of PVY isolates to appropriate group and/or variant. Recently, molecular determinants involved in necrosis capacity of PVY isolates have been

109

identified (Tribodet et al., 2005) and used to develop innovative PVYN /PVYO characterization tools (Balme-Sinibaldi et al., 2006; Jacquot et al., 2005). However, the latter do not allow identification of PVYN -W and PVYNTN variants. Since their first description in Hungary and Poland, these variants have been studied extensively for their geographic distribution (BlancoUrgoiti et al., 1998; Crosslin et al., 2002; Kerlan et al., 1999; McDonald and Singh, 1996; Nie and Singh, 2003a; Ohshima et al., 2000; Salazar et al., 2000). Collected data have shown that PVY variants have spread rapidly and are prevalent in many countries. This reinforces the requirement for improved PVY detection tools. The objective of this study was to set up a single assay for PVY group and variant detection/characterization that combines data associated with molecular determinants involved in the necrosis capacity of PVY isolates and the genetic status of PVY genomes (recombinant or not). In order to reach these objectives, the SNaPshot multiple single nucleotide interrogation technique was adapted to PVY sequence detection. 2. Materials and methods 2.1. Viruses and host plants Nineteen potato PVY isolates (5 PVYO , 4 PVYN , 5 PVYNTN and 5 PVYN -W), characterized biologically, serologically and molecularly, maintained individually on N. tabacum cv. Xanthi, were used as control samples in this study (Table 1). Sixty samples collected in the field from PVY-infected potato plants were used as unknown samples for PVY group and variant characterization assays. Such PVY isolates were tested with the SNaPshot assay, characterized serologically and biologically on N. tabacum cv. Xanthi. All infected material was maintained in a regulated insect-proof greenhouse.

Table 1 Origin, characteristics and references of PVY isolates used as standards Group or variant

Isolate

Origin

Serotypea

Recombinantb

Reference

O

139 L73 L26 L11 L84

Canada France France France France

YO YO YO YO YO

No No No No No

Singh and Singh (1996a,b) From this report From this report From this report From this report

N

605 Sp20 Sp125 B7

Switzerland Spain Spain France

YN YN YN YN

No No No No

Jakab et al. (1997) Blanco-Urgoiti et al. (1998) Blanco-Urgoiti et al. (1998) Jacquot et al. (2005)

France France France France France

Y

NTN

FrOrl L29 L94 L115 L138

YN YN YN YN

Yes Yes Yes Yes Yes

Glais et al. (1996) From this report From this report From this report From this report

N-W

i-P B15 N324 N341 L10

Poland France France France France

YO YO YO YO YO

Yes Yes Yes Yes Yes

Glais et al. (1998) Jacquot et al. (2005) Jacquot et al. (2005) Jacquot et al. (2005) From this report

a b

N

Results according to DAS-ELISA performed using PVYN or PVYO specific antibodies as described in Jacquot et al. (2005). The presence of recombination site(s) in the tested PVY genomes was identified using RT-PCR assays previously published in Glais et al. (2002).

110

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

2.2. Serological detection of PVY Leaf tissue (0.5 g) from non-inoculated leaves of N. tabacum cv. Xanthi plants or from field-collected potatoes were sampled and ground in 1ml of cold grinding buffer (PBS, 0.05% (v/v) Tween 20). PVY detection in samples was carried out using DAS-ELISA protocol as described previously (Jacquot et al., 2005). Briefly, PVY polyclonal antibodies (FNPPPTINRA, France) were used in the coating step of the ELISA procedure. One hundred microlitres of plant sap was used for each tested sample. Mouse-derived monoclonal antibodies conjugated to alkaline phosphatase and raised against PVYN (Bioreba, Switzerland) or PVYO/C (Adgen, UK) were used according to the expected specificity of the detection assay. Phosphatase enzyme activity was tested using p-nitrophenyl phosphate substrate (1 mg/ml) in appropriate alkaline buffer and the absorbance of samples was read at 405 nm using a microplate reader. 2.3. Nucleic acid extraction Total RNA from healthy or PVY-infected N. tabacum cv. Xanthi leaves, or from field-collected potato leaves were extracted using SV Total RNA Isolation System® (Promega) according to the manufacturer’s instructions. Thirty milligrams of tobacco or potato leaves were used as the sample in the extraction procedure and RNA was eluted in 100 ␮l of nuclease-free water. The quantitation of viral genome copies was determined using the appropriate PVYN or PVYO specific Taqman® -based real-time RT-PCR assays described previously (Balme-Sinibaldi et al., 2006). 2.4. Reverse transcription and multiplex polymerase chain reaction Reverse transcription of the viral RNA was carried out in the presence of 2 U of AMV reverse transcriptase (Promega), 20 pmol of the oligonucleotide 5  9701 GTCTCCTGATTGAAGTTTAC9682 -3 (nucleotide posiN tions according to PVY -605 isolate, Jakab et al., 1997), 5 nmol of each dNTP, 20 U of RNasin® (Promega) and 5 ␮l of crude or diluted fraction of total RNA extract. The reaction was performed according to the enzyme manufacturer’s instructions in a final volume of 20 ␮l for 1 h at 42 ◦ C. The cDNA regions corresponding to part of the Hc-Pro/P3 and of the NIb/CP genes of PVY genome were amplified using a multiplex PCR protocol in the presence of 20 pmol of four primers (5 -1906 CCCTGTTGTTGCACTACACTT1926 -3 (forward) and 5 -2469 TCCTCCTTCTCTAAAAGGTGATA2447 3 (reverse), and 5 -8360 ACCAAATCAGGAGATTCTACTCA   8382 -3 (forward) and 5 -9324 GGTGGTGTGCCTCTCTGTGT  9305 -3 (reverse) for specific amplification of HC-Pro/P3 and NIb/CP regions, respectively). Nucleotide positions are according to Jakab et al. (1997). Reactions contained 1.25 U of AmpliTaq polymerase (Applied Biosystems), 40 nmol of dNTPs, 100 nmol MgCl2 , 5 ␮l of cDNA and were adjusted to a final volume of 50 ␮l with sterile water. The reactions were

cycled in an MJ Research Tetrad thermal cycler for 40 cycles of 95 ◦ C for 1 min, 52 ◦ C for 1 min and 72 ◦ C for 1 min. PCR products were analysed by agarose gel (1%, w/v) electrophoresis in TBE buffer (0.089 M Tris borate, 0.089 M boric acid and 0.002 M EDTA) and visualised under UV light in the presence of SybrSafe® (5 ␮g/ml). 2.5. SNaPshot assay Small molecules such as dNTPs and primers were removed from post-PCR fractions using a fast gel filtration step. Five microliters of post-PCR fractions were centrifuged through sephadex G50 gel (400 ␮l). Two microliters of the resulting fraction were used as sample in a single nucleotide primer extension procedure carried out in the presence of 1 pmol of PVY specific primers (Table 2), 2 ␮l of SNaPshot Ready Reaction Mix® (Applied Biosystems) and adjusted to a final volume of 5 ␮l with sterile water. The primer extension reaction was cycled in an MJ Research Tetrad thermal cycler for 25 cycles of 96 ◦ C for 10 s, 50 ◦ C for 5 s and 60 ◦ C for 30 s. Post extension products were incubated at 37 ◦ C for 1 h in the presence of 1 U of calf intestinal phosphatase (Promega). One microliter of the produced fraction was mixed with 8.5 ␮l of Hi-Di Formamide (Applied Biosystems) and 0.5 ␮l of Liz-120 Size Standard (Applied Biosystems), and denatured at 95 ◦ C for 5 min. The fragments were then run through POP-7 polymer® (Applied Biosystems) at 15 kV for 24 min on a 3130 Genetic Analyzer (Applied Biosystems). During electrophoresis, fluorescent signals were recorded and analysed using ABI GeneScan Software. Genotypes were scored manually, using size standards for peak verification. 3. Results 3.1. Selection of targeted nucleotides for PVY group and variant discrimination The A/G2213 , A/C2271 and G/C8573 single nucleotide polymorphisms (SNP), reported to be associated with either YN or YO sequences (Shukla and Ward, 1988; Tribodet et al., 2005), were selected as targets. According to the genetic organisation of PVY groups and variants (Fig. 1), the simultaneous use of these three SNPs distinguished PVYN , PVYO and PVYN -W isolates but the differentiation of PVYNTN variants from standard PVYN isolates is not possible without the use of an additional marker. Thus, a fourth SNP located within the coat protein downstream from the PVYNTN specific recombination site (Glais et al., 1998, 2002) was chosen. The selection of the T/C9259 (YN /YO ) polymorphic nucleotide was based on alignments and comparisons of 63 coat protein sequences from 19 PVYO and 44 PVYN isolates (data not shown). Primers of 26, 34, 42 and 50 bases in length (including or not a poly(A) tail at the 5 -end) were designed to hybridize with the complementary strand of PVY PCR product immediately upstream of nucleotides 9259, 2271, 8573 and 2213, respectively (Table 2). To deal with known polymorphism of viral sequences a few nucleotides upstream of the targeted SNPs T/C9259 , A/C2271 and G/C8573 , primers pairs

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

111

Table 2 Primers used for the SNaPshot single nucleotide elongation step Primer

Sequence

Bases

Nucleotide locationa

P2213.N/O P2271.O P2271.N NterCP.O NterCP.N MidCP.O MidCP.N

5 -(A)20 TGGATCTGGCGACAACTTGTGCTCAAATGA-3 5 -ATGCAGAACTGCCTAGAATATTGGTTGACCATGA-3 5 -ATGCAGAACTGCCTAGAATACTAGTCGATCACGA-3 5 -ACGATGAGTTTGAGTTTGACTCTTATGAAGTATACCATCAAG-3 5 -(A)10 TGAGTGCGATACTTATGAAGTGCACCATCAAG-3 5 -AGGCCGCAGCATTGAAATCAGCCCAA-3 5 -AGGCCGCAGCTTTAAAATCAGCTCAA-3

50 34 34 42 42 26 26

2183–2212 2237–2270 2237–2270 8531–8572 8541–8572 9233–9258 9233–9258

a

Position according to Jakab et al. (1997).

Fig. 1. Genomic organisation of PVY groups and variants. Each box corresponds to a potyvirus gene, the name of the corresponding encoded protein is indicated. Grey and white boxes correspond to sequences related to PVYN or PVYO , respectively. The Vpg and the poly(A) tail are presented at the 5 - and 3 -end of the viral RNA, respectively. The four-targeted single nucleotide polymorphisms in the developed SNaPshot assay are indicated. a : nucleotide position according to Jakab et al. (1997).

were designed to hybridize specifically with either PVYN - or PVYO -like sequences. 3.2. Amplification of viral sequences containing targeted SNPs Prior to being characterized, viral sequences present in infected plants must be amplified using classical RT-PCR. After total RNA extraction, fractions were used to produce viral cDNA. As selected SNPs to be targeted are located within two separate genes (i.e. HC-Pro and Coat Protein), HC-Pro/P3 and NIb/CP regions overlapping SNPs 2213 and 2271, and 8573 and 9259, respectively, were amplified using a multiplex RTPCR protocol. The expected fragments of 563 bp (HC-Pro/P3, nt 1906–2469) and 964 bp (NIb/CP, nt 8360–9324) were efficiently amplified for both PVYN -605 and PVYO -139 isolates (Fig. 2), and for the 60 field-collected samples (data not shown) illustrating the efficiency of the multiplex PCR assay.

length using capillary electrophoresis in the presence of a calibrated molecular standard ranging in size from 15 to 120 bases. The resulting electropherogram allows identification of peaks (above the 500 fluorescence units) for calibrated standards and peaks associated with the labeled primers (Fig. 3). Calculated sizes of the fluorescent primers (Fig. 3, 32/35 for T/C9259 , 40/41 for A/C2271 , 45/49 for G/C8573 and 51/52 for A/G2213 ) did not fit exactly with their expected length due to the presence of the

3.3. PVY group and variant characterization using SNaPshot assay PCR products were used as templates for single nucleotide extension in the presence of fluorescent-labeled ddNTPs and of the 26-, 34-, 42- and 50-mers primers used to target the selected SNPs. The produced fluorescent 27-, 35-, 43- and 51mers molecules were separated according to their respective

Fig. 2. Agarose gel electrophoresis of multiplex RT-PCR products. Lanes 1 and 2 correspond to samples containing 104 PVYN -605 and PVYO -139 copies, respectively. Lane 3 corresponds to no template control. Lane L is the ladder, length (in base pair; bp) of molecular markers in a range of 400–1500 are denoted. Expected NIb/CP (a: 964 pb) and HC-Pro/P3 (b: 563 pb) fragments are denoted by arrows.

112

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

Fig. 3. SNaPshot electropherograms obtained for (A) PVYN -605, (B) PVYO -139, (C) PVYN -Wi-P and (D) PVYNTN -FrOrl isolates. The nucleotide scale, calculated according to migration time of the labeled nucleic acid standards (S35 and S50 ), is denoted. The fluorescence and the calculated length associated with peaks allowed to identify the four-digit code (“TAGA”, “CCCG”, “CACA”, “CAGA”) specific to each PVY group and variant. FU: fluorescence unit; Nucl. scale: nucleotide scale.

different chemical dyes that slightly modify (from 1 to 9 bases in calculated length) the mobility of the oligomer in the polymer. However, according to the migration time of standards, peaks can be assigned to each of the four-targeted SNPs. The wavelength of the fluorescent signal associated with a peak indicates the nature of the fluorescent ddNTP incorporated at the 3 -end of the primer during the extension step. The four identified bases obtained for PVYN -605 correspond to “TAGA” (Fig. 3A). This four-digit code allowed identification of PVYN group members. Based on the polymorphism of nucleotides 9259, 2271, 8573 and 2213 in available PVY sequences, “CCCG”, “CACA” and “CAGA” four-digit codes should characterize PVYO , PVYN -W and PVYNTN , respectively. Applied to samples containing either PVYO -139 (Singh and Singh, 1996b), PVYN -Wi-P (Glais et al., 1998) or PVYNTN -FrOrl (Glais et al., 1996) RNA, the procedure described gave expected four-digit codes (Fig. 3B–D, respectively). 3.4. Threshold limit for PVY characterization using the SNaPshot assay PVYN -605 and PVYO -139 RNA present in total RNA extracts from infected tobacco leaves were quantified and 10fold serially diluted to obtain fractions containing from 104 to 101 PVY genome copies/5 ␮l. Five microliters of each fraction were used as samples in the SNaPshot procedure to determine the threshold detection limit of this new PVY characterization tool. Viral detection using the multiplex RT-PCR was efficient for fractions containing at least 103 PVY copies as shown by the presence of the HC-Pro/P3 and NIb/CP specific bands (Fig. 4). Faint bands could be obtained for more dilute fractions but the lack of reliability of such weak detection (data not shown) allow fixed the threshold detection limit of this multiplex RT-PCR to 103 copies of target RNA. A fraction (1/25th) of the PCR products was used in the SNaPshot procedure. The four expected peaks were obtained for fractions containing 104 , 103 and 102 copies while only two peaks (A/C2271 and A/G2213 ) were present in SNaPshot electrophero-

grams associated with fractions containing only 10 viral RNA molecules (Fig. 4). Such results fixed the SNaPshot threshold limit for PVY group and variant characterization to 102 viral RNA molecules. However, the two-digit codes (“AA” vs. “CG”) obtained for fractions containing 10 viral molecules illustrate the high sensitivity of this fluorescent-based assay and make possible the PVY group characterization (PVYN /PVYNTN /PVYN -W vs. PVYO ) for fractions with extremely low viral concentrations. 3.5. Characterization of PVYN and PVYO in mixed samples Calibrated mixed fractions containing both PVYN and PVYO RNA molecules in the range 2 × 104 to 0 copies/5 ␮l were prepared. Five microliters of each mixture were analysed using the developed SNaPshot procedure. As described for samples tested previously, fractions containing less than 103 viral RNA are associated with weak or no RT-PCR amplification (Fig. 5A). All samples, except the “no template” fraction, were associated with a SNaPshot detection signal (viral detection and group identification) confirming the very low threshold detection limit of this technique (Fig. 5B). Indeed, fractions containing only 10 PVYN and/or 10 PVYO RNA molecules were efficiently detected. For fractions containing viral RNA quantities close to the defined threshold limit (102 to 101 copies), the dual detection was restricted to PVYN /PVYO balanced fractions (Fig. 5B). However, for fractions containing 103 or 104 copies of both PVYN and PVYO RNA (PVYN /PVYO ratio in a range 0.1 to 10), the two-targeted genomes were detected. 3.6. Detection and characterization of isolates from laboratory and collected in the field PVY isolates from the laboratory viral collection (19 isolates) or from potato field surveys (60 samples) were tested using the SNaPshot procedure. As expected, the four-digit codes produced for isolates of the collection allowed their assign-

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

113

Fig. 4. RT-PCR- and SNaPshot-based assays for detection and characterization of PVY isolates. Diluted fractions containing from 104 to 101 PVYN -605 or PVYO 139 RNA copies were tested. The PCR products and the identity of the four-targeted SNPs were analysed using agarose gel and polymer electrophoresis, respectively. Amplified viral sequences corresponding to NIb/CP (a) and HC-Pro/P3 (b) regions were observed under UV light in the presence of SybrSafe® . SNP four-digit codes were listed according to the characteristics of the fluorescent peaks. FU: Fluorescence unit; Nucl. scale: nucleotide scale.

ment in the accurate group or variant (not illustrated). The characterization of samples collected in the field using SNaPshot assay allowed identification and characterization of 17 mixed samples (Table 3). Moreover, this assay identifies groups and variants present in all samples infected dually (YN /YNTN , YN /YO , YN /YN -W, YNTN /YO , YNTN /YN -W and YN -W/YO ). Such mixed infections were confirmed by serological assays

except for PVYN /PVYNTN and PVYN -W/PVYO that could not be characterized as mixed infections by ELISA. The SNaPshot procedure allowed the detection and characterization of 6 PVYO , 19 PVYN , 14 PVYNTN and 4 PVYN -W isolates out of the 43 infected samples containing only one type (group/variant) of PVY isolate. These results were consistent with serological and biological data (Table 4).

Fig. 5. (A) RT-PCR results and (B) interpretation of SNaPshot electropherograms for detection and characterization of PVYN -605 and PVYO -139 in mixed samples. Diluted fractions containing from 0 to 104 copies of both PVYN -605 and PVYO -139 RNA were used as samples for PVY group and variant detection and characterization. The PCR products and the identity of the four-targeted SNPs were analysed using agarose gel and polymer electrophoresis, respectively. Amplified viral sequences corresponding to NIb/CP (a) and HC-Pro/P3 (b) regions were observed under UV light in the presence of SybrSafe® . According to observed fluorescent peaks and to SNP digit codes, the single detection of PVYN -605 (N) or PVYO -139 (O), the dual detection (N/O) of viral isolates and the absence of detection (X) is indicated.

114

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

Table 3 Characterization using SNaPshot assay of PVY isolates in mixed infected samples Host plant (genotype)a

SNaPshot result

ELISA result

Digit code

Group/variant assignment

YN

YO/C

G1 G2

TAGA/CAGA TAGA/CCCG

N/NTN N/O

+ +

− +

G3

TAGA/CCCG CACA/CCCG

N/O N-W/O

+ −

+ +

G4

TAGA/CAGA

N/NTN

+

−

G5

TAGA/CACA TAGA/CCCG TAGA/CCCG TAGA/CCCG

N/N-W N/O N/O N/O

+ + + +

+ + + +

G6

CAGA/CCCG

NTN/O

+

+

G7

CAGA/CACA TAGA/CACA CAGA/CACA TAGA/CACA TAGA/CACA

NTN/N-W N/N-W NTN/N-W N/N-W N/N-W

+ + + + +

+ + + + +

G8 G9

CAGA/CACA CAGA/CCCG

NTN/N-W NTN/O

+ +

+ +

a

Infected samples were collected in different potato genotypes during global survey of potato fields (France, 2006).

4. Discussion PVY is a pathogen of major economical and agronomical importance for potato growers. Indeed, this virus could induce necrosis symptoms in infected organs (including tubers) and can be easily transferred from plant to plant due to the vegetative propagation of potatoes. Such characteristics imposed the selection of virus-free tubers as the main control method to manage PVY infections in potato fields. Efficient viral detection requires tool(s) that deal with the intrinsic characteristics of the pathogen. Data collected during the last two decades have highlighted the marked diversity of biological, serological and molecular properties of PVY isolates. Such viral variability has increased the necessity but also the difficulty of developing efficient and reliable PVY detection/characterization assay(s). The current PVY classification is based on the connection between biological (abilities to induce necrosis on tobacco and/or on potato plants/tubers) and molecular (recombinant genome organisation) characteristics of PVY isolates. The SNaPshot procedure described in this paper targets simultaneously molecular determinants known to be involved in necrosis properties (A/G2213 and A/C2271 ) and nucleotides (G/C8573 and T/C9259 ) unlinked to biological properties. Based on four simple steps (nucleic acids extraction, multiplex RT-PCR, single nucleotide primer extension and polymer electrophoresis) compatible with robotic workstations, the multiple SNPs interrogation method makes possible the accurate detection and characterization of PVY isolates according to the current complex classification. The assay developed is able to detect and characterize the fourtargeted SNPs, required to discriminate PVY group/variant, in fractions containing as few as 102 copies of the PVY genome. This threshold limit for efficient diagnosis is 10–100 times lower

than that associated with classical RT-PCR detection (103 copies under our experimental conditions), SNP-based technique (104 copies) (Jacquot et al., 2005) and “real-time” RT-PCR assays (103 copies) (Balme-Sinibaldi et al., 2006). In samples containing 10 copies of PVY genomic RNA, the SNaPshot assay allows efficient viral detection but is restricted to PVY group (YN vs. YO ) characterization. In prepared mixed samples, this original assay allows dual detection of PVYN -605 and PVYO -139 when present at a ratio of 0.1–10. The SNaPshot procedure was tested on 19 isolates in the laboratory collection (from Canada, France, Poland, Spain and Switzerland). This new tool assigns correctly all these isolates to their PVY group/variant. Moreover, applied to field-collected infected samples, isolates belonging to PVYO , PVYN , PVYNTN or PVYN -W were detected accurately and characterized by the SNaPshot assay. Finally, due to the ability to identify the presence of the different groups and/or variants in dually infected plants (including PVYN + PVYNTN and PVYO + PVYN -W combinations, not identifiable by serological tools), the SNaPshot assay permits the detection of mixed infected samples and the characterization of the PVY mixture. Since molecular technologies made possible the development of rapid, sensitive and reliable detection/characterization tools, they have been used extensively to improve detection of numerous pathogens (Pastrik and Rainey, 1999; Sarlin et al., 2006; Tang et al., 1997). During the last 10 years, more than 15 different tools have been published to detect and classify PVY isolates according to their biological properties. These assays were designed using a wide range of molecular methods (Mumford et al., 1999; Rosner and Maslenin, 2001; Singh and Singh, 1996a). Beside the improvement of sensitivity offered by each new molecular method, the development of these numerous PVY detection assays was justified by the description of

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

115

Table 4 Characterization of field-collected PVY isolates using SNaPshot assay Host plant (genotype)a

ELISA result

Tobacco leaf necrosis

YN

YO/C

G10

+ + − + + + + − +

− + − − − − + −

G11

+ + + − − + +

SNaPshot result Digit code

Group/variant assignment

+ + − + + + + − +

CAGA CAGA CCCG TAGA TAGA TAGA TAGA CCCG CAGA

NTN NTN O N N N N O NTN

− − − + + − −

+ + + + + + +

CAGA CAGA CAGA CAGA CAGA CAGA TAGA

NTN NTN NTN N-W N-W NTN N

G1

+ − − − +

− + + + −

+ − − − +

TAGA CCCG CCCG CCCG TAGA

N O O O N

G3

+

−

+

TAGA

N

G12

+ + + + +

− − − − −

+ + + + +

TAGA TAGA TAGA TAGA CAGA

N N N N NTN

G5

+ + +

− − −

+ + +

TAGA TAGA TAGA

N N N

G13

+ − +

− + −

+ + +

CAGA CAGA CAGA

NTN N-W NTN

G14

+ + +

− − −

+ + +

CAGA TAGA TAGA

NTN N N

G4

+ +

− −

+ +

CAGA CAGA

NTN NTN

G2

+ +

− −

+ +

TAGA TAGA

N N

G8 G6 G7

− − +

+ + −

+ − +

CAGA CCCG CAGA

N-W O NTN

a

Infected samples were collected in different potato genotypes during global survey of potato fields (France, 2006).

new types of PVY isolates. Studies have demonstrated that plant virus genomic diversity is supported by mutations and/or recombination events (Roossinck, 1997). Based on sequence alignments and/or on the comparative analysis between genomic organisation and biological properties of selected isolates, different sequences specific to PVY group(s) and variant(s) have been identified. Such molecular markers, putatively linked to PVY biological properties, were used individually for the development of a series of molecular tools. However, as most of

the assays developed were designed using methods allowing the targeting of a limited number of molecular markers, the identification of any additional marker allowing a better characterization of the PVY diversity requires the development of new assay(s) rather than the upgrade of the previous assay(s). The SNaPshot technology is based on the length-dependant migration of fluorescent-labeled single-stranded nucleic acids molecules in polymer electrophoresis. The methods used to achieve the separation of such fluorescent molecules makes pos-

116

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117

sible the simultaneous targeting of up to 10 SNPs (Syvanen, 2001). According to the putative increase of PVY variability, the upgrade of the SNaPshot assay will require, in conjunction with the identification of molecular marker(s) linked to the next emerging variant(s), only the design of primer pair(s) for the amplification of the PVY region overlapping such new marker(s) and PVY specific primer(s) (length in the range of 58–120) for the single nucleotide extension step. The other parameters of the described SNaPshot procedure will not require improvements. Genomic variants of PVY not associated with changes in biological properties in plant hosts are not identified by the available detection techniques. The extreme variability of PVY isolates suggests that genomic organisations not described so far could exist in natural reservoirs or within cultivated hosts. Actually, some PVY isolates with unclassified genomic organisations have been found both in cultivated and non-cultivated host plants (L. Glais, unpublished data). Some PVYN -W (Schubert et al., 2007), PVYNTN and PVYN isolates (M. Rolland, unpublished data) that do not fit into traditional pattern have been characterized recently. Molecular determinants supporting their particular behaviour have to be identified prior being integrated as a fifth targeted SNP in our SNaPshot procedure. As a whole, with its high sensitivity, accurate assignment of detected isolates in one of the described groups and variants of the Potato virus Y classification, compatibility with robotic workstations, and easy upgrade from 4 to 10 simultaneous targeted SNPs, the SNaPshot assay is an excellent tool for characterization of PVY isolates. Acknowledgements We are grateful to Stephen Sunderwirth and James M. Crosslin for critical reading of the manuscript and to Aur´elie Leclerc for her help in biological characterization of fieldcollected isolates. This work was supported by the Institut National de la Recherche Agronomique (France) and the Ecole Nationale Sup´erieure d’Agronomie (Rennes, France). References Balme-Sinibaldi, V., Tribodet, M., Croizat, F., Lefeuvre, P., Kerlan, C., Jacquot, E., 2006. Improvement of Potato virus Y (PVY) detection and quantitation using PVYN- and PVYO-specific real-time RT-PCR assays. J. Virol. Methods 134, 261–266. Beczner, L., Horvath, J., Romhanyi, I., Forster, H., 1984. Studies on the aetiology of tuber necrotic ringspot disease in potato. Potato Res. 27, 339–352. Blanco-Urgoiti, B., Tribodet, M., Leclere, S., Ponz, F., Roman, C.P.S.D., Legorburu, F.J., Kerlan, C., 1998. Characterization of potato potyvirus Y (PVY) isolates from seed potato batches. Situation of the NTN, Wilga and Z isolates. Eur. J. Plant Pathol. 104, 811–819. Chrzanowska, M., 1991. New isolates of the necrotic strain of Potato virus Y (PVYN) found recently in Poland. Potato Res. 34, 179–182. Crosslin, J.M., Hamm, P.B., Eastwell, K.C., Thornton, R.E., Brown, C.R., Corsini, D., Shiel, P.J., Berger, P.H., 2002. First report of the necrotic strain of Potato virus Y (PVYN) on potatoes in the Northwestern United States. Plant Disease 86, 1177. De Bokx, J.A., Hunttinga, H., 1981. Potato virus Y. AAB/CMI Description of plant viruses, 242. Dougherty, W.G., Carrington, J.C., 1988. Expression and function of potyviral gene products. Annu. Rev. Phytopathol. 26, 123–143.

Glais, L., Kerlan, C., Tribodet, M., Tordo, V.M.J., Robaglia, C., AstierManifacier, S., 1996. Molecular characterization of potato virus YN isolates by PCR-RFLP differentiation of PVYN isolates by PCR-RFLP. Eur. J. Plant Pathol. 102, 655–662. Glais, L., Tribodet, M., Gauthier, J.P., Astier-Manifacier, S., Robaglia, C., Kerlan, C., 1998. RFLP mapping of the whole genome of ten viral isolates representative of different biological groups of Potato virus Y. Arch. Virol. 143, 2077–2091. Glais, L., Tribodet, M., Kerlan, C., 2002. Genomic variability in Potato potyvirus Y (PVY): evidence that PVYNW and PVYNTN variants are single to multiple recombinants between PVYO and PVYN isolates. Arch. Virol. 147, 363–378. Glais, L., Tribodet, M., Kerlan, C., 2005. Specific detection of the PVYN-W variant of Potato virus Y. J. Virol. Methods 125, 131–136. Gugerli, P., Fries, P., 1983. Characterization of monoclonal antibodies to Potato virus Y and their use for virus detection. J. Gen. Virol. 64, 2471–2477. Jacquot, E., Tribodet, M., Croizat, F., Balme-Sinibaldi, V., Kerlan, C., 2005. A single nucleotide polymorphism-based technique for specific characterization of YO and YN isolates of Potato virus Y (PVY). J. Virol. Methods 125, 83–93. Jakab, G., Droz, E., Brigneti, G., Baulcombe, D., Malnoe, P., 1997. Infectious in vivo and in vitro transcripts from a full-length cDNA clone of PVY-N605, a Swiss necrotic isolate of Potato virus Y. J. Gen. Virol. 78, 3141–3145. Kerlan, C., Tribodet, M., Glais, L., Guillet, M., 1999. Variability of Potato virus Y in potato crops in France. J. Phytopathol. 147, 643–651. Latorre, B.A., Flores, V., Marholz, G., 1984. Effect of Potato virus Y on growth, yield, and chemical composition of flue-cured tobacco in Chile. Plant Disease 68, 884–886. Le Romancer, M., Kerlan, C., Nedellec, M., 1994. Biological characterisation of various geographical isolates of Potato virus Y inducing superficial necrosis on potato tubers. Plant Pathol. 43, 138–144. Lorenzen, J.H., Piche, L.M., Gudmestad, N.C., Meacham, T., Shiel, P., 2006. A multiplex PCR assay to characterize Potato virus Y isolates and identify strain mixtures. Plant Disease 90, 935–940. McDonald, J.G., Singh, R.P., 1996. Response of potato cultivars to North American isolates of PVYNTN. Am. Potato J. 73, 317–323. Milne, R.G., 1988. The filamentous plant viruses. In: Fraenkel-Conrat, H., Wagner, R.R. (Eds.), The Plant Viruses, vol. 4. Plenum Press, New York, pp. 331–407. Moravec, T., Cerovska, N., Boonham, N., 2003. The detection of recombinant, tuber necrosing isolates of Potato virus Y (PVYNTN) using a three-primer PCR based in the coat protein gene. J. Virol. Methods 109, 63–68. Mumford, R., Walsh, K., Barker, I., Boonham, N., 1999. Fluorescent PCR for the detection of potato viruses. Petria 9, 127–130. Nie, X., Singh, R.P., 2002. A new approach for the simultaneous differentiation of biological and geographical strains of Potato virus Y by uniplex and multiplex RT-PCR. J. Virol. Methods 104, 41–54. Nie, X., Singh, R.P., 2003a. Evolution of North American PVYNTN strain Tu 660 from local PVYN by mutation rather than recombination. Virus Genes 26, 39–47. Nie, X., Singh, R.P., 2003b. Specific differentiation of recombinant PVYN:O and PVYNTN isolates by multiplex RT-PCR. J. Virol. Methods 113, 69–77. Ohshima, K., Sako, K., Hiraishi, C., Nakagawa, A., Matsuo, K., Ogawa, T., Shikata, E., Sako, N., 2000. Potato tuber necrotic ringspot disease occurring in Japan: its association with Potato virus Y necrotic strain. Plant Disease 84, 1109–1115. Pastrik, K.H., Rainey, F.A., 1999. Identification and differentiation of Clavibacter michiganensis subspecies by polymerase chain reaction-based techniques. J. Phytopathol. 147, 687–693. Roossinck, M.J., 1997. Mechanisms of plant virus evolution. Annu. Rev. Phytopathol. 35, 191–209. Rosner, A., Maslenin, L., 1999. Transcript conformation polymorphism: a novel approach for differentiating PVYNTN. J. Phytopathol. 147, 661–664. Rosner, A., Maslenin, L., 2001. Differentiating PVYNTN from PVYN by annealing to reference RNA transcripts. J. Virol. Methods 97, 125–131. Salazar, L.F., Bartolini, I., Flores, V., 2000. Evidence for the existence of PVYNTN in the Andes and a hypothesis towards its origin. Fitopatologia 35, 87–90.

M. Rolland et al. / Journal of Virological Methods 147 (2008) 108–117 Sarlin, T., Yli-Mattila, T., Jestoi, M., Rizzo, A., Paavanen-Huhtala, S., Haikara, A., 2006. Real-time PCR for quantification of toxigenic Fusarium species in barley and malt. Eur. J. Plant Pathol. 114, 371– 380. Schubert, J., Fomitcheva, V., Sztangret-Wisniewska, J., 2007. Differentiation of Potato virus Y strains using improved sets of diagnostic PCR-primers. J. Virol. Methods 140, 66–74. Shukla, D.D., Ward, C.W., 1988. Amino acid sequence homology of coat proteins as a basis for identification and classification of the potyvirus group. J. Gen. Virol. 69, 2703–2710. Shukla, D.D., Ward, C.W., Burnt, A.A., 1994. The Potyviridae. Cambridge University Press, Cambridge. Sigvald, R., 1984. The relative efficiency of some aphid species as vectors of Potato virus Y. Potato Res. 27, 285–290. Singh, M., Singh, R.P., 1996a. Factors affecting detection of PVY in dormant tubers by reverse transcription polymerase chain reaction and nucleic acid spot hybridization. J. Virol. Methods 60, 47–57.

117

Singh, M., Singh, R.P., 1996b. Nucleotide sequence and genome organization of a Canadian isolate of the common strain of Potato virus Y (PVYO). Can. J. Plant Pathol. 18, 209–224. Syvanen, A.C., 2001. Accessing genetic variation: genotyping single nucleotide polymorphisms. Nat. Rev. Genet. 2, 930–942. Szemes, M., Klerks, M.M., Heuvel, J.F.J.M.v.d., Schoen, C.D., 2002. Development of a multiplex AmpliDet RNA assay for simultaneous detection and typing of Potato virus Y isolates. J. Virol. Methods 100, 83–96. Tang, Y.W., Procop, G.W., Persing, D.H., 1997. Molecular diagnostics of infectious diseases. Clin. Chem. 43, 2021–2038. Tribodet, M., Glais, L., Kerlan, C., Jacquot, E., 2005. Characterization of Potato virus Y (PVY) molecular determinants involved in the vein necrosis symptom induced by PVYN isolates in infected Nicotiana tabacum cv. Xanthi. J. Gen. Virol. 86, 2101–2105. Van der Zaag, D.E., 1987. Yield reduction in relation to virus infection. In: De Bokx, J.A., Van der Want, J.P.H. (Eds.), Viruses of Potatoes and Seed-Potato Production. Pudoc, Wageningen, pp. 149–150.