A multiplex RT-PCR assay for the simultaneous detection of prevalent viruses infecting pepper (Capsicum annuum L.)

Journal Pre-proof A multiplex RT-PCR assay for the simultaneous detection of prevalent viruses infecting pepper (Capsicum annuum L.) ´ Katalin Nemes, Katalin Salanki

PII:

S0166-0934(19)30119-3

DOI:

https://doi.org/10.1016/j.jviromet.2020.113838

Reference:

VIRMET 113838

To appear in:

Journal of Virological Methods

Received Date:

14 March 2019

Revised Date:

11 February 2020

Accepted Date:

12 February 2020

´ Please cite this article as: Nemes K, Salanki K, A multiplex RT-PCR assay for the simultaneous detection of prevalent viruses infecting pepper (Capsicum annuum L.), Journal of Virological Methods (2020), doi: https://doi.org/10.1016/j.jviromet.2020.113838

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

A multiplex RT-PCR assay for the simultaneous detection of prevalent viruses infecting pepper (Capsicum annuum L.)

Katalin Nemesa, Katalin Salánkia* [email protected]

a

Plant Protection Institute, Centre for Agricultural Research, Hungarian Academy of Sciences,

ro

Corresponding author:

-p

*

of

Budapest, Hungary



re

Highlights

An easy, fast and sensitive multiplex RT-PCR assay was developed for the simultaneous



lP

detection of the most frequent viruses infecting pepper crops. The assay could efficiently detect the two subgroups of cucumber mosaic virus, tobamoviruses (tobacco mosaic virus, pepper mild mottle virus), potato virus Y and tomato 

ur na

spotted wilt virus from pepper leaf and fruit samples. The assay would provide rapid information required for pepper breeding programs and

Jo

epidemiological studies.

ABSTRACT The aim of this work was to create an easy, fast and sensitive method for the simultaneous detection of the most frequent viruses known to infect pepper (Capsicum annuum L.) crops. A

of

multiplex RT-PCR assay was developed that successfully achieved this aim. Using specifically

ro

designed primer pairs, the assay could simultaneously amplify the genomes of members of the two subgroups (I and II) of cucumber mosaic virus (CMV), two tobamoviruses, tobacco mosaic

-p

virus (TMV) and pepper mild mottle virus (PMMoV), potato virus Y (PVY), and tomato spotted

re

wilt virus (TSWV) in a single assay. The multiplex RT-PCR assay was found to be a sensitive diagnostic tool for the detection of the viruses from the leaves and fruits of naturally infected

lP

pepper plants. This assay would provide prompt disease status information for pepper breeders.

ur na

Keywords: CMV; PVY; TSWV; tobamovirus; multiplex RT-PCR; pepper 1. Introduction

Forty-nine virus species have been described to infect pepper (Capsicum annuum L.)

Jo

(Edwardson and Christie, 1997), a member of the Solanaceae family. The frequency, the incidence and the agronomical impact of these viruses are clearly distinct. Major viral constraints affecting pepper crops in the Mediterranean basin in Europe have been remarkably stable for the past 20 years, the most prevalent ones are the contact and seed-transmitted tobamoviruses; the aphid-transmitted PVY and CMV; and thrips-transmitted TSWV (Moury and Verdin 2012). In

France, five viruses were common on peppers, the CMV, PMMoV, PVY, TMV and TSWV (Marchoux et al. 2000). According to a survey in the Czech Republic carried out in the years 2006–2010, the most frequent viruses were CMV and PVY. They were present in 24 and 29% of tested pepper samples (Svoboda and Svoboda-Leisová 2012). Tomato mosaic virus (ToMV), CMV, PMMoV (Kostova et al. 2003) and TSWV (Neshev 2008) proved to be widespread viruses on peppers in Bulgaria as well. In Hungary the most frequent and significant viral

of

pathogens of pepper during the last decade are TMV, PMMoV TSWV, found in protected

ro

cultivation, while the aphid-transmitted CMV and PVY are dominantly found in open fields

-p

(Tóbiás et al., 2017).

Tobamoviruses are easily spread mechanically, and persist in seeds, plant debris, on glass-house

re

benches (Spence et al. 2001) and present even in wastewater (Rosario et al., 2009). The TMV and tomato mosaic virus (ToMV) were the prevalent tobamoviruses in pepper breading for

lP

decades but their management was successful with resistance breading utilising the L1-L4 resistance genes. Recently, PMMoV induced severe infection and heavy losses, since the L3 and

ur na

L4 resistance-breaking PMMoV strains being identified (Berzal-Herranz et al., 1995, Genda et al., 2007). Increased occurrence of these strains presents further risks because most of the cultivated species harbour the L3 and L4 resistance gene. The genome of tobamoviruses is a

Jo

single-stranded RNA (ssRNA) which is encapsidated into stable rod-shaped particles approximately 300 nm long and the particles are particularly stable (Creager et al. 1999, McKinney, 1952). Generally, TMV infected pepper plants have a chlorotic mosaic, stunting with distortion of younger leaves and fruits. In the case of PMMoV infection, the leaf symptoms are usually mild or even infected peppers may remain asymptomatic and the virus infection induces

striking symptoms on the fruit. Both the yield and quality of pepper production are severely reduced upon tobamovirus epidemics. The aphid transmitted CMV and PVY has great economic impact, they can drastically reduce fruit weight up to 70-80% in the case of early infection after plantation (Avilla et al., 1997). PVY is the prevalent potyvirus affecting pepper in Europe. PVY is ssRNA virus with a genome

of

of 9.7 kb packaged in long flexuous particles 730 x 11 nm (Karasev and Gray 2013). PVY is

ro

transmitted mainly by Myzus persicae (Radcliffe and Ragsdale, 2002). The most common

symptom induced by PVY in pepper is systemic vein clearing which develops into a mosaic or

-p

mottle, and dark green vein banding in leaves (Pernezny et al. 2003). Vein and petiole necrosis often develop depending on the pepper genotype and the PVY strain (Dogimont et al. 1996).

re

Necrotic spots, mosaic patterns and distortions may develop on fruits on some cultivars.

lP

However, fruit symptoms do not always occur in PVY-infected plants. Yield loss greatly depends on the plant stage upon infection and can reach 100% (Avilla et al. 1997).

ur na

The CMV virion is icosahedral encapsidating three genomic ssRNA separately (Jacquemond 2012). CMV strains can be divided into two major subgroups, designated I and II, both of which are found in Hungary (Salánki el al. 1994, Divéki et al. 2004). Subgroup I strains are further divided into two additional subgroups (A and B) (Roossinck et al. 1999). The virus is transmitted

Jo

by a large number of aphid species; Myzus persicae and Aphis gossypii are the most important in vegetable crops (Gildow et al. 2008). Symptoms include punctiform mosaic and dull leaves, filiformism of young leaves associated with curling of the veins, misshaped fruits with annular discolourations, and sterility when infection occurs at plantlet stage. In fruits, CMV can induce distortions, reduction of size and irregular maturation. Early seedling infections can induce stem

necrosis and the death of plants (Kaper and Waterworth 1981). Yield loss greatly depends on the growth stage of infection and can reach 80% (Avilla et al. 1997). Generally, the subgroup II isolates induce milder symptoms than the strains belonging to subgroup I. The economic importance of TSWV is increasing worldwide in the last decade (Gupta et al. 2018). TSWV is transmitted in a propagative manner by several thrips species (Wijkamp et al.

of

1993). Amongst them, Frankliniella occidentalis (western flower thrips) and Frankliniella fusca (tobacco thrips) are the most efficient vectors (Groves et al. 2001). Outbreaks of TSWV in

ro

Europe have been associated to the introduction of F. occidentalis in the early 1980s that has

-p

established also outdoors in agricultural areas with milder winters (Kirk et al., 2003). TSWV virions are spherical and membrane-bound with a diameter of approximately 80-120 nm. The

re

virus possesses a tripartite ssRNA genome of which one segment is of negative polarity and the other two are ambisense (Goldbach and Peters, 1996). Symptoms in C. annuum include stunting

lP

and yellowing of the whole plant, mosaic or necrotic spots, and curling of the leaves. Infected fruits often show deformations, necrotic ring patterns and arabesque-like coloration (Moury and

ur na

Verdin, 2012).

The multiplex RT-PCR assay is a widely-used molecular diagnostic technique used for the amplification of multiple target sequences in a single PCR experiment. Formerly, a multiplex

Jo

RT-PCR assay was established for the differentiation of the tobamoviruses TMV and tomato mosaic virus ToMV in pepper cultivars (Vinayarani et al. 2011). In this study the multiplex RTPCR primer design based on the conserved nt sequence regions of the distinct TSWV, PVY and CMV genomes retrieved from the GeneBank. In the case of tobamoviruses, an universal primer pair was used previously proved to be efficient in the detection of TMV, PMMoV and even Tobacco mild green mosaic virus (Kálmán et al., 2001; Nemes et al., 2015). In the present study, a

multiplex RT-PCR assay was developed to detect simultaneously both subgroups (I and II) of CMV, TMV, PMMoV, PVY and TSWV in pepper leaves and fruits. 2. Materials and methods 2.1. Viruses and plant materials

of

The cDNA clones of each of the viruses tested, derived from previous studies in our laboratory (Table 1), were used as positive controls. Pepper samples with distinct viral symptoms (on leaves

ro

or fruit) were collected from Central Hungary (Boldog, Bokros, Lajosmizse and Hatvan) in the middle of the growing season. Eight samples were collected in Boldog: six from open fields

-p

(sample No. 1, 2, 3, 4, 9, 18) and two from a greenhouse (No. 5, 6); one sample (No. 7) in

re

Hatvan from a greenhouse; five samples (No. 8, 14, 15, 16, 17) in Lajosmizse from open fields

ur na

lP

and four samples (No. 10, 11, 12, 13) in Bokros, also from open fields.

2.2. Total nucleic acid extraction

Total RNA was extracted from 200 mg samples of pepper leaves or fruits according to White and

Jo

Kaper (1989). The RNA was dissolved in 50 µl of sterile water, 2 µl of each sample was run in agarose gel to assess the quality. Two µg of it was used for subsequent cDNA synthesis (RevertAid Reverse Transcriptase, Thermo Fisher Scientific). 2.3. Primer design

At least 15 different strains of each virus originating from different geographical regions were retrieved from the NCBI database and used for multiple sequence alignment. The sequence identity was at least 98% for each virus and conserved regions were chosen for primer design. The primers for PVY RT-PCR were designed based on the conserved regions of the CP gene of the PVY strains; those for CMV RT-PCR were based on the CP gene of CMV and those for TWSV RT-PCR were based on the S segment of TSWV. The universal tobamo primers used for

of

the detection of TMV and/or PMMoV were reported previously (Kalman et al. 2001). C. annuum

ro

actin primers (Li et al. 2016) were used as the internal reference for the RT-PCR assay. All the oligonucleotides were designed to work efficiently at a melting temperature of 60 °C and each

-p

primer pair was designed to amplify the respective virus-specific amplicon of a different length.

re

The primers for each virus were optimised using the respective plasmid cDNA clone of the virus shown in Table 1. The sequences of primers used and the expected PCR products size are

lP

detailed in Table 2. The PCR conditions were finalised as follows: denaturation step of 5 min at 95 °C, 30 amplification cycles of 30 sec 95 °C; 1 min 30 sec 60 °C and 1 min 72 °C; and a final

ur na

extension step of 10 min 72 °C.

2.4. Multiplex RT-PCR detection of plant viruses

Jo

Viral cDNAs were synthesised by reverse transcription (RT) of the total RNAs extracted from pepper leaves or fruits using the reverse primers (Table 2) and RevertAid Reverse Transcriptase according to the manufacturer’s instructions (Thermo Fisher Scientific). Two μL (100 ng) each of the total RNA was used in the RT reaction. The subsequent PCR reaction contained 100 pmol of each primer. All PCRs were performed in 50 μL final volume. Reaction components included 1 μL of 10 μM forward and reverse primers, 1 µL cDNA and 0.5 μL Taq DNA Polymerase

(recombinant) (Thermo Fisher Scientific). RT-PCR products from the infected plants were sequenced to confirm their identity. 3. Results 3.1. Optimisation of PCR using cDNA clones

of

Prior to applying the multiplex RT-PCR assay for field samples, the accuracy and sensitivity of the PCR for each virus was verified using cDNA clones from previous studies (Table 1). Ten-

ro

fold serial dilutions of each cDNA clone (1 ng/µl and 0.1 fg/µl plasmid DNA) were tested.

-p

In the assays, amplified bands with the expected sizes were detected for all the viruses (1000 bp for CMV, 750 bp for both the tobamoviruses, 500 bp for PVY and 350 bp for TSWV) (Fig.1).

re

The detection limit for PMMoV was 1 pg/µl (Fig. 1A); for TMV, 0.1 fg/µl (Fig. 1B); for CMV,

lP

0.01 pg/µl (Fig. 1C); for PVY, 1 fg/µl (Fig. 1D) and for TSWV, 0.1 fg/µl (Fig. 1E). The amplified bands confirmed the detection of the two different subgroups of CMV using

ur na

plasmid constructs of subgroup I and II CMV (Fig. 2). The detection limits were equal for both

Jo

subgroups (0.01 pg/µl).

of ro -p re lP ur na

Figure 1. Detection and detection limits for the different viruses by the virus-specific PCRs. Dilutions used were between 1 ng/µl to 0.01 fg/µl. A: PMMoV detection, B: TMV detection, C: CMV detection, D: PVY detection, E: TSWV detection. GeneRuler 1 kb DNA Ladder (Thermo

Jo

Fisher Scientific) was used as a marker.

of

Figure 2. Detection of the different subgroups of cucumber mosaic virus (sg I and II) (plasmid

ro

concentration 0.01 pg/µl). GeneRuler 1 kb DNA Ladder (Thermo Fisher Scientific) was used as

re

3.2. Application of RT-PCR for pepper samples

-p

a marker.

lP

Altogether 18 samples were analysed from 17 diseased pepper leaves or fruits and one sample from Atriplex patula as a reservoir of plant viruses (No. 18) (Fig. 3). All the samples were

ur na

positive and all the monitored viruses were present among the samples collected. CMV was detected in 6 samples (No. 1, 2, 6, 7, 9, 18), PVY was present in 2 samples (No. 3, 4). Tobamoviruses were detected in 3 samples (No. 11, 12, 13) and TSWV was detected in 14

Jo

samples (No. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18) (Fig. 4A). All the samples found infected with tobamoviruses were co-infected with TSWV. Nucleotide sequence determination of the multiplex RT-PCR products from representative samples proved the identity of the amplified viruses. Sequence analysis confirmed the presence of TSWV (sample No. 15), the NTN strain of PVY (samples No. 3, 4), TMV (sample No. 11), PMMoV (sample No. 12, 13) and the subgroup I strain of CMV (sample No. 6).

Since in the analysed field samples only single and double virus infections were detected, to validate the system for detecting multiple viruses, RT-PCR reactions were carried out using artificial virus combinations created by mixing the RNAs from selected virus-positive field samples (Fig. 4B). All the possible combinations were prepared, except for a mixture which did not contain TSWV. The results obtained proved the feasibility of using the assay in detecting

ur na

lP

re

-p

ro

of

triple and quadruple virus co-infections (Fig. 4B).

Figure 3. Pepper leaves and fruits (1-17) and Atriplex patula (18) showing virus-like disease

Jo

symptoms collected from different regions of Hungary.

of ro -p

Figure 4. (A) Multiplex RT-PCR detection of pepper-infecting CMV, tobamoviruses (Tobamo),

re

PVY and TSWV viruses from pepper leaves and fruits represented in Figure 3. 2 µl of the total reaction (50 µl) was run on the gel. (B) Verification of multiplex RT-PCR in artificial

lP

combinations of infections using mixed RNAs. Lane 1 represents multiplex RT-PCR of RNAs from samples No. 1, 3 and 11. Lane 2 represents multiplex RT-PCR of RNAs from samples No. 3 and 11. Lane 3 represents multiplex RT-PCR of RNAs from samples No. 4 and 9. Lane 4

ur na

represents multiplex RT-PCR of RNAs from samples No. 2 and 12 while lane 5 represents negative sample. GeneRuler DNA Ladder Mix (Thermo Fisher Scientific) was used as a marker.

3.3. Verification of the sensitivity of the RT-PCR

Jo

The detection limits of viral RNAs from plant extracts were also verified by RT-PCR using a 10fold dilution series of the extracted total RNA preparations (100 to 10-9 dilutions) from four different field samples, representing the four monitored viruses (CMV, PVY, TMV, TSWV; samples No. 1, 4, 11, 15) (Fig. 5). The detection limits observed were 10-4 for CMV, 10-8 for PVY, 10-3 for TMV and 10-3 for TSWV. In the case of TSWV the detection limit proved to be

similar in a single (sample No. 15) or in a double virus infected (sample No. 11) plant samples. The multiplex PCR system performed perfectly on both leaf (Fig. 4., samples No. 1, 2, 3, 4, 11,

lP

re

-p

ro

of

17, 18) and fruit (Fig. 4., samples No. 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16) samples.

ur na

Figure 5. Detection limits of viral RNA sequences in plants. RT-PCR on a dilution series of total extracted RNAs. A: Sample 1 (CMV detection), B: Sample 4 (PVY detection), C: Sample 11 (TMV and TSWV detection and D: Sample 15 (TSWV detection). GeneRuler DNA Ladder Mix

Jo

(Thermo Fisher Scientific) was used as a marker.

4. Discussion

Despite the disadvantages, the most widely used technique for plant virus detection is still a serological method like ELISA since large number of samples can be handled easily, but the sensitivity is low, requires multiple steps and can detect only individual viruses. Cross-reaction

between different antisera could also limit serological differentiation (Letschert et al. 2002). Frequently the detection sensitivity is adequate only in the early stage of infection. Among the viral detection techniques used in diagnostics, polymerase chain reaction (PCR) of viral gene segments using sequence specific primers is still the most accurate, highly sensitive, and facile technique available (Kwon et al. 2014). There are two major limitations associated with the design of specific primers for identifying a target virus; sequence variations within virus species

ro

typically designed based on conserved regions of viral genomes.

of

and nonspecific priming to non-target sequences. To avoid these problems, specific primers are

-p

The most recent viral emergences in pepper crops in Hungary are induced by TSWV and tobamovirus isolates breaking down specific resistances of pepper cultivars. Resistance

re

breakdowns were reported in the case of tobamovirus resistance gene L3 (Moury and Verdin 2012), and the TSWV resistance gene Tsw that was overcome only a few years after being

lP

deployed (García-Arenal and McDonald 2003; Margaria et al. 2004; Roggero et al. 2002; Sharman and Persley 2006; Thomas-Carroll and Jones, 2003; Almasi et al. 2015). In Hungary

ur na

Tsw resistance-breaking isolate was first reported by Salamon et al. in 2010. No alternative resistance gene is available against TSWV in pepper breading yet. The transmission of TSWV is mainly assisted by its effective vector Frankliniella occidentalis. Unlike previous years, the

Jo

occurrence of this virus is now more common (see samples No. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18) due to the ability of the different thrips species in Hungary to overwinter in open fields. TSWV was detected from more than 75% of the samples, from protected crops as well as open field, and it was present in all the monitored pepper production areas. The defence against the thrips vectors is extremely important in the control of the TSWV disease, even in the case of resistant pepper varieties since late infection can induce extreme necrotic symptoms on the fruits

(Salamon et al. 2010). The screening of TSWV is going to have primary importance in relation to open field pepper cultivation. These facts make this virus the main constraint on pepper production in all the areas, which is corroborated by our results. PVY was detected from 2 samples (No. 3, 4) and only in open field condition, in line with its marginal role in pepper cultivation in Hungary. Tobamoviruses were present in three samples

of

(No. 11, 12, 13) which were collected from open field. Since these viruses are transmitted only mechanically, the virus infection could occur before plantation. CMV was present in 6 samples

ro

(No. 1, 2, 6, 7, 9, 18) both in greenhouse and open field production. CMV is distributed in

-p

pepper crops all over the world and can induce severe economic losses by affecting the growth of the vegetative parts of the plants and also by causing symptoms on fruits.

re

We have detected multiple viruses in seven samples (No. 6, 7, 9, 11, 12, 13, 18). Multiplex

lP

infection occurred both in open field (No. 9, 11, 12, 13, 18) and in greenhouse (No. 6, 7) conditions. It is remarkable that TSWV was present in all the double virus-infected plants

ur na

although it had a minor pathological significance in Hungary until recent years. TSWV was present simultaneously with either CMV or tobamoviruses. Coinfection modulates symptom development in two opposite ways, synergistic or antagonistic interactions may occur. Coinfection with CMV and a virus from another genus (Crinivirus, Potexvirus, Potyvirus,

Jo

Tobamovirus) usually worsen the disease (synergy), particularly in cucurbits or solanaceous hosts, and generally correlates with an increase in CMV accumulation only (Jacquemond 2012). PVY and CMV are transmissible by aphids in a non-persistent manner (Moury and Verdin 2012) which means that these viruses can be transmitted rapidly, no requirement for a long-time inoculation feeding. Myzus persicae is the most efficient vector of PVY and also for CMV; the increase of its population could correlate the disease severity caused by these viruses. In a

context of increasing aphid populations and thrips overwintering in open field due to climate change; and reduction of the use of insecticides in crops breeding proper diagnostic methods are essential for pepper cultivation. In the field samples, only single or double virus-infections were present (Fig. 4A). However, it was possible to show that the developed multiplex RT-PCR assay could accurately detect triple

of

and quadruple viruses as well (Fig. 4B).

ro

As similar symptoms may be caused by different agents, to accurately identify the infecting virus based on the induced macroscopic symptoms on the fruits and leaves of pepper plants is unlikely.

-p

Furthermore, the symptoms can vary greatly according to the plant variety, the virus strain and the presence of a mixed infection. Symptoms of a given virus may be masked by symptoms of

re

other viruses or the interaction of different viruses. It is of primary importance to identify the

lP

infecting viruses properly and quickly. The presented multiplex PCR system was simple, fast and could detect the main viruses infecting pepper at quite high sensitivities. For diagnostics and

ur na

reference for growers, the determination of the virus species or strains is unnecessary. However, the assay was able to detect and distinguish among the viruses in mixed infections and is useful for further epidemiological studies to refine our understanding of the fitness of these

Jo

economically destructive viruses.

Conflict of interest The authors declare that no conflict of interest exists.

Acknowledgements Katalin Nemes was a recipient of a János Bolyai fellowship from the Hungarian Academy of

Jo

ur na

lP

re

-p

ro

of

Sciences. The authors are grateful to Pál Salamon for providing the pepper samples.

References Almási, A., Csilléry, G., Csömör, Zs., Nemes, K., Palkovics, L., Salánki, K., Tóbiás, I., 2015. Phylogenetic analysis of Tomato spotted wilt virus (TSWV) NSs protein demonstrates the

of

isolated emergence of resistance-breaking strains in pepper. Virus Genes 50(1), 71-8. Avilla, C., Collar, J.L., Duque, M., Pérez, P., Fereres, A.,1997. Impact of floating rowcovers on

ro

bell pepper yield and virus incidence. Hortscience 32,882–883.

-p

Creager, A. N., Scholthof, K, Citovsky, V.,and Scholthof H.B., 1999. Tobacco Mosaic Virus: Pioneering Research for a Century. Plant Cell. 11(3), 301–308.

re

Berzal-Herranz, A., De la Cruz, A., Tenllado, F., Díaz-Ruíz, J.R., Lopez, L., Sanz, A.I.,

lP

Vaquero, C., Serra, M.T., García-Luque., 1995. The Capsicum L3 gene-mediated resistance against the tobamoviruses is elicited by the coat protein. Virology 209,498-505.

ur na

Divéki, Z., Salánki, K., Balázs, E. 2004. The necrotic pathotype of the cucumber mosaic virus (CMV) ns strain is solely determined by amino acid 461 of the 1a protein. Mol. Plant Microbe Interact. 17(8),837-45.

Jo

Dogimont, C., Palloix, A., Daubéze, A.M., Marchoux, G., Gebre Selassie, K., Pochard, E. 1996. Genetic analysis of broad spectrum resistance to potyviruses using doubled haploid lines of pepper (Capsicum annuum L.). Euphytica 88,231–239. Edwardson, J.R., Christie, R.G. 1997. Viruses infecting peppers and other solanaceous crops. Volume 2 pp 427.

García-Arenal, F., McDonald, B.A. 2003. An Analysis of the Durability of Resistance to Plant Viruses. Phytopathology 93(8), 941-952. Genda, Y., Kanda, A., Hamada, H., Sato, K., Ohnishi, J., and Tsuda, S. 2007. Two amino acid substitutions in the coat protein of pepper mild mottle virus are responsible for overcom-ing the L4gene mediated resistance in Capsicum spp. Phytopathology 97:787-793.

of

Goldbach, R., Peters, D. 1996, Molecular and Biological Aspects of Tospoviruses. The

ro

Bunyaviridae. In: Elliott RM (editor). The Viruses. Springer US; pp. 129–157.

Gildow, F.E., Shah, D.A., Sackett, W.M., Butzler, T., Nault, B.A., Fleischer, S.J. 2008,

-p

Transmission efficiency of Cucumber mosaic virus by aphids associated with virus epidemics in

re

snap bean. Phytopathology 98, 1233–1241.

Groves, R.L., Walgenbach, J.F., Moyer, J.W., Kennedy, G.G., 2001. Overwintering of

lP

Frankliniella fusca (Thysanoptera: Thripidae) on Winter Annual Weeds Infected with Tomato spotted wilt virus and Patterns of Virus Movement Between Susceptible Weed Hosts.

ur na

Phytopathology 91(9), 891-9.

Gupta, R., Kwon, S-Y., Kim, S.T., 2018. An insight into the tomato spotted wilt virus (TSWV), tomato and thrips interaction. Plant Biotechnology Reports 12(3), 157–163.

Jo

Jacquemond, M., 2012. Cucumber mosaic virus. Adv. Virus Res. 84, 439–504. Kálmán, D., Palkovics, L., Gáborjányi, R., 2001. Serological, pathological and molecular characterisation of Hungarian Pepper mild mottle tobamovirus (PMMoV) isolates. Acta Phytopath. et Entomol. Hung. 36, 31-42.

Kaper, J. M., Waterworth, H. E., 1981. Cucumoviruses. In: Kurstak E, ed. Handbook of Plant Virus Infections and Comparative Diagnosis. Amsterdam, The Netherlands: Elsevier/ North Holland, 257-332. Karasev, A.V., Gray, S.M., 2013. Continuous and emerging challenges of Potato virus Y in potato. Annu. Rev. Phytopathol. 51, 571-86.

of

Kirk, W. D. J., and Terry, L. I. 2003. The spread of the western flower thrips Frankliniella

ro

occidentalis (Pergande). Agric. For. Entomol. 5:301–310.

-p

Kostova, D., Lisa V., Milne R.G., Vaira A.M., Dellavalle G., Tsorlianis S., 2003. Virus diseases of vegetable crops in southern Bulgaria. Phytopathol. Mediterr. 42, 3–8.

re

Kwon, J.Y., Hong, J.S., Kim, M.J., Choi, S.H., Min, B.E., Song, E.G., Kim, H.H., Ryu, K.H.,

Methods 206, 133-9.

lP

2014. Simultaneous multiplex PCR detection of seven cucurbit-infecting viruses. J. Virol.

ur na

Letschert, B., Günter, A., Dietrich-Eckhardt, L., Willingmann, P., Heinze, C., 2002. Detection and differentiation of serologically cross-reacting tobamoviruses of economical importance by RT-PCR and RT-PCR-RFLP. J. Virol. Methods 106, 1–10.

Jo

Li, J., Yang, P., Kang, J., Gan, Y., Yu, J., Calderón-Urrea, A., Lyu, J., Zhang, G., Feng, Z., Xie, J., 2016. Transcriptome Analysis of Pepper (Capsicum annuum) Revealed a Role of 24Epibrassinolide in Response to Chilling. Front. Plant Sci. 7,1281. Marchoux, G., Ginoux, G., Morris, C., Nicot, P., 2000. Pepper: the breakthrough of viruses. PHM Revue Horticole, 410 Suppl.: 17–20.

Margaria, P., Ciuffo, M., Turina, M., 2004. Resistance breaking strain of Tomato spotted wilt virus (Tospovirus; Bunyaviridae) on resistant pepper cultivars in Almería, Spain. Plant Pathol. 53(6), 795. McKinney, H.H., 1952. Two strains of Tobacco-mosaic virus, one of which is seed-borne in an etch-immune pungent Pepper. Plant Dis. Rep. 36(5), 184-187.

of

Moury, B., Verdin, E., 2012. Viruses of pepper crops in the Mediterranean basin: a remarkable

ro

stasis. Adv. Virus Res. 84, 127-62.

Nemes, K., Almási, A.,Tóbiás, I., Csilléry G., Salánki, K., 2015. Identification and molecular

-p

characteization of Tobacco Mild Green Mosaic Virus in Hungary. J. Plant Pathol. 97, S67-S77.

re

Neshev G., 2008. Bronzing on tomatoes and peppers is the cause of many headaches amongst

lP

gardeners. Plant Protection Bulletin, 1: 22–23, 26–27.

Pernezny, K.L., Roberts, P.D., Murphy, J.F., Goldberg, N.P., 2003. Compendium of Pepper

ur na

Diseases. American Phytopathology Society Press, St Paul, MN. Radcliffe, E.B., Ragsdale, D.W., 2002. Aphid-transmitted potato viruses: the importance of understanding vector biology. Am. J. Potato Res. 79, 353–386.

Jo

Roggero, P., Masenga, V., Tavella, L., 2002. Field Isolates of Tomato spotted wilt virus Overcoming Resistance in Pepper and Their Spread to Other Hosts in Italy. Plant Dis. 86 (9), 950-954.

Roossinck, M.J., Zhang, L., Hellwald, K.H., 1999. Rearrangements in the 5' nontranslated region and phylogenetic analyses of cucumber mosaic virus RNA 3 indicate radial evolution of three subgroups. J. Virol. 73(8), 6752-8.

Rosario, K., Nilsson, C., Lim, Y. W., Ruan, Y., Breitbart, M. 2009. Metagenomic analysis of viruses in reclaimed water. Environ. Microbiol. 11, 2806–2820. Salamon, P., Nemes, K., Salánki, K., 2010. A paradicsom foltos hervadás vírus (Tomato Spotted Wilt Virus, TSWV) rezisztencia törzsének izolálása paprikáról (Capsicum annuum L.) Magyarországon. 56. Növényvédelmi Tudományos Napok Budapest 23 Salánki, K., Carrère, I., Jacquemond, M., Balázs, E., Tepfer, M., 1997. Biological properties of

of

pseudorecombinant and recombinant strains created with cucumber mosaic virus and tomato

ro

aspermy virus. J. Virol. 71(5), 3597-602.

Salanki, K., Thole, V., Balazs, E., Burgyan, J., 1994. Complete Nucleotide-sequence of the

-p

RNA-3 from Subgroup-II of Cucumber Mosaic-virus (CMV) Strain - Trk7. Vir Res 31(3), 379-

re

384.

Sharman, M., Persley, D.M., 2006. Field isolates of Tomato spotted wilt virus overcoming

lP

resistance in capsicum in Australia. Australasian Plant Pathol. 35(2), 123-128.

ur na

Spence, N.J., Scaly, I., Mills, P.R., Foster, G.D., 2001. Characterization of a Tobamovirus from Trailing Petunias.Eur. J. Plant Pathol. 107, 633–638. Svoboda, J., Svobodová-Leišová, L., 2012. Occurrence of viruses on pepper plantations in the

Jo

Czech Republic. Hort. Sci. 39(3), 139–143. Thole, V., Dalmay, T., Burgyán, J., Balázs, E., 1993. Cloning and sequencing of potato virus Y (Hungarian isolate) genomic RNA. Gene 123(2), 149-56. Thomas-Caroll, M.L., Jones, R.A.C., 2003. Selection, biological properties and fitness of resistance-breaking strains of Tomato spotted wilt virus in pepper. Annals of Applied Biology 142(2), 235-243.

Tóbiás, I., Csilléry, G., 1983. Virus diseases of pepper in greenhouse and plastic tunnel in Hungary. Eucarpia 5th Meeting on Genetics and Breeding on Capsicum and Eggplant Plovdiv, Bulgaria, p 45. Tóbiás, I., Almási, A., Csilléry, G., Nemes, K., Salánki, K. 2017. Virus diseases of pepper (Capsicum annuum L.) in Hungary. Agriculture & Food Vol. 5.

of

Vinayarani, G., Madhusudhan, K.N., Deepak, S.A., Niranjana, S.R., Prakash H.S., 2011.

ro

Detection of Mixed Infection of Tobamoviruses in Tomato and Bell Pepper by using RT-PCR and Duplex RT-PCR. Int. J. Plant Pathol. 2(2), 89-95.

-p

White, J.L., Kaper, J.M., 1989. A simple method for detection of viral satellite RNAs in small

re

tissue samples. J. Vir. Met. 23, 83–94.

Wijkamp, I., van Lent, J., Kormelink, R., Goldbach, R., Peters, D., 1993. Multiplication of

lP

tomato spotted wilt virus in its insect vector, Frankliniella occidentalis. J. Gen. Virol. 74(3), 341-

Jo

ur na

9.

Table 1. The cDNA clones used for optimisation of PCR reactions.

CMV I

Rs

CMV II PVY TMV PMMoV

R H VO2 SzC1

TSWV

Szentes

Reference Diveki et al. 2004 Salanki et al. 1997 Thole et al. 1993 Tóbias el al. Kiss et al. Almasi et al. 2015

of

Isolate

-p

ro

Virus name

re

Table 2. Oligonucleotides primers used in the multiplex RT-PCR

re v

TGTGCCATGATTTGCCTAAGTGTTG

CMV

TSWV

ur na

PVY

lP

for

Genes of Sequence (5'-3') interest GGGAATTCCGCGGAAATGACACAATYGATGCAG GAG CP gene

Virus

for

CTTTCTCATGGATGCTTCTCCGCG

re v

CGTGGTCTCCTTTTGGAGGCC

for

CCCAGCATTATGGCAAGCC

Jo

re v

tobam o

Cap. actin

for

GGGCTAGCGGAAAACCTCGACCAGATCA G(AT)CGC(GC)GA(GT)C(GT)GATTCGT(AT)TTAA ATATG

re v

TGGGCC(GC)CTACC(GC)G(GC)GG3

for

AGGGATGGGTCAAAAGGATGC

PCR size (bp) 500

CP gene

1000

S segment

350

CP gene

750

actin

230

GAGACAACACCGCCTGAATAGC

Jo

ur na

lP

re

-p

ro

of

re v