A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice

BBADIS-63642; No. of pages: 13; 4C: 6, 7, 8, 9 Biochimica et Biophysica Acta xxx (2013) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis

Q1 3 4 5

Wint Nandar a, Elizabeth B. Neely a, Erica Unger b, James R. Connor a,⁎ a b

Department of Neurosurgery, The Pennsylvania State University, M. S. Hershey Medical Center, Hershey, PA 17033, USA Department of Biobehavioral Health, The Pennsylvania State University, University Park, PA 16802, USA

a r t i c l e

i n f o

a b s t r a c t

Article history: Received 22 October 2012 Received in revised form 5 February 2013 Accepted 12 February 2013 Available online xxxx

D

P

Because of the increasing evidence that H63D HFE polymorphism appears in higher frequency in neurodegenerative diseases, we evaluated the neurological consequences of H63D HFE in vivo using mice that carry H67D HFE (homologous to human H63D). Although total brain iron concentration did not change significantly in the H67D mice, brain iron management proteins expressions were altered significantly. The 6-month-old H67D mice had increased HFE and H-ferritin expression. At 12 months, H67D mice had increased H- and L-ferritin but decreased transferrin expression suggesting increased iron storage and decreased iron mobilization. Increased L-ferritin positive microglia in H67D mice suggests that microglia increase iron storage to maintain brain iron homeostasis. The 6-month-old H67D mice had increased levels of GFAP, increased oxidatively modified protein levels, and increased cystine/glutamate antiporter (xCT) and hemeoxygenase-1 (HO-1) expression indicating increased metabolic and oxidative stress. By 12 months, there was no longer increased astrogliosis or oxidative stress. The decrease in oxidative stress at 12 months could be related to an adaptive response by nuclear factor E2-related factor 2 (Nrf2) that regulates antioxidant enzymes expression and is increased in the H67D mice. These findings demonstrate that the H63D HFE impacts brain iron homeostasis, and promotes an environment of oxidative stress and induction of adaptive mechanisms. These data, along with literature reports on humans with HFE mutations provide the evidence to overturn the traditional paradigm that the brain is protected from HFE mutations. The H67D knock-in mouse can be used as a model to evaluate how the H63D HFE mutation contributes to neurodegenerative diseases. © 2013 Published by Elsevier B.V.

T

E

Keywords: H63D HFE Iron Oxidative stress Gliosis Neurodegenerative disease

R

E

C

7 8 9 10 11 12 14 13 15 16 17 18 19 20 21

R O

6

F

2

A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice

O

1

44

R

43

1. Introduction

46 47

HFE polymorphisms are common allelic variants in Caucasians, particularly in Northern European (1:200–400) and Irish (1:100) populations. HFE protein interacts with the transferrin receptor (TfR) and regulates transferrin-mediated iron uptake [1,2]. Two common HFE polymorphisms, H63D and C282Y, result in loss of ability to limit iron uptake via TfR. The C282Y HFE, generally associated with hereditary hemochromatosis (HH), is relatively rare (1.9%) while the H63D HFE (8.1%) is more common in the general population [3,4]. Although the penetrance of H63D HFE for HH is lower than the C282Y HFE, the H63D HFE variant is associated with increased serum transferrin saturation, increased serum ferritin level and increased serum iron level particularly in elderly populations (> 55 years) and in some of the demographic subgroups such as Mexican-American

50 51 52 53 54 55 56 57 58

U

48 49

N C O

45

⁎ Corresponding author at: Department of Neurosurgery, The Pennsylvania State University, College of Medicine, 500 University Drive (H110), Hershey, PA 17033-0850, USA. Tel.: +1 717 531 4541; fax: +1 717 531 0091. E-mail addresses: [email protected] (W. Nandar), [email protected] (E.B. Neely), [email protected] (E. Unger), [email protected] (J.R. Connor).

22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 42 41

[5–7]. This biochemical penetrance of the H63D allele resulted in our investigations into the relationship between the H63D HFE genotype and late onset neurodegenerative diseases [8] where increased brain iron is often reported [9,10]. The HFE protein is expressed in endothelial cells, choroid plexus and the ependymal cells where it can influence brain iron content [11]. However, based on misinterpretation of studies in the mid1900s, the brain is thought to be protected from iron overload associated with HFE mutations. However, these studies in the mid-1900s [12,13] and recent MRI studies [14–16] all demonstrate an iron accumulation in the brain of HH-patients; including those areas protected by the blood–brain-barrier. Moreover, in healthy aged individuals the presence of H63D HFE and transferrin C2 is associated with higher brain ferritin iron [17]. Increased hippocampal and basal ganglia iron is associated with poor declarative and verbal working memory [18]. However, Jahanshad et al. [19] recently reported a positive association between H63D HFE and white matter fiber integrity in healthy adults. A relationship between iron accumulation and neurodegenerative disease is established [9,10] so it was logical to consider a relationship between HFE genotypes and neurodegenerative diseases.

0925-4439/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.bbadis.2013.02.009

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79

2.1. Generation of H67D knock-in mice

111 112

136 137

The H67D knock-in mice (mouse homologous to H63D in humans) were commercially generated (inGenious Targeting Laboratory, Inc, NY) as previously described by Tomatsu et al. [28]. Briefly, the HFE gene isolated from 129/SvJ mouse bacterial artificial chromosome library was subcloned into the pBS vector. The H67D point mutation (199C to –G) was introduced into exon 2 of HFE gene by site-directed mutagenesis, which destroyed a BspHI restriction site. The HFE gene fragment containing H67D mutation was added between the thymidine kinase (TK) and neo r gene of a targeting vector (pPNT–loxP2 vector). The resulting targeting vector was linearized with NotI and introduced into the 129/Sv-derived embryonic stem (ES) cell line RW4 (Incyte Genomics Systems, St. Louis) by electroporation. ES clones that were resistant to both 200 μg/ml G418 (BIBCO/BRL) and 2 μM ganciclovir (Syntex Chemicals, Boulder, CO) were isolated and used for injection into C57BL/6J blastocysts. Chimeric males were bred to C57BL/6J females for germ-line transmission. The F1 heterozygous mice were bred to Cre mice to remove neor gene flanked by loxP sites. The resultant neor-excised heterozygotes were interbred to generate wild-type (+/+), heterozygous (+/H67D) and homozygous (H67D/H67D) H67D knock-in mice. Mice were maintained under normal housing conditions. They were given ad libitum access to rodent chow pellets and water. Both males and females were included in all experiments. All procedures were conducted according to the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Pennsylvania State University College of Medicine Institutional Animal Care and Use Committee.

138

2.2. Mice genotyping

139

DNA was isolated from tail biopsies according to DNeasy blood and tissue kit (QIAGEN, CA). To amplify HFE gene including the H67D

105 106

113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135

140

2.3. Measurement of iron

148

Brain and liver samples were harvested from 6- and 12-monthold wild-type (+/+), heterozygous (+/H67D) and homozygous (H67D/H67D) H67D knock-in mice. Samples were diluted 1:10 (wt:v) with 0.32 M sucrose and homogenized. Total brain and hepatic iron concentrations (μg/g of tissue; wet weight) were measured triplicate by graphite furnace atomic absorption spectrometry (model 5100AA, Perkin-Elmer, Norwalk, CT) according to standard protocol [29].

149

143 144 145 146 147

150 151 152 153 154 155 156

2.4. Immunblotting

157

Brain and liver tissues from 6- and 12-month-old wild-type (+/+), +/H67D and H67D/H67D mice (n= 4–6/genotype) were homogenized in homogenization buffer: 1× PBS, 0.5% NP-40 (IGEPAL; Sigma, St. Louis, MO) and protease inhibitor cocktail (1:100; Sigma, St. Louis, MO). The total protein concentration was determined with Pierce BCA protein assay kit (Thermo scientific, MA). Total brain or liver homogenates (20 μg) were separated by electrophoresis in Criterion polyacrylamide Tris–HCl gel (4–20%; Bio-Rad, Hercules, CA). Proteins were then transferred to nitrocellulose membranes and the membranes were blocked with 5% nonfat dry milk for 1 h at room temperature. After overnight incubation at 4 °C with primary antibodies, membranes were then incubated with enhanced chemiluminescent (ECL) anti-host horseradish peroxidase-linked secondary antibodies (Amersham Bioscience, Piscataway, NJ) for 1 h at room temperature. The signal was visualized by ECL detection (Perkin Elmer, Waltham, MA) and Multigauge software (V3.0; Fuji film system) was used to quantitate the intensity of the band. Following primary antibodies were used: HFE (1:500; Sigma, St. Louis, MO), H-ferritin (1:1000; Covence, Princeton, NJ), L-ferritin (1:500; abcam, Cambridge, MA), transferrin receptor (1:500;; Zymed Laboratories Inc., San Francisco, CA), divalent metal transporter-1 (1:1000; Convence, Princeton, NJ), transferrin (1:1000; MP biomedicals, Solon, OH), T cell immunoglobulin and mucin domain-containing protein-2 (Tim-2; 1:2000; abcam, Cambridge, MA), cystine/glutamate antiporter (xCT; 1:500; abcam, Cambridge, MA), hemeoxygenase-1 (HO-1; 1:500; Enzo Life Science, Farmingdale, NY), Nrf2 (1:1000; abcam, Cambridge, MA), GFAP (1:2000; Dako, Carpinteria, CA) and beta-actin (1:3000; Sigma, St. Louis, MO).

158

2.5. Histology

185

Six- and 12-month-old wild-type (+/+) and H67D/H67D mice (n = 4/genotype) were perfused transcardially with Ringer's solution followed by ice-cold 4% paraformaldehyde. The brains were paraffinembedded and sectioned coronally at 6-μm-thick. The sections were deparaffinized and then rehydrated through a series of ethanol. After antigen retrieval with sodium citrate (pH 6), endogenous peroxidase activity was blocked with hydrogen peroxide (3.7% in methanol) for 20 min at room temperature. The sections were then blocked for 1 h with 2% milk and were incubated with primary antibodies overnight at 4 °C followed by 1 h of incubation at room temperature with biotinylated anti-host secondary antibody (1:200; vector laboratories, Burlingame, CA). Immunoreactivity was detected using the avidin biotin complex (ABC) and 3,3′-diaminobenzidine (DAB; vector laboratories, Burlingame, CA). The sections were analyzed with a bright-field microscopy by an investigator blinded for

186 187

T

103 104

C

101 102

E

99 100

R

97 98

R

95 96

O

93 94

C

91 92

N

89 90

U

87 88

F

110

86

O

2. Material and methods

84 85

141 142

R O

109

82 83

variant PCR analysis was conducted using a forward primer (5′AGG ACTCACTCTCTGGCAGCAGGAGGTAACCA3′) and a reverse primer (5′TTTCTTTTACAAAGCTATATCCCCAGGGT3′). PCR conditions were: 94 °C for 15 min, 94 °C for 45 s, 58 °C for 45 s, 39 cycles of 72 °C for 90 s and 72 °C for 10 min. Amplified PCR fragments were digested with BspHI restriction enzyme for 2 h at 37 °C to detect H67D point mutation. DNA fragments were separated by 2% agarose gel electrophoresis.

E

107 108

The investigations into such a relationship in Alzheimer's disease have given mix results although most studies report either a relationship or a trend for H63D HFE to impact the disease particularly in the presence of the ApoE4 mutation [8,20]. In amyotrophic lateral sclerosis (ALS), the data are more consistent that H63D HFE is a risk factor [8] although recent reports did not find an association [21,22]. However, in a recent study [21] control subjects were pooled from five published studies which could be problematic because frequency of HFE genotype is region dependent. Nonetheless, these studies still reported, as the others, as many as 30% incidence of H63D HFE in the ALS population [21,22]. Thus, to determine the specific effects of H63D HFE on phenotypes we have developed cell models [23] and, in this paper, introduce an animal model, which carries an analogous HFE mutation (H63D HFE). In a human neuroblastoma cell line expressing different HFE genotypes, the H63D cells have increased iron, oxidative stress [23] and endoplasmic reticulum stress [24], increased glutamate release and monocyte chemoattractant protein-1 secretion [25,26] and tau phosphorylation [27]; each of which is proposed as a contributing factor to neurodegenerative diseases. Thus, we hypothesized that H63D HFE enables a convergence of mechanisms that promote pathogenic processes. In this study, we generated in vivo model, a H67D knock-in mouse line (mouse homolog of the human H63D), to evaluate the neurological consequences of H63D HFE in vivo under controlled environmental conditions. We demonstrated that H63D HFE alters brain iron homeostasis and creates an environment of oxidative stress. In the long-term H67D mice will serve as a model to explore how H63D HFE impacts disease mechanisms and therapeutic interventions in neurodegenerative disorders.

P

80 81

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

D

2

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184

188 189 190 191 192 193 194 195 196 197 198 199 200

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

226 227 228 229 230 231

F

236 237 238 239 240 241 242

244 245

2.8. Statistical analyses

252

Data were expressed as mean ± standard error. An analysis of variance (one-way ANOVA; GraphPad Prism 4) followed by a Tukey multiple comparison or Dunnett test was used to compare between experimental groups. For iron measurement, two-way ANOVA was performed to analyze the interaction of age and genotype with iron concentration. Bonferroni posttest was used to compare between experimental parameters. A value of p b 0.05 was considered significant for all experiments.

253

C

225

234 235

As a consequence of oxidative modification to proteins, carbonyl groups are introduced to the side chain of amino acids. These carbonyl groups hallmark the oxidative status of protein [30]. An Oxyblot kit (Millipore, Billerica, MA) was used to measure protein carbonyl levels. Briefly, total brain homogenates (20 μg) from 6- and 12-month-old wild-type, +/H67D and H67D/H67D mice (6/genotype) were reacted with 2,4-dinitrophenylhydrazone (DNP-hydrazone). Samples were then treated according to the manufacturer's protocol.

E

218 219

243

R

216 217

2.7. Measurement of oxidatively modified proteins

R

214 215

N C O

212 213

U

210 211

O

Brain samples from 6- and 12-month-old mice (5 to 6/genotype) were weighed and homogenized with 1.5 ml of 0.32 M sucrose. After adding 2 ml of 0.85 M sucrose samples were centrifuged for 30 min at 41,000 rpm at 4 °C. The supernatant was discarded; the middle layer was collected and resuspended with 2.5 ml iron free water (Sigma, St. Louis, MO). The samples were centrifuged for 15 min at 41,000 rpm at 4 °C. Supernatant was discarded and the pellet was resuspended with 3.0 ml iron free water. The samples were centrifuged 10 min at 17,000 rpm at 4 °C and collected the pellet,

208 209

R O

223 224

207

232 233

P

2.6. Myelin isolation and analysis of myelin protein

205 206

which was crude myelin protein. The pellets were kept at − 80 °C for 20 min and then were freeze-dry using a lyophilizer overnight. The pellets were then left at room temperature for 20 min and were weighed. The pellets were resuspended with RIPA buffer (Sigma, St. Louis, MO) and centrifuged 45 min at 51,000 rpm at 4 °C. Supernatant was collected and protein concentration was determined with Pierce BCA protein assay kit (Thermo scientific, MA). Total protein of 10 μg was used for immunoblot analyses to determine the expression of myelin basic protein (MBP; 1:1000; abcam, Cambridge, MA), proteolipid protein (PLP; 1:1000; Millipore, Billerica, MA) and CNPase (1:500; abcam, Cambridge, MA).

D

222

203 204

T

220 221

genotypes. Following primary antibodies were used for immunostaining: L-ferritin (1:250; abcam, Cambridge, MA), transferrin receptor (1:250; Zymed Laboratories Inc., San Francisco, CA), divalent metal transporter-1 (1:200; convence, Princeton, NJ) and transferrin (1:200; MP biomedicals, Solon, OH). For immunofluorescence, after overnight incubation with rabbit anti-GFAP antibody (1:1000; Dako, Carpinteria, CA) or rabbit Iba-1 antibody (1:600; Wako, Richmond, VA), sections were probed with Alexa Flour 488 secondary antibody (Invitrogen, Grand Island, NY) for 1 h in the dark at room temperature. After washes, slides were mounted and the sections were analyzed with fluorescence microscopy. For double immunofluorescence staining, because both L-ferritin and Iba-1 antibodies were made from the same host we fluorescently labeled L-ferritin using a DyLight 550 antibody labeling kit (Thermo fisher scientific, Waltham, MA) prior to the incubation with brain sections. The sections were first incubated overnight with rabbit Iba-1 antibody followed by overnight incubation with DyLight 550 labeled L-ferritin. The sections were then probed with Alexa Flour 488 secondary antibody for 1 h in the dark at room temperature. After washes, the slides were mounted and the sections were analyzed with fluorescence microscopy.

E

201 202

3

Fig. 1. Increased body weight and hepatic iron concentration in H67D knock-in mice. (A) Generation of H67D knock-in mice. PCR analysis of DNA obtained from tail biopsies was followed by digestion with BspHI restriction enzyme to detect the H67D point mutation. DNA digested with BspHI from wild-type mice (+/+) results 240 and 260 bp; DNA digested with BspHI from +/H67D mice results 500, 240 and 260 bp and DNA digested with BspHI from H67D/H67D results 500 bp. (B) Body weight was taken at 6 and 12 months of age in three groups. At both ages, body weight of H67D/H67D mice is higher compared to the wild-type mice. Bars represent mean ± standard error. (* = pb 0.05, ** = p b 0.01; n = 14 to 36 per genotype for each age group). (C) Total iron concentration measured by atomic absorption spectrometry is 67% and 70% increase in the liver of 6- and 12-month-old H67D/H67D mice compared to the wild-type (+/+) mice. Hepatic iron concentration in H67D/H67D mice is 65% and 64% increase compared to +/H67D mice for both age groups. Bars represent mean ± standard error. * represents a significant difference from wild-type (p b 0.05) and # represents a significant difference from +/H67D (p b 0.05). n = 4 to 9 per genotype.

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

246 247 248 249 250 251

254 255 256 257 258 259 260

4

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx Table 1 Summary findings from neurological characterization of the H67D mice.

Iron HFE H-ferritin L-Ferritin Transferrin receptor Transferrin Divalent metal transporter-1 Tim-2 Myelin proteins Iba-1 (microglia) GFAP Oxidatively modified proteins Cystine/glutamate transporter (xCT) Hemeoxygenase-1 (HO-1) Nrf2

291

A H67D knock-in mouse line (mouse homolog of the human H63D) was generated by site-directed mutagenesis to murine HFE gene. The resultant heterozygous mice were bred to generate wildtype, heterozygous and homozygous H67D knock-in mice. Mice carrying the H67D variant were indistinguishable at birth from their littermate controls. Homozygous H67D mice develop normally and are reproductively viable. Genotyping of mice was performed by PCR analysis of DNA obtained from tail biopsies and subsequent digestion with BspHI restriction enzyme (Fig. 1A). Body weights of mice were taken at 6- and 12-months of age. At both ages, H67D/H67D mice had significantly higher body weight than wild-type mice while the heterozygous H67D (+/H67D) mice had similar body weight as the wild-type (Fig. 1B). To confirm whether the allelic variant is functional we determined hepatic iron levels in 6- and 12-month-old H67D mice. Compared to the wild-type mice, 6- and 12-month-old H67D/H67D mice had a 67% (266.4 ± 27.3 vs. 159.6 ± 31.9 μg/g of liver) and 70% (281.35 ± 50.7 vs. 165.7±22.9 μg/g of liver) increase in hepatic iron concentration while +/H67D mice had similar hepatic iron concentration as wild-type mice at both ages (Fig. 1C). Six and 12-month-old H67D/H67D mice also had changes in iron management protein expressions in the liver. Consistent with increased iron concentration iron storage proteins, H-ferritin and L-ferritin were significantly increased while iron transport protein transferrin receptor (TfR) was significantly decreased in H67D/H67D mice compared to wild-type mice at both ages. Ceruloplasmin, which is involved in iron export, was also significantly decreased in 12-month-old H67D/H67D mice compared to the wild-type (Supplementary Fig. 1). Together these results indicated that the allelic variant is functional in H67D mice.

292

3.2. Brain iron concentration in H67D mice

293

Total brain iron was measured in 6- and 12-month-old mice by atomic absorption spectrometry. At 6-months of age, total brain iron

278 279 280 281 282 283 284 285 286 287 288 289 290

294

C

E

276 277

R

274 275

R

272 273

O

270 271

C

268 269

N

266 267

U

264 265

R O

263

t1:4

22% ↑ ↑ ↑ Not different Not different Not different 40% ↓ Not different Not different Not different ↑ ↑ ↑ ↑ Not different

Not different Not different ↑ ↑ Not different ↓ Not different ↓ Not different ↑ Not different Not different Not different Not different ↑

t1:5 t1:6 t1:7

level was 22% higher in H67D/H67D (22.57 ± 2.0 μg/g of brain) and 18.6% higher in +/H67D mice (21.95 ± 1.4 μg/g of brain) compared to wild-type mice (18.5 ± 0.7 μg/g of brain) although these differences did not reach statistical significance (p = 0.26). At 12 months of age, total brain iron concentration in H67D/H67D mice (24.04 ± 1.1 μg/g) and +/H67D mice (27.76 ± 3.0 μg/g) was not different compared to wild-type mice (24.58 ± 1.4 μg/g). There was a significant interaction for age and iron concentrations indicating that regardless of genotypes brain iron concentration increased with age (p = 0.01). Compared to 6-month-old mice, by 12 months, brain iron concentration increased by 33% in the wild-type, 26.5% in the +/H67D but only 6.5% in H67D/H67D mice (Fig. 2 and Table 1).

P

3.1. Generation of H67D mice

12-month-old H67D mice

D

262

6-month-old H67D mice

E

3. Results

t1:3

T

261

O

Fig. 2. Total brain iron concentration is altered in H67D/H67D mice. Total brain iron was measured with atomic absorption spectrometry in 6- and 12-month old mice. Brain iron concentration is 22% and 18.6% increase in H67D/H67D and +/H67D compared to wild-type (+/+) mice at 6 months (p=0.26). At 12 months of age, brain iron level in H67D knock-in mice is not significantly different from the wild-type mice. Analysis of brain iron level by age indicates wild-type and +/H67D mice have increased brain iron with age (32.9% and 26.5% respectively). Brain iron level is increased only 6.5% in 12-month old H67D/H67D mice compared to 6-month-old H67D/H67D mice. Bars represent mean±standard error. (n=4 to 8 per genotype in both age groups).

Total expression level in the brain (relative to wild-type)

F

Proteins

t1:1 t1:2

t1:8

t1:9 t1:10 t1:11 t1:12 t1:13 t1:14 t1:15 t1:16 t1:17 t1:18 t1:19

295 296 297 298 299 300 301 302 303 304 305 306

3.3. Alteration in expression of proteins involved in iron homeostasis in 307 H67D mice 308 Although total iron levels are important, it is the response of the regulatory proteins that are perhaps most important because they maintain homeostasis. Thus, we evaluated the expressions of proteins involved in brain iron homeostasis: HFE, H-ferritin, L-ferritin, transferrin receptor (TfR), transferrin (Tf), divalent metal transporter-1 (DMT-1) and T cell immunoglobulin and mucin domain-containing protein-2 (Tim-2). Western blot analyses of brain homogenates from 6- and 12-month-old mice revealed differences in the levels of iron management proteins in H67D/H67D mice compared to the wild-type (Table 1 and Fig. 3). At 6 months, H67D/H67D mice had significant increases in HFE (Fig. 3A) and H-ferritin (Fig. 3C) and a 40% decrease in DMT-1 which did not reach statistical significance (p = 0.07; Fig. 3I). L-Ferritin, Tf, Tim-2 levels (Fig. 3E, G, K) and TfR (data not shown) in H67D/H67D mice were not different from wild-type mice. At 12 months of age, H67D/H67D mice had increases in H- and L-ferritin levels (Fig. 3D, F), and decreases in Tf (Fig. 3H) and Tim-2 levels (Fig. 3L) compared to wild-type mice. The relative concentrations of HFE, DMT-1 (Fig. 3B, J) and TfR (not shown) in H67D/H67D mice were not different from wild-type mice at this age. None of the iron management proteins levels in +/H67D mice were different from wild-type at any ages (Fig. 3A–L).

Fig. 3. Altered iron management protein expressions in H67D knock-in mice. (A–L) Brain homogenates from 6- and 12-month-old wild-type (+/+), +/H67D and H67D/H67D were determined for the presence of HFE, H-ferritin, L-ferritin, transferrin, divalent metal transporter-1 and T cell immunoglobulin and mucin domain-containing protein-2 (Tim-2) by Western blot. A representative Western blot is shown for each protein and quantification of blots is shown as bar graphs. The expression level was normalized to β-actin. At 6 months of age, HFE (A) and H-ferritin expression is increased (C) while DMT-1 expression is tended to decrease (I; p = 0.07) in H67D/H67D mice. L-Ferritin (E), transferrin (G) and Tim-2 expressions (K) are not significantly changed in H67D knock-in mice. At 12 months of age, H-ferritin (D) and L-ferritin (F) expressions are increased while transferrin (H) and Tim-2 expressions (L) are decreased in H67D/H67D compared to +/+ mice. HFE (B) and DMT-1 expressions (J) in H67D/H67D mice do not alter significantly. Bars represent mean ± standard error. * represents a significant difference from wild-type (* = p b 0.05; ** = p b 0.01). # represents a significant difference from +/H67D (# = p b 0.05; ## = p b 0.01; ### = p b 0.001; n= 4 to 6 per genotype).

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329

5

U

N C O

R

R

E

C

T

E

D

P

R O

O

F

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

353 354 355 356 357 358 359 360 361 362 363 364 365 366

381

O

F

3.5. H67D HFE is associated with astrogliosis

R O

351 352

375

369 370 371 372 373

376 377 378 379 380

To determine whether H67D HFE is associated with increased gliosis, we evaluated GFAP staining in H67D mice at both ages (Fig. 9 and Table 1). GFAP staining was increased in all observed brain regions; the cortex, hippocampus and the cerebellum in 6-month-old H67D/H67D (Fig. 9D, F, H, J) compared to wild-type mice (Fig. 9C, E, G, I), which is consistent with the significant increase in total GFAP level in H67D knock-in mice determined by immunoblotting (Fig. 9A). GFAP staining and total GFAP level in 12-month-old H67D mice was not changed significantly from wild-type mice (Fig. 9B, K–R).

382

3.6. H67D HFE is associated with oxidative stress

391

Because H63D HFE is associated with higher baseline stress in our cell models [23], we determined the level of oxidatively modified proteins (carbonyl level), and expression of xCT antiporter, which is essential for maintaining intracellular glutathione level [31], and hemeoxygenase-1 (HO-1; [32]) as indices of oxidative stress in H67D mice. The level of oxidatively modified proteins increased in

392

P

349 350

Crude myelin protein was extracted by sucrose gradient and ultracentrifugation and three major myelin proteins in myelin extract were analyzed in 6- and 12-month-old mice by immunoblotting. Myelin basic protein (MBP), proteolipid protein (PLP) and CNPase protein were not changed significantly between any of the groups at either age (Supplementary Fig. 4A–F and Table 1).

D

347 348

374

T

345 346

C

343 344

E

341 342

3.4. Myelin proteins were not changed in H67D mice

R

339 340

R

337 338

O

336

367 368

C

334 335

(Fig. 8 and Table 1). There also appeared to be an increase in number of Iba-1 positive microglia and L-ferritin immunoreactive microglia in 12-month-old H67D/H67D indicating the presence of microgliosis in H67D mice (Fig. 8E, F). However, the number of microglia in H67D mice at 6-months did not differ from wild-type mice (Supplementary Fig. 2 and Table 1). L-Ferritin did not co-localize with GFAP positive astrocytes (Supplementary Fig. 3).

N

332 333

We also determined the distribution and cellular localization of TfR, DMT-1, transferrin and L-ferritin by immunohistochemical staining in both age groups. At the cellular level, transferrin receptor (TfR) staining was primarily confined to neurons with very little or no TfR staining in the white matter tracts in either group. There appeared to be regional differences in staining for TfR at 6 months; compared to wild-type mice, H67D/H67D mice had weaker neuronal staining for TfR in the cortex (Fig. 4A–B) and the cerebellum (data not shown) but stronger TfR staining in the striatum (Fig. 4C–D). Immunohistochemical analysis for DMT-1 revealed that similar cell types were stained for DMT-1 protein in both groups (Fig. 5). However, compared to wild-type mice (Fig. 5A, C, E), 6-month-old H67D/H67D mice had relatively weaker neuronal staining for DMT-1 in the cortex (Fig. 5B) and the purkinje cells of cerebellum (Fig. 5F), and weaker staining in oligodendrocytes in the striatum (Fig. 5D). The DMT-1 immunostaining was not different between 2 groups at 12 months (data not shown), which is consistent with immunoblot analysis. For transferrin, the same type of cells was positive for staining in both wild-type and H67D/H67D mice. Neuronal transferrin staining was observed in the cortex (Fig. 6A, B) while transferrin staining was found predominantly in oligodendrocytes in the striatum and corpus callosum (Fig. 6C–F). Staining intensity for transferrin was much less in H67D/H67D (Fig. 6B, D, F) compared to wild-type mice in all regions examined at 12 months (Fig. 6A, C, E). Higher L-ferritin staining intensity was seen only in 12-month-old H67D/H67D mice compared to wild-type mice, which is consistent with immunoblot analysis. L-Ferritin staining was found primarily in the glial cells, although there was relatively weak neuronal staining in the cortex of H67D/H67D (Fig. 7A–B). L-Ferritin staining was primarily found in the oligodendrocytes in the striatum and thalamus (Fig. 7C–F) in both groups; however, there was more robust L-ferritin staining in H67D/H67D mice (Fig. 7B, D, F) compared to the wild-type mice (Fig. 7A, C, E). To determine whether L-ferritin positive glial cells observed in the cortex were either astrocytes or microglia, we performed double immunofluorescence staining. The fluorescence analysis also reveals an increase L-ferritin staining in 12-month-old H67D/H67D mice and strong co-localization of L-ferritin with Iba-1 positive microglia

U

330 331

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

E

6

Fig. 4. Immunohistochemical localization for transferrin receptor (TfR). Neurons in the cortex of both wild-type (+/+) and H67D/H67D mice express TfR (A, B); however TfR staining is weaker in H67D/H67D mice. In striatum, TfR staining is primarily confined to neurons in both groups with little or no TfR staining is observed in the white matter tract. Compared to wild-type, H67D/H67D mice have relatively higher staining intensity for TfR in the striatum (C, D). A scale bar represents 50 μm. n=4 per genotype.

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

383 384 385 386 387 388 389 390

393 394 395 396 397

7

P

R O

O

F

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

T

C

R

E

the oxidatively modified proteins level, and xCT and HO-1 expression 403 between three groups at 12 months of age (Fig. 10B, D, F and Table 1). 404 To examine whether an increase oxidative stress observed in 405 6-month-old H67D mice, is associated with an impaired cellular defense 406 system against redox stress we measured the expression of nuclear 407

R

401 402

both H67D/H67D (64%) and +/H67D (50%) mice at 6 months of age compared to the wild-type (Fig. 10A and Table 1). Moreover, xCT expression was 86% higher and HO-1 expression was 27% higher in the brains of 6-month-old H67D/H67D mice compared to the wild-type mice (Fig. 10C, E and Table 1). However, there was no difference in

N C O

399 400

U

398

E

D

Fig. 5. Immunohistochemical localization for divalent metal transporter-1(DMT-1). Neurons in the cortex of both wild-type (+/+) and H67D/H67D mice express DMT-1 with much less DMT-1 staining is observed in H67D/H67D mice compared to wild-type mice (arrows in A, B). In striatum, DMT-1 expresses predominantly in oligodendrocytes (arrows in C, D). Blood vessels staining for DMT-1 are also observed in both wild-type and H67D/H67D mice; however, the staining intensity is relatively weaker in H67D mice (arrow head in C, D). In cerebellum, strong neuronal staining for DMT-1 is observed in Purkinje cells in wild-type mice (arrows in E). In contrast, Purkinje cells of cerebellum in H67D/H67D mice have relatively little staining for DMT-1 (arrows in F). bv = blood vessel. A scale bar represents 50 μm. n = 4 per genotype.

Fig. 6. Immunohistochemical localization for transferrin. Neurons in the cortex of both wild-type (+/+) and H67D/H67D mice express transferrin (arrows in A, B). Few transferrin positive oligodendrocytes are observed in the cortex (arrow head in A, B). However, transferrin expresses predominantly in oligodendrocytes in the striatum (arrows in C, D) and corpus callosum (arrows in E, F) of both wild-type and H67D/H67D mice. Transferrin positive oligodendrocytes appear in a row in the corpus callosum (arrows in E, F) and only a few of process bearing oligodendrocytes staining for transferrin are present (arrow heads in E, F). In all observed regions, transferrin staining is much less in H67D/H67D mice compared to the wild-type mice. LV = lateral ventricle; bv = blood vessel. A scale bar represents 50 μm. n = 4 per genotype.

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

P

R O

O

F

8

T

O

R

R

E

C

413

Because liver iron accumulation is a common histologic finding 414 and perhaps the gold standard for diagnosis of HFE associated hemo- 415 chromatosis we first determined the liver iron concentration in H67D 416

C

412

4. Discussion

N

410 411

factor E2-related factor 2 (Nrf2) that controls endogenous antioxidant genes transcription. The expression of Nrf2 in 6-month-old H67D/H67D and +/H67D mice was not different from wild-type mice (Fig. 11A and Table 1) but was 69% higher (pb 0.05) in 12-month-old H67D/H67D mice compared to the wild-type (Fig. 11B and Table 1).

U

408 409

E

D

Fig. 7. Immunohistochemical localization for L-ferritin. L-Ferritin staining in the cortex is relatively weak in both wild-type (+/+) and H67D/H67D mice. The staining is mostly confined to glial cells (arrows in B). L-Ferritin staining in the striatum (arrows in C and D) and the thalamus (E–F) is primarily confined to oligodendrocytes. L-Ferritin staining in the cortex, striatum and the thalamus is relatively weak in wild-type mice (A, C, and E). In contrast, L-ferritin staining is more robust with more L-ferritin-positive oligodendrocytes in H67D/H67D mice (B, D, and F). A scale bar represents 50 μm. n= 4 per genotype.

Fig. 8. Double immunostaining showing the co-localization of L-ferritin and Iba-1. Double fluorescence analysis indicates that L-ferritin fluorescence staining is present primarily in the glial cells in the cortex of both wild-type (+/+) and H67D mice (A, D); however there are increased number of L-ferritin positive glial cells in H67D mice (D). Merged images indicate the co-localization of L-ferritin with Iba-1 positive microglia to greater extent (C, F). More L-ferritin positive microglia is observed in the cortex of H67D mice (E, F) compared to the wild-type (B, C). A scale bar represents 50 μm. n= 4 per genotype.

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

9

N C O

R

R

E

C

T

E

D

P

R O

O

F

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

U

Fig. 9. Increased GFAP in 6-month-old but not in 12-month-old H67D knock-in mice. (A, B) GFAP protein expression was determined in brain homogenates from 6- and 12-month-old mice. Quantification of blots is shown as bar graphs. The expression level was normalized to β-actin. At 6-months, the +/H67D and H67D/H67D mice have significant increase in GFAP protein expression compared to +/+ mice. Total brain GFAP expression in 12-month-old +/H67D and H67D/H67D mice did not change significantly compared to +/+ mice. Bars represent mean ± standard error. (* = p b 0.05; ** = p b 0.01; n= 5 to 6 per genotype). (C–J) Immunofluorescence analyses of GFAP in brains of 6-month-old mice indicates that GFAP immunoreactivity is increased in the cortex (D), hippocampus (F and H) and cerebellum (J) of H67D/H67D compared to +/+ mice (C, E, G and I) (n = 4 per genotype). (K–R) Immunofluorescence analyses of GFAP in brains of 12-month-old mice indicates that GFAP immunoreactivity in the cortex (L), hippocampus (N and P) and cerebellum (R) of H67D/H67D mice is not different compared to +/+ mice (K, M, O and Q) (n = 4 per genotype).

417 418 419 420 421 422 423 424

mice. Even on standard diet, total hepatic iron content was significantly elevated in both 6- and 12-month-old H67D/H67D mice, which is consistent with the previous report of Tomatsu et al. [28] for 10-week-old H67D mice. H67D/H67D mice also had significant alterations in expression of liver iron management proteins such as increased storage proteins while decreased transport proteins. Changes in liver iron profiles in H67D mice indicate that the H67D allelic variant is functional in these mice. Although H67D mice are indistinguishable from wild-type

mice at birth, H67D/H67D mice have increased weight gain with age. Increased body weight together with higher hepatic iron concentration in H67D mice may be relevant to the increased prevalence of metabolic syndrome including obesity that is positively associated with elevated iron stores and increased serum ferritin levels [33–36]. Thus, the utility of this model could extend beyond studies directly involving the nervous system and have relevance to studies on HFE mutations in general. Because HFE polymorphisms are common allelic variants in Caucasians,

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

425 426 427 428 429 430 431 432

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

O

R

R

E

C

T

E

D

P

R O

O

F

10

433 434 435 436 437 438 439 440 441 442 443 444

U

N

C

Fig. 10. Increased oxidative stress in H67D knock-in mice. An oxyblot assay and slotblot analysis was used to measure total oxidatively modified protein levels in 6-month-old and 12-month-old mice. (A and B). Total oxidatively modified protein levels is significantly higher in 6-month-old +/H67D (50%) and H67D/H67D (64%) compared to wild-type (+/+) mice (A). By 12-months, total oxidatively modified protein levels in H67D mice do not change significantly compared to +/+ mice (B). Brain homogenates from 6- and 12-month-old wild-type (+/+), +/H67D and H67D/H67D were determined for the expression of cystine/glutamate antiporter (xCT) that is essential for maintaining intracellular glutathione level and hemeoxygenase-1 (HO-1). A representative Western blot is shown and quantification of blots is shown as bar graphs. The expression level was normalized to β-actin. The expression of xCT and HO-1 in 6-month-old H67D/H67D is increased by 86% and 27% respectively compared to the wild-type (+/+) mice (C, E). Brain xCT and HO-1 expression level in H67D/H67D and +/H67D mice is not significantly different compared to the wild-type (+/+) mice at 12-months (D, F). Bars represent mean ± standard error. (* = p b 0.05; ** = p b 0.01; *** = p b 0.001; n= 5 to 6 per genotype).

the H67D mouse line presented here is a meaningful model for human aging and diseases. This model differs from previous investigations that used HFE knockout mice into the association between HFE and brain iron accumulation. Although both our model and the knockout model accumulate iron in the liver [28,37], only our H67D knock-in model showed brain iron accumulation. However, the HFE knockout mice were examined at an earlier age than ours [38,39]. Our model with an analogous HFE mutation (H67D HFE) is more similar to the human condition and MRI studies [14–16] and early histological studies [12,13] that report increased iron in the brain in association with HFE mutations. The presence of the HFE mutation is associated with

multiple changes in cells and animal models, including ER stress [24] and cholesterol disruption [40] which suggest the HFE mutant protein may impact the cell phenotype beyond iron uptake. Our study evaluated brain iron profiles in H67D knock-in mice at 6 and 12 months of age. Brain iron was increased by 22% in H67D mice, but this was not statistically significant. However, there was increased expression of iron storage protein H-ferritin at both ages as well as an increase in L-ferritin at 12 months in the H67D mice. These findings are strong indication that the increased amount of brain iron in H67D mice was biologically meaningful and suggest brain iron metabolism is altered in these mice. Perhaps the most impressive evidence for altered brain iron homeostasis in H67D mice is

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

445 446 447 448 449 450 451 452 453 454 455 456

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

11

462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485

R

R

460 461

N C O

459

the gliosis and increased oxidative stress indicated by increased oxidatively modified proteins, and increased expression of xCT and HO-1. Of note, is that the consequences of loss of iron homeostasis (increased oxidative stress and astrogliosis) are manifested in the brains of the 6-month-old mice but not at 12 months. The lack of oxidative stress in 12 months of age could be the result of an apparent adaptive response to the oxidative stress mediated by Nrf2 which was elevated in the 12-month-old H67D mice. In addition to the increase in Nrf2 as an adaptive response, there are multiple adaptive responses by the iron management proteins. At 6 months, H67D mice have increased H-ferritin which is involved in rapid iron uptake and iron detoxification [41,42], and a regional decrease in TfR, which delivers iron to neurons [43,44]. The expression of ferritin and TfR are regulated post-transcriptionally according to iron status. Iron overload increases ferritin protein synthesis while decreases TfR protein synthesis [10]. Thus, increased H-ferritin is consistent with increased iron concentration in H67D mice. Although we expected a decrease in TfR expression, total TfR expression in H67D mice was not different from wild-type mice. At cellular level however, we found regional differences in TfR staining in H67D mice with relatively weaker in the cortex and cerebellum but increased TfR staining in the striatum compared to the wild-type. Regional differences in TfR expression have been reported by Dornelles et al. [45] who demonstrated that iron loading decreased TfR mRNA in the cortex and hippocampus while it increased TfR mRNA in the striatum. Regional differences in TfR expression may be associated with heterogeneity of iron distribution in the brain [46,47]. In all brain regions examined, we found that TfR staining was primarily confined to neurons in both groups which are consistent with previous studies [43,44,48].

U

457 458

E

C

E

T

Fig. 11. H67D HFE increases Nrf2 expression. Brain homogenates from 6- and 12-month-old wild-type (+/+), +/H67D and H67D/H67D were determined for the expression of nuclear factor E2-related factor 2 (Nrf2) that controls the endogenous anti-oxidant genes transcription in response to redox stress. A representative Western blot is shown and quantification of blots is shown as bar graphs. The expression level was normalized to β-actin. (A) The expression of Nrf2 in 6-month-old H67D/H67D and +/H67D mice is not different significantly from wild-type (+/+) mice. (B) Brain Nrf2 expression level is increased in 12-month-old H67D/H67D mice compared to the wild-type mice. Bars represent mean ± standard error. (* = p b 0.05; n = 5 to 6 per genotype in both age group).

D

P

R O

O

F

Transferrin, the major iron mobilization protein, is 39% decreased in H67D mice. Because transferrin is synthesized primarily by the oligodendrocytes [49] reduced transferrin may suggest decreased metabolic activity by oligodendrocytes. However, transferrin is also taken up by the brain [50,51] and iron overload lowers transferrin uptake by the brain [50]. Decreased transferrin levels are also associated with aging and brain disease [52]. Together these data suggest lower transferrin levels in H67D mice would decrease iron mobilization and limit iron delivery particularly to neurons. The other iron delivery protein in the brain, Tim-2 is decreased in 12-month-old H67D mice. Tim-2 is a receptor for H-ferritin on oligodendrocytes and its expression is inversely related to iron status [53]. Therefore, decreased Tim-2 expression in H67D mice is an additional response to decrease iron availability. Despite the decrease in transferrin and Tim-2, myelin proteins expression is normal but total brain cholesterol is decreased [40]. Cholesterol is expressed by neurons as well as found in myelin, thus further analysis of myelin in the presence of the HFE gene variants is warranted particularly in light of the diffusion weighted imaging (DWI) analysis by Jahanshad et al. [19] suggesting that H63D HFE is associated with increased myelin integrity. An additional compensatory response indicating increased iron availability in the brain is the 40% decrease in DMT-1 levels in 6-month-old H67D mice. DMT-1 transports iron out of the endosome to the cytosol of the endothelial cell and is down-regulated with increased iron availability. DMT-1 is found in brain endothelial and ependymal cells, and a mutation in DMT-1 led to less detectable iron in both neurons and glia [54,55]. In H67D mice, DMT-1 staining is lower in the cortex, striatum and cerebellum suggesting that cells are exposed to increased iron. Further evidence for altered brain iron homeostasis in 12-month-old H67D mice is a 2-fold increase in L-ferritin, which involves in long-term iron storage [56]. Increased L-ferritin staining is found in microglia and neurons; the latter being visible but weak. Although L-ferritin is primarily found in glial cells [57], neurons have capacity to express L-ferritin when challenged with iron [58]. Therefore, the presence of L-ferritin positive microglia and neurons in H67D mice suggests the initiation of adaptive responses and that microglia increases iron storage as an attempt to effectively manage the iron that has accumulated in the brain. An additional change in glia in the H67D mice is the increased GFAP expression throughout the brain at 6 months indicating astrogliosis. Reactive gliosis is a rapid response to CNS injury and metabolic stress [59]; thus, increased GFAP expression indicates that cellular metabolic stress occurs in the brains of 6-month-old H67D mice. However, at 12 months, there is no longer increased cellular metabolic stress and indicates that the adaptive mechanisms to protect against iron-induced toxicity were successful. However, the metabolic disruptions as consequences of the altered iron status were not completely restored given the finding of persistent alterations in cholesterol metabolism and behaviors [40] and increased ER stress [24] in the H67D mice. In summary, there are two salient findings in this study. Firstly, we provide the direct in vivo evidence that H63D HFE impacts brain iron homeostasis and creates environment for oxidative stress. Our findings together with recent MRI studies [14–17] shift the existing classical paradigm that brain is protected from iron overload associated with HFE mutations. Secondly, we demonstrated that as they age, H67D mice appear to develop adaptive mechanisms such as elevated Nrf2, decreased iron mobilization via Tf, and increased iron storage within L-ferritin that limits the amount of iron available to induce oxidative stress. Although there are compensatory mechanisms at younger ages, they are not sufficient to protect the brain because 6-month-old H67D mice have increased oxidative stress and astrogliosis. Moreover, our findings suggest that H67D mice may be more susceptible to environmental challenges and/or genetic modifiers at younger ages when there is a stress milieu and gliotic responses trying to adapt to the metabolic stress. The presence of oxidative and cellular stress in brains of

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551

561 562 564 563 565 566 567 568 569 570 571 572 573 574

Abbreviations DMT-1 divalent metal transporter-1 HO-1 hemeoxygenase-1 MBP myelin basic protein Nrf2 nuclear factor E2-related factor 2 PLP proteolipid protein Tf transferrin TfR transferrin receptor Tim-2 T cell immunoglobulin and mucin domain-containing protein-2 xCT cystine/glutamate antiporter

F

559 560

O

558

P

556 557

[16] M.P. Rutgers, A. Pielen, M. Gille, Chronic cerebellar ataxia and hereditary hemochromatosis: causal or coincidental association? J. Neurol. 254 (2007) 1296–1297. [17] G. Bartzokis, P.H. Lu, T.A. Tishler, D.G. Peters, A. Kosenko, K.A. Barrall, J.P. Finn, P. Villablanca, G. Laub, L.L. Altshuler, D.H. Geschwind, J. Mintz, E. Neely, J.R. Connor, Prevalent iron metabolism gene variants associated with increased brain ferritin iron in healthy older men, J. Alzheimers Dis. 20 (2010) 333–341. [18] G. Bartzokis, P.H. Lu, K. Tingus, D.G. Peters, C.P. Amar, T.A. Tishler, J.P. Finn, P. Villablanca, L.L. Altshuler, J. Mintz, E. Neely, J.R. Connor, Gender and iron genes may modify associations between brain iron and memory in healthy aging, Neuropsychopharmacology 36 (2011) 1375–1384. [19] N. Jahanshad, O. Kohannim, D.P. Hibar, J.L. Stein, K.L. McMahon, G.I. de Zubicaray, S.E. Medland, G.W. Montgomery, J.B. Whitfield, N.G. Martin, M.J. Wright, A.W. Toga, P.M. Thompson, Brain structure in healthy adults is related to serum transferrin and the H63D polymorphism in the HFE gene, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) E851–E859. [20] J.R. Connor, S.Y. Lee, HFE mutations and Alzheimer's disease, J. Alzheimers Dis. 10 (2006) 267–276. [21] J. Praline, H. Blasco, P. Vourc'h, V. Rat, C. Gendrot, W. Camu, C.R. Andres, Study of the HFE gene common polymorphisms in French patients with sporadic amyotrophic lateral sclerosis, J. Neurol. Sci. 317 (2012) 58–61. [22] W. van Rheenen, F.P. Diekstra, P.T. van Doormaal, M. Seelen, K. Kenna, R. McLaughlin, A. Shatunov, D. Czell, M.A. van Es, P.W. van Vught, P. van Damme, B.N. Smith, S. Waibel, H.J. Schelhaas, A.J. van der Kooi, M. de Visser, M. Weber, W. Robberecht, O. Hardiman, P.J. Shaw, C.E. Shaw, K.E. Morrison, A. Al-Chalabi, P.M. Andersen, A.C. Ludolph, J.H. Veldink, L.H. van den Berg, H63D polymorphism in HFE is not associated with amyotrophic lateral sclerosis, Neurobiol. Aging (2012). [23] S.Y. Lee, S.M. Patton, R.J. Henderson, J.R. Connor, Consequences of expressing mutants of the hemochromatosis gene (HFE) into a human neuronal cell line lacking endogenous HFE, FASEB J. 21 (2007) 564–576. [24] Y. Liu, S.Y. Lee, E. Neely, W. Nandar, M. Moyo, Z. Simmons, J.R. Connor, Mutant HFE H63D protein is associated with prolonged endoplasmic reticulum stress and increased neuronal vulnerability, J. Biol. Chem. 286 (2011) 13161–13170. [25] R.M. Mitchell, S.Y. Lee, W.T. Randazzo, Z. Simmons, J.R. Connor, Influence of HFE variants and cellular iron on monocyte chemoattractant protein-1, J. Neuroinflammation 6 (2009) 6. [26] R.M. Mitchell, S.Y. Lee, Z. Simmons, J.R. Connor, HFE polymorphisms affect cellular glutamate regulation, Neurobiol. Aging 32 (2011) 1114–1123. [27] E.C. Hall II, S.Y. Lee, N. Mairuae, Z. Simmons, J.R. Connor, Expression of the HFE allelic variant H63D in SH-SY5Y cells affects tau phosphorylation at serine residues, Neurobiol. Aging 32 (2011) 1409–1419. [28] S. Tomatsu, K.O. Orii, R.E. Fleming, C.C. Holden, A. Waheed, R.S. Britton, M.A. Gutierrez, S. Velez-Castrillon, B.R. Bacon, W.S. Sly, Contribution of the H63D mutation in HFE to murine hereditary hemochromatosis, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 15788–15793. [29] K.M. Erikson, D.J. Pinero, J.R. Connor, J.L. Beard, Regional brain iron, ferritin and transferrin concentrations during iron deficiency and iron repletion in developing rats, J. Nutr. 127 (1997) 2030–2038. [30] E.R. Stadtman, R.L. Levine, Protein oxidation, Ann. N. Y. Acad. Sci. 899 (2000) 191–208. [31] M. Conrad, H. Sato, The oxidative stress-inducible cystine/glutamate antiporter, system x (c) (-): cystine supplier and beyond, Amino Acids 42 (2012) 231–246. [32] A. Grochot-Przeczek, J. Dulak, A. Jozkowicz, Haem oxygenase-1: non-canonical roles in physiology and pathology, Clin. Sci. (Lond.) 122 (2012) 93–103. [33] N. Freixenet, A. Remacha, E. Berlanga, A. Caixas, O. Gimenez-Palop, F. Blanco-Vaca, V. Bach, M. Baiget, Y. Sanchez, J. Felez, J.M. Gonzalez-Clemente, Serum soluble transferrin receptor concentrations are increased in central obesity. Results from a screening programme for hereditary hemochromatosis in men with hyperferritinemia, Clin. Chim. Acta 400 (2009) 111–116. [34] M. Jehn, J.M. Clark, E. Guallar, Serum ferritin and risk of the metabolic syndrome in U.S. adults, Diabetes Care 27 (2004) 2422–2428. [35] E. Rossi, M.K. Bulsara, J.K. Olynyk, D.J. Cullen, L. Summerville, L.W. Powell, Effect of hemochromatosis genotype and lifestyle factors on iron and red cell indices in a community population, Clin. Chem. 47 (2001) 202–208. [36] S.H. Lee, J.W. Kim, S.H. Shin, K.P. Kang, H.C. Choi, S.H. Choi, K.U. Park, H.Y. Kim, W. Kang, S.H. Jeong, HFE gene mutations, serum ferritin level, transferrin saturation, and their clinical correlates in a Korean population, Dig. Dis. Sci. 54 (2009) 879–886. [37] X.Y. Zhou, S. Tomatsu, R.E. Fleming, S. Parkkila, A. Waheed, J. Jiang, Y. Fei, E.M. Brunt, D.A. Ruddy, C.E. Prass, R.C. Schatzman, R. O'Neill, R.S. Britton, B.R. Bacon, W.S. Sly, HFE gene knockout produces mouse model of hereditary hemochromatosis, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 2492–2497. [38] M.S. Golub, S.L. Germann, R.S. Araiza, J.R. Reader, S.M. Griffey, K.C. Lloyd, Movement disorders in the Hfe knockout mouse, Nutr. Neurosci. 8 (2005) 239–244. [39] D. Johnstone, R.M. Graham, D. Trinder, R.D. Delima, C. Riveros, J.K. Olynyk, R.J. Scott, P. Moscato, E.A. Milward, Brain transcriptome perturbations in the Hfe(−/−) mouse model of genetic iron loading, Brain Res. 1448 (2012) 144–152. [40] F. Ali-Rahmani, P. Grigson, S. Lee, E. Neely, B. Kinsman, J.R. Connor, C.-L. Schengrund, Effect of H63D-HFE on cholesterol metabolism, brain atrophy, and cognitive impairment: implications for Alzheimer's Disease, (submitted for publication). [41] S. Levi, A. Luzzago, G. Cesareni, A. Cozzi, F. Franceschinelli, A. Albertini, P. Arosio, Mechanism of ferritin iron uptake: activity of the H-chain and deletion mapping of the ferro-oxidase site. A study of iron uptake and ferro-oxidase activity of human liver, recombinant H-chain ferritins, and of two H-chain deletion mutants, J. Biol. Chem. 263 (1988) 18086–18092.

575

Acknowledgements

577 578 579

This work is supported by the Judith and Jean Pape Adams Charitable Foundation and the George M. Leader Laboratory for Alzheimer's disease research.

580

References

581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620

[1] J.N. Feder, D.M. Penny, A. Irrinki, V.K. Lee, J.A. Lebron, N. Watson, Z. Tsuchihashi, E. Sigal, P.J. Bjorkman, R.C. Schatzman, The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 1472–1477. [2] J.A. Lebron, A.P. West Jr., P.J. Bjorkman, The hemochromatosis protein HFE competes with transferrin for binding to the transferrin receptor, J. Mol. Biol. 294 (1999) 239–245. [3] A.T. Merryweather-Clarke, J.J. Pointon, J.D. Shearman, K.J. Robson, Global prevalence of putative haemochromatosis mutations, J. Med. Genet. 34 (1997) 275–278. [4] A.T. Merryweather-Clarke, J.J. Pointon, A.M. Jouanolle, J. Rochette, K.J. Robson, Geography of HFE C282Y and H63D mutations, Genet. Test. 4 (2000) 183–198. [5] P.A. Gochee, L.W. Powell, D.J. Cullen, D.Du. Sart, E. Rossi, J.K. Olynyk, A population-based study of the biochemical and clinical expression of the H63D hemochromatosis mutation, Gastroenterology 122 (2002) 646–651. [6] M.E. Cogswell, M.L. Gallagher, K.K. Steinberg, D.S. Caudill Ph, A.C. Looker, B.A. Bowman, E.W. Gunter, A.L. Franks, G.A. Satten, M.J. Khoury, L.M. GrummerStrawn, HFE genotype and transferrin saturation in the United States, Genet. Med. 5 (2003) 304–310. [7] O.T. Njajou, J.J. Houwing-Duistermaat, R.H. Osborne, N. Vaessen, J. Vergeer, J. Heeringa, H.A. Pols, A. Hofman, C.M. van Duijn, A population-based study of the effect of the HFE C282Y and H63D mutations on iron metabolism, Eur. J. Hum. Genet. 11 (2003) 225–231. [8] W. Nandar, J.R. Connor, HFE gene variants affect iron in the brain, J. Nutr. 141 (2011) 729S–739S. [9] L. Batista-Nascimento, C. Pimentel, R.A. Menezes, C. Rodrigues-Pousada, Iron and neurodegeneration: from cellular homeostasis to disease, Oxid. Med. Cell. Longev. 2012 (2012) 128647. [10] L. Zecca, M.B. Youdim, P. Riederer, J.R. Connor, R.R. Crichton, Iron, brain ageing and neurodegenerative disorders, Nat. Rev. Neurosci. 5 (2004) 863–873. [11] J.R. Connor, E.A. Milward, S. Moalem, M. Sampietro, P. Boyer, M.E. Percy, C. Vergani, R.J. Scott, M. Chorney, Is hemochromatosis a risk factor for Alzheimer's disease? J. Alzheimers Dis. 3 (2001) 471–477. [12] J.H. Sheldon, Hemochromatosis, Oxford University Press, London, 1935, pp. 155–159. [13] J. Cammermyer, Deposition of iron in paraventricular areas of the human brain in hemochromatosis, J. Neuropathol. Exp. Neurol. 6 (1947) 111–127. [14] J.E. Nielsen, L.N. Jensen, K. Krabbe, Hereditary haemochromatosis: a case of iron accumulation in the basal ganglia associated with a Parkinsonian syndrome, J. Neurol. Neurosurg. Psychiatry 59 (1995) 318–321. [15] D. Berg, U. Hoggenmuller, E. Hofmann, R. Fischer, M. Kraus, M. Scheurlen, G. Becker, The basal ganglia in haemochromatosis, Neuroradiology 42 (2000) 9–13.

U

N

C

O

R

R

E

C

T

576

D

554 555

H67D mice support our hypothesis that H63D HFE establishes an environment for pathogenic factors that promote cellular damage and neurodegeneration. For example, a double transgenic mouse line that carries both SOD1(G93A) mutation and the H67D gene variant have accelerated disease progression and shorter survival than SOD1(G93A) ALS mouse model [60]. Thus, these data strongly indicate that the H67D mouse line presented here can be used as a model to evaluate how H63D HFE contributes to disease mechanisms and its impacts on the treatment strategies in neurodegenerative diseases. Supplementary data to this article can be found online at http:// dx.doi.org/10.1016/j.bbadis.2013.02.009.

E

552 553

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

R O

12

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 Q2 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 Q3 702 703 704 705 706

W. Nandar et al. / Biochimica et Biophysica Acta xxx (2013) xxx–xxx

[52] J.R. Connor, B.S. Snyder, J.L. Beard, R.E. Fine, E.J. Mufson, Regional distribution of iron and iron-regulatory proteins in the brain in aging and Alzheimer's disease, J. Neurosci. Res. 31 (1992) 327–335. [53] B. Todorich, X. Zhang, B. Slagle-Webb, W.E. Seaman, J.R. Connor, Tim-2 is the receptor for H-ferritin on oligodendrocytes, J. Neurochem. 107 (2008) 1495–1505. [54] J.R. Burdo, J. Martin, S.L. Menzies, K.G. Dolan, M.A. Romano, R.J. Fletcher, M.D. Garrick, L.M. Garrick, J.R. Connor, Cellular distribution of iron in the brain of the Belgrade rat, Neuroscience 93 (1999) 1189–1196. [55] J.R. Burdo, S.L. Menzies, I.A. Simpson, L.M. Garrick, M.D. Garrick, K.G. Dolan, D.J. Haile, J.L. Beard, J.R. Connor, Distribution of divalent metal transporter 1 and metal transport protein 1 in the normal and Belgrade rat, J. Neurosci. Res. 66 (2001) 1198–1207. [56] S. Levi, P. Santambrogio, A. Cozzi, E. Rovida, B. Corsi, E. Tamborini, S. Spada, A. Albertini, P. Arosio, The role of the L-chain in ferritin iron incorporation. Studies of homo and heteropolymers, J. Mol. Biol. 238 (1994) 649–654. [57] J.R. Connor, K.L. Boeshore, S.A. Benkovic, S.L. Menzies, Isoforms of ferritin have a specific cellular distribution in the brain, J. Neurosci. Res. 37 (1994) 461–465. [58] E.A. Malecki, E.E. Cable, H.C. Isom, J.R. Connor, The lipophilic iron compound TMH-ferrocene [(3,5,5-trimethylhexanoyl)ferrocene] increases iron concentrations, neuronal L-ferritin, and heme oxygenase in brains of BALB/c mice, Biol. Trace Elem. Res. 86 (2002) 73–84. [59] J. Middeldorp, E.M. Hol, GFAP in health and disease, Prog. Neurobiol. 93 (2011) 421–443. [60] W. Nandar, E. Neely, Z. Simmons, J.R. Connor, The 21st International Symposium on ALS/MND, 2010.

O

F

[42] P. Rucker, F.M. Torti, S.V. Torti, Role of H and L subunits in mouse ferritin, J. Biol. Chem. 271 (1996) 33352–33357. [43] T. Moos, Immunohistochemical localization of intraneuronal transferrin receptor immunoreactivity in the adult mouse central nervous system, J. Comp. Neurol. 375 (1996) 675–692. [44] T.K. Dickinson, J.R. Connor, Immunohistochemical analysis of transferrin receptor: regional and cellular distribution in the hypotransferrinemic (hpx) mouse brain, Brain Res. 801 (1998) 171–181. [45] A.S. Dornelles, V.A. Garcia, M.N. de Lima, G. Vedana, L.A. Alcalde, M.R. Bogo, N. Schroder, mRNA expression of proteins involved in iron homeostasis in brain regions is altered by age and by iron overloading in the neonatal period, Neurochem. Res. 35 (2010) 564–571. [46] B. Hallgren, P. Sourander, The effect of age on the non-haemin iron in the human brain, J. Neurochem. 3 (1958) 41–51. [47] J.M. Hill, R.C. Switzer III, The regional distribution and cellular localization of iron in the rat brain, Neuroscience 11 (1984) 595–603. [48] T. Moos, P.S. Oates, E.H. Morgan, Expression of the neuronal transferrin receptor is age dependent and susceptible to iron deficiency, J. Comp. Neurol. 398 (1998) 420–430. [49] D.F. Leitner, J.R. Connor, Functional roles of transferrin in the brain, Biochim. Biophys. Acta 1820 (2012) 393–402. [50] E.M. Taylor, A. Crowe, E.H. Morgan, Transferrin and iron uptake by the brain: effects of altered iron status, J. Neurochem. 57 (1991) 1584–1592. [51] J.R. Burdo, D.A. Antonetti, E.B. Wolpert, J.R. Connor, Mechanisms and regulation of transferrin and iron transport in a model blood–brain barrier system, Neuroscience 121 (2003) 883–890.

R O

707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731

13

U

N C O

R

R

E

C

T

E

D

P

758

Please cite this article as: W. Nandar, et al., A mutation in the HFE gene is associated with altered brain iron profiles and increased oxidative stress in mice, Biochim. Biophys. Acta (2013), http://dx.doi.org/10.1016/j.bbadis.2013.02.009

732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757