- Email: [email protected]
A multiplex PCR for 4 X chromosome STR markers and population data from Beijing Han ethnic group
Legal Medicine 11 (2009) 248–250
Contents lists available at ScienceDirect
Legal Medicine journal homepage: www.elsevier.com/locate/legalmed
Announcement of Population Data
A multiplex PCR for 4 X chromosome STR markers and population data from Beijing Han ethnic group Huifen Li a,*, Hui Tang b, Qinxia Zhang b, Zhangping Jiao b, Jie Bai b, Shoupeng Chang c a
Shanxi Medical University, School of Forensic Medicine, Taiyuan 030001, China Forensic Medical Examination and Identification and Center of Beijing Public Bureau, Beijing 100192, China c Nanxun Police Precinct Office of Huzhou Public Bureau, Huzhou 313009,China b
a r t i c l e
i n f o
Article history: Received 17 November 2008 Received in revised form 8 February 2009 Accepted 25 March 2009 Available online 9 June 2009 Keywords: Multiplex PCR X-STR markers Population genetic Forensic genetic
a b s t r a c t STR multiplex is a practical and simple method to obtain large amounts of important information in forensic and population genetic studies. The present work describes a new multiplex system that allows the simultaneous analysis of 4 X-STR markers, namely DXS9902, DXS6800, DXS6799 and DXS7132, as the tool of approach for X-STR studies. In addition, this work presents the genotyping results obtained for a sample 400 individuals (200 males and 200 females) from Beijing Han ethnic group in China. Ó 2009 Published by Elsevier Ireland Ltd.
Introduction: The analysis of X chromosome short tandem repeats (X-STR) has so far played a more and more important role in forensic and in population studies, especially for testing in complex kinship cases, for example in father/daughter relationship (motherless cases) and maternity testing, or when female individuals have the same father, they always share the same paternal X chromosome (ChrX). An advantage of X-STRs is that the probability of excluding a false father in standard trios in which the child is higher than for autosomal loci with similar polymorphic information content [1,2]. Here, we have selected DXS9902, DXS6800, DXS6799 and DXS7132 with good multiplex amplification effect under same annealing temperature from X-STR markers with good polymorphisms and high discriminate probability that have been reported in internal and abroad to develop a rapid multiplex PCR typing system suitable for fluorescent detection and to perform population genetic studies among Beijing Han ethnic group in China. Materials and methods: Blood samples (females 200 and males 200) were collected from healthy unrelated individuals of Han ethnic group in China under informed consent. Genomic DNA was extracted according to the Chelex-100 protocol [3]. A tetraplex system was optimized in a single PCR reaction using fluorescentlabeled primers. Primer sequences were selected according to GeneBank information (http://www.gdb.org/); primers were designed by ourselves, and primer sequence, concentrations, PCR * Corresponding author. Tel.: +86 10 62909012; fax: +86 10 62904605. E-mail address: [email protected] (H. Li). 1344-6223/$ - see front matter Ó 2009 Published by Elsevier Ireland Ltd. doi:10.1016/j.legalmed.2009.03.013
product sizes and dye-labeling are listed in Table 1. The multiplex PCR was performed in a volume of 20 ll with a reaction mix containing: 1 PCR buffer with 1.5 mM MgCl2, 200 lM each dNTP, 1 U AmpliTaq DNA Polymerase (Applied Biosystems, Foster City, USA); the temperature profile was: 11 min at 95 °C followed by 45 s at 94 °C, 45 s at 62 °C and 1 min at 72 °C for 35 cycles and a final extension of 60 min at 72 °C. We also amplified 9948 human cell line DNA (Promega Corporation, Madison, WI) as a control and to test quality of typing protocol for the multiplex ChrX STRs [4] and 9948 typing is shown in Table 1. The samples were detected by using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). Results were analyzed using GeneScan Analysis software 3.7. Allele sequencing was performed from purified STR fragments DNA of hemizygous male subjects with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Sequencing products were analyzed on ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). The allele frequencies for each ChrX marker were determined by counting. Hardy–Weinberg equilibrium (HWE) and possible deviations were tested following the v2-testing method using the female genotypes only [5]. Polymorphism information content (PIC) was estimated according to Botstein et al. [6], Heterozygosity (Het) [7], Power of discrimination (PD) in females and males were calculated according to Desmarais et al. [8]. Probability of exclusion in trios involving daughters and in father/daughter duos lacking maternal genotype information were computed according to Desmarais et al. [8].
249
H. Li et al. / Legal Medicine 11 (2009) 248–250 Table 1 Information of the four X-STR loci. Locus
Primer sequence (50 –30 )
Allele size in (bp)
Concentration (lM)
Core sequence
Dye
9948 typing
DXS9902
F:TGGAGTCTCTGGGTGAAGAG R:CAGGAGTATGGGATCACCAG F:GTGGGACCTTGTGATTGTGT
150–180
1.2
GATA
FAM
12
189–220
0.125
(TAGA)x-CA-(GATA)1-GAT-(GATA) y-GG-(TAGA)3-TC-(GATA)3
FAM
19
228–255
1
TATC
FAM
11
263–300
1.5
TCTA
FAM
13
DXS6800
DXS6799 DXS7132
R:CTGGCTGACACTTAGGGAAA F:ATGAATTCAGAATTATCCTCATACC R:GAACCAACCTGCTTTTCTGA F:AGCCCATTTTCATAATAAATCC R:AATCAGTGCTTTCTGTACTATTGG
Results and discussion: Allele nomenclatures of all markers investigated here were designated by the number of repeats, mainly according to the International Society for Forensic Genetics (ISFG) guidelines [9]. For the marker DXS6800, we adopted the nomenclature proposed by Edelmann et al. [10]. The allele frequencies and forensic parameters for the four ChrX markers examined in a population sample from Beijing Han ethnic group are listed in Table 2. Allele frequencies, PE and PIC were calculated from the combined data of females and males, whereas Hetobs was obtained from the females only. Allele frequencies between female and male samples were not significantly different in all examined markers. The v2-testing for genotype distribution of the four X-STR in females showed no significant deviation from the HWE (P P 0.01). Of all the markers studied, it is showed that observed heterozygosities for DXS9902, DXS6799, DXS7132 were greater than 0.6. The DXS7132 was proven to be high polymorphic locus with 8 alleles (Hetobs = 0.771, PIC = 0.71, PEtrio = 0.691, PEduo = 0.551). Comparisons of population genetic frequencies of DXS7132 in five different populations from Korean, German, Spain, Italy and Chinese Han, there was no significant difference [11].Three markers could be useful in paternity tests and forensic purpose, but
Table 2 Allele frequencies distribution of four and forensic parameters X-STR loci in the present study (N = 400; 200 males; 200 females; 600 chromosomes). Allele
DXS9902
7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Hetobs PIC PDF PDM PEtrio PEduo HWE (P-value)
0.007
DXS6800
DXS6799 0.008 0.031 0.188 0.568 0.167 0.033 0.005
0.018 0.455 0.325 0.187 0.008
0.817
0.625 0.59 0.813 0.651 0.586 0.439 0.3159
0.012 0.101 0.002 0.013 0.051 0.004 0.335 0.32 0.521 0.321 0.321 0.191 0.9799
0.625 0.56 0.805 0.612 0.561 0.419 0.6116
DXS7132
0.002 0.005 0.068 0.192 0.355 0.307 0.057 0.014
0.771 0.71 0.886 0.735 0.691 0.551 0.3647
N, total number of samples; P-value, probability value (HWE analysis); Hetobs, observed heterozygosity; PIC, polymorphism information content; PEtrio, power of exclusion (trios involving daughters); PEduo, power of exclusion (father/daughter duos); PDM, discrimination power in males; PDF, discrimination power in females.
DXS6800 presented the lowest values for the forensic parameters investigated (Hetobs = 0.335, PIC = 0.32, PEtrio = 0.321, PEduo = 0.191) in Beijing Han ethnic group. In the comparison with the Korea population, forensic parameters of DXS9902, DXS6800 and DXS7132 were regard as similar [12]. It is usually reported for DXS6799 in Asia population, such as China, Megolia, but rarely investigated in other population. Male chromosomes were investigated by haplotype analysis and for linkage disequilibrium. Among the 200 men typed, 76 haplotypes were observed. No linkage disequilibrium was detected between any of the maker pairs investigated. In the kinship cases involving 50 family trios with daughter, no mutation was detected. The application and usefulness of this 4 XSTR multiplex approach in paternity deficiency case is demonstrated by a combined power of discrimination (PDc) for females with PDc > 0.998 and for male with PDc > 0.975. The simultaneous typing of many ChrX markers is a high efficient, simple and practical method to obtain large amounts of information as proven in many other studies [13]. With the increasing interest gained by the analysis of ChrX STRs , particularly in forensic and population studies, we will devote to find more valuable ChrX markers and it is noteworthy that PCR multiplexes should continue to be optimized and considered for large amount of microsattelite genotyping. Acknowledgments The author thank Professor Yacheng Liu and all personnels of biology/DNA lab (Forensic Medical Examination and Identification and Center of Beijing Public Bureau) for their support. References [1] Szibor R, Krawczak M, Hering S, et al. Use of X-linked markers for forensic purposes. Int J Legal Med 2003;117:67–74. [2] Bini C, Ceccardi S, Ferri G, Pelotti S, et al. Development of a heptaplex PCR system to analyse X-chromosome STR loci from five Italian population samples. A collaborative study. Forensic Sci Int 2005;153:231–6. [3] Li S, Zheng HB, Feng JD, et al. A study on the genetic structure and variational trait in Chinese Han nation population. J Xi’an Med Univ 2000;21: 1–5. [4] Szibor R, Edelmann J, Hering S, et al. Cell line DNA typing in forensic genetics – the necessity of reliable standards. Forensic Sci Int 2003;138:37–43. [5] Guo SW, Thompson EA. Performing the exact test of Hardy–Weinberg proportion for multiple alleles. Biometrics 1992;48:361–72. [6] Botstein D, White RL, Skolnick M, Davies RW. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am J Hum Genet 1980;32:314–31. [7] Nei M, Roychoudhury AK. Sampling variances of heterozygosity and genetic distance. Genetics 1974;76:379–90. [8] Desmarais D, Zhong Y, Chakraborty R, et al. Development of a highly polymorphic STR marker for identity testing purposes at the human androgen receptor gene (HUMARA). J Forensic Sci 1998;43:1046–9. [9] Bar W, Brinkmann B, Budowle B, Carracedo A, et al. DNA recommendations, further report of the DNA commission of the ISFH regarding the use of short tandem repeat systems. International Society for Forensic Haemogenetics. Int J Legal Med 1997;110:175–6.
250
H. Li et al. / Legal Medicine 11 (2009) 248–250
[10] Edelmann J, Deichsel D, Hering S, et al. Sequence variation and allele nomenclature for the X-STRs DXS9895, DXS8378, DXS7132, DXS 6800, DXS7133, GATA172D05, DXS7423 and DXS8377. Forensic Sci Int 2002;129:99–103. [11] Shanzhi Gu, Shengbin Li. X-chromosome STRs analysis of Ewenke ethnic population. Forensic Sci Int 2006;158:72–5.
[12] Sang Hee Shin, Jin Seok Yu, Ki Wha Chung, et al. Genetic analysis of 18 X-linked short tandem repeat markers in Korean population. Forensic Sci Int 2005;147:35–41. [13] Gusmaõ L, Alves C. Y chromosome STR typing. Methods of molecular biology, vol. 297. Humana Press; 2004. p. 67–82.
Contents lists available at ScienceDirect
Legal Medicine journal homepage: www.elsevier.com/locate/legalmed
Announcement of Population Data
A multiplex PCR for 4 X chromosome STR markers and population data from Beijing Han ethnic group Huifen Li a,*, Hui Tang b, Qinxia Zhang b, Zhangping Jiao b, Jie Bai b, Shoupeng Chang c a
Shanxi Medical University, School of Forensic Medicine, Taiyuan 030001, China Forensic Medical Examination and Identification and Center of Beijing Public Bureau, Beijing 100192, China c Nanxun Police Precinct Office of Huzhou Public Bureau, Huzhou 313009,China b
a r t i c l e
i n f o
Article history: Received 17 November 2008 Received in revised form 8 February 2009 Accepted 25 March 2009 Available online 9 June 2009 Keywords: Multiplex PCR X-STR markers Population genetic Forensic genetic
a b s t r a c t STR multiplex is a practical and simple method to obtain large amounts of important information in forensic and population genetic studies. The present work describes a new multiplex system that allows the simultaneous analysis of 4 X-STR markers, namely DXS9902, DXS6800, DXS6799 and DXS7132, as the tool of approach for X-STR studies. In addition, this work presents the genotyping results obtained for a sample 400 individuals (200 males and 200 females) from Beijing Han ethnic group in China. Ó 2009 Published by Elsevier Ireland Ltd.
Introduction: The analysis of X chromosome short tandem repeats (X-STR) has so far played a more and more important role in forensic and in population studies, especially for testing in complex kinship cases, for example in father/daughter relationship (motherless cases) and maternity testing, or when female individuals have the same father, they always share the same paternal X chromosome (ChrX). An advantage of X-STRs is that the probability of excluding a false father in standard trios in which the child is higher than for autosomal loci with similar polymorphic information content [1,2]. Here, we have selected DXS9902, DXS6800, DXS6799 and DXS7132 with good multiplex amplification effect under same annealing temperature from X-STR markers with good polymorphisms and high discriminate probability that have been reported in internal and abroad to develop a rapid multiplex PCR typing system suitable for fluorescent detection and to perform population genetic studies among Beijing Han ethnic group in China. Materials and methods: Blood samples (females 200 and males 200) were collected from healthy unrelated individuals of Han ethnic group in China under informed consent. Genomic DNA was extracted according to the Chelex-100 protocol [3]. A tetraplex system was optimized in a single PCR reaction using fluorescentlabeled primers. Primer sequences were selected according to GeneBank information (http://www.gdb.org/); primers were designed by ourselves, and primer sequence, concentrations, PCR * Corresponding author. Tel.: +86 10 62909012; fax: +86 10 62904605. E-mail address: [email protected] (H. Li). 1344-6223/$ - see front matter Ó 2009 Published by Elsevier Ireland Ltd. doi:10.1016/j.legalmed.2009.03.013
product sizes and dye-labeling are listed in Table 1. The multiplex PCR was performed in a volume of 20 ll with a reaction mix containing: 1 PCR buffer with 1.5 mM MgCl2, 200 lM each dNTP, 1 U AmpliTaq DNA Polymerase (Applied Biosystems, Foster City, USA); the temperature profile was: 11 min at 95 °C followed by 45 s at 94 °C, 45 s at 62 °C and 1 min at 72 °C for 35 cycles and a final extension of 60 min at 72 °C. We also amplified 9948 human cell line DNA (Promega Corporation, Madison, WI) as a control and to test quality of typing protocol for the multiplex ChrX STRs [4] and 9948 typing is shown in Table 1. The samples were detected by using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). Results were analyzed using GeneScan Analysis software 3.7. Allele sequencing was performed from purified STR fragments DNA of hemizygous male subjects with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Sequencing products were analyzed on ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). The allele frequencies for each ChrX marker were determined by counting. Hardy–Weinberg equilibrium (HWE) and possible deviations were tested following the v2-testing method using the female genotypes only [5]. Polymorphism information content (PIC) was estimated according to Botstein et al. [6], Heterozygosity (Het) [7], Power of discrimination (PD) in females and males were calculated according to Desmarais et al. [8]. Probability of exclusion in trios involving daughters and in father/daughter duos lacking maternal genotype information were computed according to Desmarais et al. [8].
249
H. Li et al. / Legal Medicine 11 (2009) 248–250 Table 1 Information of the four X-STR loci. Locus
Primer sequence (50 –30 )
Allele size in (bp)
Concentration (lM)
Core sequence
Dye
9948 typing
DXS9902
F:TGGAGTCTCTGGGTGAAGAG R:CAGGAGTATGGGATCACCAG F:GTGGGACCTTGTGATTGTGT
150–180
1.2
GATA
FAM
12
189–220
0.125
(TAGA)x-CA-(GATA)1-GAT-(GATA) y-GG-(TAGA)3-TC-(GATA)3
FAM
19
228–255
1
TATC
FAM
11
263–300
1.5
TCTA
FAM
13
DXS6800
DXS6799 DXS7132
R:CTGGCTGACACTTAGGGAAA F:ATGAATTCAGAATTATCCTCATACC R:GAACCAACCTGCTTTTCTGA F:AGCCCATTTTCATAATAAATCC R:AATCAGTGCTTTCTGTACTATTGG
Results and discussion: Allele nomenclatures of all markers investigated here were designated by the number of repeats, mainly according to the International Society for Forensic Genetics (ISFG) guidelines [9]. For the marker DXS6800, we adopted the nomenclature proposed by Edelmann et al. [10]. The allele frequencies and forensic parameters for the four ChrX markers examined in a population sample from Beijing Han ethnic group are listed in Table 2. Allele frequencies, PE and PIC were calculated from the combined data of females and males, whereas Hetobs was obtained from the females only. Allele frequencies between female and male samples were not significantly different in all examined markers. The v2-testing for genotype distribution of the four X-STR in females showed no significant deviation from the HWE (P P 0.01). Of all the markers studied, it is showed that observed heterozygosities for DXS9902, DXS6799, DXS7132 were greater than 0.6. The DXS7132 was proven to be high polymorphic locus with 8 alleles (Hetobs = 0.771, PIC = 0.71, PEtrio = 0.691, PEduo = 0.551). Comparisons of population genetic frequencies of DXS7132 in five different populations from Korean, German, Spain, Italy and Chinese Han, there was no significant difference [11].Three markers could be useful in paternity tests and forensic purpose, but
Table 2 Allele frequencies distribution of four and forensic parameters X-STR loci in the present study (N = 400; 200 males; 200 females; 600 chromosomes). Allele
DXS9902
7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Hetobs PIC PDF PDM PEtrio PEduo HWE (P-value)
0.007
DXS6800
DXS6799 0.008 0.031 0.188 0.568 0.167 0.033 0.005
0.018 0.455 0.325 0.187 0.008
0.817
0.625 0.59 0.813 0.651 0.586 0.439 0.3159
0.012 0.101 0.002 0.013 0.051 0.004 0.335 0.32 0.521 0.321 0.321 0.191 0.9799
0.625 0.56 0.805 0.612 0.561 0.419 0.6116
DXS7132
0.002 0.005 0.068 0.192 0.355 0.307 0.057 0.014
0.771 0.71 0.886 0.735 0.691 0.551 0.3647
N, total number of samples; P-value, probability value (HWE analysis); Hetobs, observed heterozygosity; PIC, polymorphism information content; PEtrio, power of exclusion (trios involving daughters); PEduo, power of exclusion (father/daughter duos); PDM, discrimination power in males; PDF, discrimination power in females.
DXS6800 presented the lowest values for the forensic parameters investigated (Hetobs = 0.335, PIC = 0.32, PEtrio = 0.321, PEduo = 0.191) in Beijing Han ethnic group. In the comparison with the Korea population, forensic parameters of DXS9902, DXS6800 and DXS7132 were regard as similar [12]. It is usually reported for DXS6799 in Asia population, such as China, Megolia, but rarely investigated in other population. Male chromosomes were investigated by haplotype analysis and for linkage disequilibrium. Among the 200 men typed, 76 haplotypes were observed. No linkage disequilibrium was detected between any of the maker pairs investigated. In the kinship cases involving 50 family trios with daughter, no mutation was detected. The application and usefulness of this 4 XSTR multiplex approach in paternity deficiency case is demonstrated by a combined power of discrimination (PDc) for females with PDc > 0.998 and for male with PDc > 0.975. The simultaneous typing of many ChrX markers is a high efficient, simple and practical method to obtain large amounts of information as proven in many other studies [13]. With the increasing interest gained by the analysis of ChrX STRs , particularly in forensic and population studies, we will devote to find more valuable ChrX markers and it is noteworthy that PCR multiplexes should continue to be optimized and considered for large amount of microsattelite genotyping. Acknowledgments The author thank Professor Yacheng Liu and all personnels of biology/DNA lab (Forensic Medical Examination and Identification and Center of Beijing Public Bureau) for their support. References [1] Szibor R, Krawczak M, Hering S, et al. Use of X-linked markers for forensic purposes. Int J Legal Med 2003;117:67–74. [2] Bini C, Ceccardi S, Ferri G, Pelotti S, et al. Development of a heptaplex PCR system to analyse X-chromosome STR loci from five Italian population samples. A collaborative study. Forensic Sci Int 2005;153:231–6. [3] Li S, Zheng HB, Feng JD, et al. A study on the genetic structure and variational trait in Chinese Han nation population. J Xi’an Med Univ 2000;21: 1–5. [4] Szibor R, Edelmann J, Hering S, et al. Cell line DNA typing in forensic genetics – the necessity of reliable standards. Forensic Sci Int 2003;138:37–43. [5] Guo SW, Thompson EA. Performing the exact test of Hardy–Weinberg proportion for multiple alleles. Biometrics 1992;48:361–72. [6] Botstein D, White RL, Skolnick M, Davies RW. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am J Hum Genet 1980;32:314–31. [7] Nei M, Roychoudhury AK. Sampling variances of heterozygosity and genetic distance. Genetics 1974;76:379–90. [8] Desmarais D, Zhong Y, Chakraborty R, et al. Development of a highly polymorphic STR marker for identity testing purposes at the human androgen receptor gene (HUMARA). J Forensic Sci 1998;43:1046–9. [9] Bar W, Brinkmann B, Budowle B, Carracedo A, et al. DNA recommendations, further report of the DNA commission of the ISFH regarding the use of short tandem repeat systems. International Society for Forensic Haemogenetics. Int J Legal Med 1997;110:175–6.
250
H. Li et al. / Legal Medicine 11 (2009) 248–250
[10] Edelmann J, Deichsel D, Hering S, et al. Sequence variation and allele nomenclature for the X-STRs DXS9895, DXS8378, DXS7132, DXS 6800, DXS7133, GATA172D05, DXS7423 and DXS8377. Forensic Sci Int 2002;129:99–103. [11] Shanzhi Gu, Shengbin Li. X-chromosome STRs analysis of Ewenke ethnic population. Forensic Sci Int 2006;158:72–5.
[12] Sang Hee Shin, Jin Seok Yu, Ki Wha Chung, et al. Genetic analysis of 18 X-linked short tandem repeat markers in Korean population. Forensic Sci Int 2005;147:35–41. [13] Gusmaõ L, Alves C. Y chromosome STR typing. Methods of molecular biology, vol. 297. Humana Press; 2004. p. 67–82.