- Email: [email protected]
A new amino-acid substitution in acetylcholinesterase 1 confers insecticide resistance to Culex pipiens mosquitoes from Cyprus
ARTICLE IN PRESS Insect Biochemistry and Molecular Biology Insect Biochemistry and Molecular Biology 37 (2007) 41–47 www.elsevier.com/locate/ibmb
A new amino-acid substitution in acetylcholinesterase 1 confers insecticide resistance to Culex pipiens mosquitoes from Cyprus Haoues Alouta, Arnaud Berthomieua, Andreas Hadjivassilisb, Myle`ne Weilla, a
Team Genetics of Adaptation, Laboratoire Ge´ne´tique et Environnement Institut des Sciences de l’Evolution (UMR CNRS 5554), Universite´ de Montpellier II (C.C. 065), F-34095 Montpellier cedex 05, France b ea, Hlois street. 3086 Limassol, Cyprus Received 26 July 2006; received in revised form 29 September 2006; accepted 2 October 2006
Abstract In insects, selection of insecticide-insensitive acetylcholinesterase (AChE) is a very common resistance mechanism. Mosquitoes possess both AChE1 and AChE2 enzymes and insensitivity is conferred by single amino-acid changes located near the active site of the synaptic AChE1. Only two positions have been reported so far to be involved in resistance, suggesting a very high structural constraint of the AChE1 enzyme. In particular, the G119S substitution was selected in several mosquitoes’ species and is now largely spread worldwide. Yet, a different type of AChE1 insensitivity was described 10 years ago in a Culex pipiens population collected in Cyprus in 1987 and fixed thereafter as the ACE-R strain. We report here the complete amino-acid sequence of the ACE-R AChE1 and show that resistance is associated with a single Phe-to-Val substitution of residue 290, which also lines the active site. Comparison of AChE1 activities of the recombinant F290 V protein and ACE-R mosquito extracts confirmed the causal role of the substitution in insensitivity. Biochemical characteristics of the mutated protein indicated that the resistance level varies with the insecticide used. A molecular diagnosis test was designed to detect this mutation and was used to show that it is still present in Cyprus Island. r 2006 Elsevier Ltd. All rights reserved. Keywords: Resistance; Insecticides; Insensitive AchE; Mosquito
1. Introduction Acetylcholinesterase (AChE, EC 3.1.1.7), responsible for neurotransmitter degradation at the cholinergic nerve synapse, is the target of both organophosphate (OP) and carbamate (CX) insecticides. Selection of a modified AChE less sensitive to these insecticides has been shown to be a common resistance mechanism, and was observed in numerous arthropod pest species. In few Diptera such as true flies, only the ace-2 gene is present and encodes the synaptic acetylcholinesterase (Fournier et al., 1989; Weill et al., 2002; Huchard et al., 2006). As we discovered that in mosquitoes a second ace gene, ace-1, encodes the synaptic AChE1 responsible for insensitivity to insecticides (Weill et al., 2002, 2003), it was confirmed that most insects analyzed so far possess both Corresponding author. Fax: 33 4 67 14 36 22.
E-mail address: [email protected] (M. Weill). 0965-1748/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2006.10.001
ace-1 and ace-2 genes. Resistance to OP and CX insecticides results mainly from mutations in the ace-1 gene and, to date, only a few positions have been involved in insensitivity, suggesting a high structural constraint of the enzyme (rewieved in Oakeshott et al., 2005). In flies (with only ace-2), substitutions at several positions led to moderate AChE2 insensitivity when unique and more pronounced insensitivity when in combination (Mute´ro et al., 1994; Menozzi et al., 2004; Kozaki et al., 2001; Walsh et al., 2001; Vontas et al., 2002). Whatever the ace gene involved in resistance, changes that confer insecticide insensitivity affect residues lining the active site. In mosquitoes, despite heavy insecticide control, only the substitutions G119S and F331W (numbering according to the Torpedo californica AChE nomenclature) have been identified so far. F331W was found only in resistant Culex tritaeniorhynchus in East-Asia (Nabeshima et al., 2004). In contrast, the G119S substitution was selected independently in several species including Anopheles gambiae,
ARTICLE IN PRESS 42
H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Anopheles albimanus, Culex vishnui and Culex pipiens in which it is largely spread worldwide (Weill et al., 2003, 2004; Alout et al., in press). G119S frequency in C. pipiens natural populations varies in relation to the nature and intensity of insecticide control as it is associated with a high fitness cost (Raymond et al., 2001; Berticat et al., 2002, 2004). Interestingly, an unusual type of AChE insensitivity was described in C. pipiens mosquitoes collected in Cyprus in 1987 (Wirth and Georghiou, 1996). The corresponding ACE-R strain, fixed by single pair crosses and selection, displayed resistance characteristics distinct from strains known since then to harbour the G119S mutation (Wirth, 1998; Bourguet et al., 1997). Using mosquitoes of the ACER strain stored in liquid nitrogen, we show here that their ace-1 gene contains a F290V substitution responsible for the resistance. This conclusion was brought by comparing AChE1 characteristics from the recombinant F290V mutant protein and resistant ACE-R mosquito head extracts. Biochemical analysis shows that the G119S and F290V mutated proteins display differential sensitivity levels depending on the insecticide used. A molecular diagnostic PASA test was designed to detect the F290V mutation specifically. Analysis of field samples showed that this substitution is still present in Cyprus Island.
Exon4: dir -50 TGGGTCCGCGACAACATCCAC30 / rev50 AAGCGTAGCTTCTTCGCGCGA30 , Exon5: dir -50 GTCTGGCCGAGGCCGTCA30 / rev-50 GCCAGTCTTGGCAAAGTTGGA30 , Exon6: dir -50 AACCCGAGTACGCCGAGCG30 / rev-50 GGTAGCTGCTACTAGTTGCGG30 , Exon7: dir -50 AACCTCCAAGTAACTCCCG30 / rev-50 TTAAATCTTGAACCGCGTTACT 30 . PCR products were purified with the QIAquick gel extraction kit (Qiagen) and sequenced directly on an ABI Prism 310 sequencer, using the Big Dye Terminator kit. 2.3. Site-directed mutagenesis pAc5.1/V5-His vectors (Invitrogen) containing C. pipiens WT and G119S AChE1 complete coding sequences were already described (Weill et al., 2003). The F290 mutation was introduced into the WT vector by means of a PCRbased strategy, using the expand high fidelity PCR system (Roche) with oligomers:
2. Experimental procedures
Cpmut290Vdir (50 GGATCTGCGAGGTTCCGTTCGTTCCGGT30 ) and Cpmut290Vrev (50 AACGAACGGAACCTCGCAGATCCCCAGC30 ) containing the mutation. After reconstruction, the mutated coding sequence was verified by DNA sequencing.
2.1. Mosquito samples
2.4. Extraction of AChE1 from mosquito heads
The ACE-R strain was established from the Mitsero population collected in Cyprus in 1987 (Wirth, 1998). Mosquitoes were stored in liquid nitrogen in the laboratory. Two C. pipiens reference strains were used: the susceptible Slab strain (Georghiou et al., 1966) and the resistant homozygous G119S SR strain (Berticat et al., 2002). Mosquito larvae were collected in 2003 in Cyprus Island and were named Kene. They were raised to the adult stage and then stored in liquid nitrogen for further analyses.
Adult heads were cut from frozen mosquitoes and homogenised in phosphate buffer (0.25 M, pH 7) containing 1% Triton X-100. Homogenates were centrifuged (9000 g for 3 min) and the supernatants were used as AChE1 source for kinetics and inhibition assays.
2.2. Sequencing the ace-1 gene of the ACE-R strain As the extraction of mRNA of ACE-R mosquitoes conserved in liquid nitrogen failed, the coding sequence was acquired from each exon by PCR on genomic DNA. Mosquito DNA was extracted using a CTAB protocol (Rogers and Bendich, 1988). For each exon, PCR was run for 30 cycles (94 1C for 30 s, 52 1C for 30 s and 72 1C for 1 min) using the following primers : Exon1: dir-50 ATGGAGATCCGAGGCCTAATAAC30 / rev-50 TGAATCTTTATTCAGCGTGG30 , Exon2: dir -50 GCATTTTTTACACCATATATAGGT30 / rev-50 ACTCCCTCCGCGTCAGGCC30 , Exon3: dir -50 CGACTCGGACCCACTGGT30 / rev-50 TCTGATCAAACAGCCCCGC30 ,
2.5. Production of wild-type and mutated AChE1 in drosophila S2 cells S2 cells (20 106) were transfected with pAc5.1/V5-His vectors, using Fugene6 (Roche) as transfection reagent, in OptiMEM medium, according to the manufacturer’s protocol. Cells were maintained in serum-free Schneider’s medium to prevent AChE activity from foetal bovine serum. Four days after transfection, cells were collected by centrifugation at 250 g for 3 min and homogenised in 500 ml phosphate buffer (0.25 M, pH 7) containing 1% Triton X-100. The homogenate was centrifuged for 10 min at 9000 g and the supernatant was used as a source of enzyme, after dilution in phosphate buffer. 2.6. AChE1 inhibition characteristics The relative AChE1 activity was determined spectrophotometrically at room temperature, as described by Ellman (1961), using 100 ml of supernatant containing the recombinant AChE1 WT, G119S or F290V. Inhibition
ARTICLE IN PRESS H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
curves were performed by incubating samples (100 ml) for 15 min with 10 ml of inhibitor solutions at various concentrations. We then added 100 ml of 1.6 mM substrate and the residual AChE1 activity was estimated by measuring changes in optical density. Colour development was measured at 412 nm for 15 min. We analysed three to five replicates for each assay. Replicates were performed with distinct batches of production. The irreversible inhibiton reaction is pseudo-first order and the remaining activity follows the equation [E]/ [Eo] ¼ ekit[I]o, when inhibitors are in excess compared to enzyme. ki is the bimolecular rate constant, t is the time of incubation and [I]o is the initial inhibitor concentration. Estimation of ki was performed by linear regression and resistance ratios were calculated by dividing the ki of WT recombinant AChE1 by the ki of mutated recombinant AChE1. 2.7. PASA diagnostic test to detect the F290V mutation in single C. pipiens mosquitoes A PASA test was defined in the coding exon 5 of the ace-1 gene (Weill et al., 2003) to discriminate individuals with a valine at position 290 from and those having the wild-type phenylalanine. DNA was amplified in a 50 ml total volume with 0.6 mM of the primer Valdir (50 acgctggggatctgcgagg30 ) and with 0.25 mM of each of the following three primers: CxEx5dir (50 GTCTGGCCGAGGCCGTCA30 ), CxKrev2 (50 tgcttctgtgcgtgtacagg30 ) and Valrev (50 TCCACAACCGGAACGAACGGAAA30 ). The PCR reaction conditions were 30 s at 94 1C, 30 s at 51 1C and 40 s at 72 1C, for thirty cycles with an initial denaturation step at 94 1C for 5 min and a final extension step at 721 for 5 min. CxEx5dir and CxKrev2 were used to amplify the 543 bp control band. The primer pairs CxEx5dir/Valrev and Valdir/CxKrev2 allowed to amplify a 148 bp fragment specific of phenylalanine and a 435 bp fragment specific of valine. Amplified fragments were analysed by electrophoresis on 1.5% agarose gel. 2.8. Te´moin propoxur propoxur (TPP) test This test was performed to identify ace-1 genotypes. One mosquito head is homogenized in 400 ml of 0.25 M phosphate buffer containing 1% Triton X-100 and centrifuged at 9000g for 3 min. Then, 100 ml of supernatant was distributed in three wells of a 96-well microtitre plate; 10 ml of ethanol (95%), 10 ml of 0.01 M propoxur and 10 ml of 0.0001 M propoxur were added in each well. After a 15min incubation, 100 ml of substrate at a concentration of 1.6 mM was added. Rate of reaction is measured at 412 nm during 15 min with a microtitre plate reader. 2.9. Three-dimensional modelling Three-dimensional structure (3D) of C. pipiens AChE1 were created by automated homology modelling as
43
previously described (Weill et al., 2004). The structural templates used were AChE from Torpedo californica (PDB: 1EA5; Sussman et al., 1991) and Drosophila melanogaster (PDB: 1DX4; Harel et al., 2000). The alpha-carbon skeleton of the modelled 3D structure of AChE1 was superimposed on that of the AChE of T. californica. RMS deviation is 1.1 A˚ on 528 carbon atoms. 3. Results 3.1. Detection of mutations conferring AChE1 insensitivity in culex mosquitoes from Cyprus DNA sequence of each ACE-R ace-1 gene exon was acquired for one resistant mosquito and compared to the susceptible Slab sequence (accession N1 AJ428047). We detected only two non-conservative mutations: A264 T and F416V, corresponding, respectively, to A136 T and F290V using the T. californica nomenclature. We next searched for these two mutations in other individuals from the ACE-R strain. The A136 T mutation was found only twice in 12 individuals analysed, whereas the F290V was always present in resistant mosquitoes. Thus, the A136 T cannot be involved in resistance as most resistant mosquitoes did not display this substitution. Protein modelling based on the structural model of T. californica AChE (PDB: 1EA5) indicated that F290V is located in the acyl pocket, close enough to the catalytic residues to hamper the binding of inhibitors (Fig. 1). The acyl pocket determines the orientation of the ligand in the active site by hydrophobic interaction implicating residues F288 and F290 (Ordentlich et al., 1993; Vellom et al., 1993). It plays an important role in substrate specificity by interacting with the acyl moiety. Substitution to valine, a less hydrophobic residue, and loss of the aryl function might impede ligand stabilization or induce steric hindrance because one of the valine methyl groups is closer to the catalytic serine (Ser200) than is the wild-type phenylalanine side chain (Fig. 1). Furthermore, the fact that a mutation providing resistance has already been described at this position in flies (Fournier et al., 1992) and the recent description of the same F290V substitution in resistant Cydia pomonella (Cassanelli et al., 2006) are good arguments to suspect that the presence of a valine at position 290 might perturb the binding of the enzyme substrate and inhibitors. 3.2. Inhibition of recombinant F290V AChE1 activity by various insecticides To address this issue, we introduced the F290V mutation by site-directed mutagenesis into the ace-1 cDNA of the susceptible Slab strain, produced the recombinant mutated protein in Drosophila S2 cells and compared its characteristics with that of the resistant ACE-R mosquito head extracts. Recombinant F290V and ACE-R extracted enzymes were similar for their sensitivity to propoxur, eserine, chlorpyriphos-oxon, malaoxon, fenitroxon, dichlorvos, paraoxon-ethyl
ARTICLE IN PRESS 44
H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Fig. 1. Position of the F290V mutation with respect to the active site. The C. pipiens AChE1 sequence was fit to the X-ray structure of the T. californica AChE (pdb 1EA5). The catalytic triad (S200, E327 and H440) appears as Van der Waals spheres. The 3D view points to the entrance of the catalytic gorge. (A) WT AChE1 structure, and (B) F290V mutated AChE1 structure.
and aldicarb (Fig. 2). This indicates that the presence of the F290V substitution in a wild-type context is sufficient to recover the pattern of ACE-R AChE1 insensitivity. Furthermore, it appears clearly that F290V mutated AChE1 and AChE2 behave differently in terms of insensitivity to insecticides. Comparisons of resistance ratio with data obtained by Villatte et al. (2000) on the mutated AChE2 show that F290V mutated AChE1 is less susceptible to propoxur, malaoxon and dichlorvos insecticides than F290V mutated AChE2. We next compared the two recombinant G119S and F290V mutated proteins for their sensitivity to various OP and CX insecticides. In the presence of propoxur, eserine, chlorpyriphos-oxon, paraoxon-ethyl and malaoxon, the G119S protein was much less inhibited than the F290V protein (Table 1). In contrast, the F290V protein was less susceptible to dichlorvos, aldicarb and fenitroxon. These results show that both mutated proteins display differential sensitivity to insecticides, in agreement with previous data acquired with enzyme extracted from the resistant mosquito heads of G119S and ACE-R strains (Bourguet et al., 1997). Interestingly, the global AChE1 activity measured in S2 cells supernatant differed considerably between the recombinant enzymes. Activity of the F290V mutated AChE1 was slightly weaker or similar to that of the susceptible enzyme, whereas the activity of the G119S mutated AChE1 was highly reduced (Fig. 3). 3.3. Is F290V mutation still present in Cyprus C. pipiens populations? We analysed 32 C. pipiens individuals from the Kene sample collected in Cyprus in 2003 and compared their susceptibility to propoxur with that of ACE-R mosquitoes using the TPP diagnostic test (Bourguet et al., 1996) (Fig. 4A). For six mosquitoes, TPP profiles were very similar to that of ACE-R, which suggested that they harbour the F290V mutation. Other individuals were either
susceptible (16) or displayed a G119S heterozygous RS profile (10). As the TPP test previously failed to characterize the different genotypes of the ACE-R strain (Bourguet et al., 1996), we developed a PASA molecular test to unambiguously detect the presence of valine substitution (Figs. 4B and 5). The PASA assay was next used to genotype the DNA extracted from the abdomen of the individuals previously analysed with the TPP assay (Fig. 4A). The six individuals that exhibited the ACE-R TPP profile carried the 435 bp valine-specific fragment, thus confirming that the F290V substitution is still present in Cyprus mosquitoes collected in 2003. ACE-R individuals appear homozygous for the F290V mutation but do not present a great decrease in AChE1 activity counter to homozygous individuals for the G119S mutation (Fig. 4). 4. Discussion We show here that the peculiar AChE1 insensitivity, described in a C. pipiens mosquito population collected in Cyprus in 1987 (Wirth and Georghiou, 1996), results from a new substitution, F290V, and is still present in Cyprus. F290 is a conserved amino acid in most vertebrate and invertebrate AChE. This aromatic residue is part of the acyl pocket, which determines substrate specificity through interaction with the alkyl portion of the acyl moiety (Ordentlich et al., 1993). AChE2 insecticide-insensitivity affecting the same relative position was reported previously in Drosophila melanogaster and Musca domestica. In these species, the F290Y substitution alone provides a low level of resistance to a range of insecticides (Villatte et al., 2000) and combination with amino-acid replacement at other positions is frequent in natural populations (Menozzi et al., 2004; Walsh et al., 2001). Substituting phenylalanine to a bulkier residue like tyrosine may block the access to the active site. Although the F290V resistance described here is associated with a substitution to a smaller residue, the most probable orientation of the valine side chain, shown in Fig. 1, may prevent large substrate or inhibitor molecules
ARTICLE IN PRESS H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Residual AChE activity (%)
Residual AChE activity (%)
Dichlorvous 100 80 60 40 20 0 10-10
10-8 10-6 Concentration (M)
Paraoxon-ethyl
100 80 60 40 20 0
10-4
10-8
Residual AChE activity (%)
Residual AChE activity (%)
Propoxur 100 80 60 40 20 0 10-10
10-8 10-6 10-4 Concentration (M)
10-2
100 80 60 40 20 0 10-10
10-8 10-6 10-4 Concentration (M)
10-6
Residual AChE activity (%)
100 80 60 40 20 0 10-11
10-7
10-9
10-7 10-5 Concentration (M)
10-3
Eserine Residual AChE activity (%)
Residual AChE activity (%)
Aldicarb 100 80 60 40 20 0 10-8
10-2
Fenitroxon Residual AChE activity (%)
10-10 10-8 Concentration (M)
10-7 10-6 10-5 Concentration (M) Malaoxon
Chlorpyrifos-oxon 100 80 60 40 20 0 10-12
45
10-6 10-5 10-4 Concentration (M)
10-3
100 80 60 40 20 0 10-12
10-10 10-8 10-6 Concentration (M)
10-4
Fig. 2. Comparison of residual AChE1 activities of recombinant F290V protein (black crosses) and ACE-R mosquito head extracts (grey crosses) incubated in the presence of increasing doses of various insecticides. Residual activities of recombinant susceptible (black squares) and G119S mutated (black diamonds) AChE1 are included as controls. Error bars (o5%) were omitted for clarity. Table 1 Resistance ratio of WT and mutated (G119S and F290V) recombinant AchEl to various organophosphate (OP) and carbamate (CX) insecticides Insecticides
Aldicarb Propoxur Eserine Dichlorvos Malaoxon Paraoxon-ethyl Fenitroxon Chlorpyrifos-oxon
ki (l/mol/s)
Resistance ration (WT/mutant)
WT
G119S
F290V
G119S
F290V
167 2895 48135 1711 3209 4557 17115 54237
50 0 948 374 43 38 253 90
7 58 8852 25 372 917 181 14531
3 99624 51 5 75 120 68 604
25 50 5 68 9 5 95 4
to interact efficiently with the catalytic serine (Ser200). This is supported by data on propionylthiocholine, whose hydrolysis was much less efficient by ACE-R extracts than by Slab extracts (Bourguet et al., 1997). Thus, insensitivity
more likely results from a reduced stability of the noncovalent complex due to the loss of the aromatic cycle. Interestingly, the F290V site-directed mutagenesis of Drosophila AChE2 also led to a decreased susceptibility to
ARTICLE IN PRESS 46
H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Fig. 5. Schematic representation of the PASA molecular test designed in the coding exon 5 of ace-1 gene, to detect the valine substitution. The specific locations of the primers and the expected sizes of the amplified fragments are indicated.
Fig. 3. WT, F290V and G119S recombinant AChE1 activity produced in S2 cells. Several dilutions of each supernatant were used. Experiments were repeated five times with the same amount of S2 cells and vector, and were reproducible.
Fig. 4. Detection of F290V in single individuals. (A) Relative residual AChE1 activities in the head extracts of individual mosquitoes from ACER and Cyprus were determined in the absence of insecticide (black), or in the presence of 104 M (white) or 102 M of propoxur (grey). Susceptible (SS), as well as homozygous (RR) and heterozygous (RS) resistant G119S profiles, were obtained with Slab and SR laboratory strains. (B) Diagnostic PASA tests were performed on the same individuals as in (A) to detect the F290V mutation. The 148 and 435 bp fragments are specific of the presence of a phenylalanine and a valine, respectively.
many distinct insecticides (Villatte et al., 2000). However, this mutation was also associated with a drastic decrease in substrate hydrolysis, predicted to considerably affect the viability of the mutant flies. Similar results were obtained with the F290V mutated human AChE (Ordentlich et al., 1993). In contrast, in C. pipiens and even when homozygous, this mutation does not seem to affect strongly the
AChE1 activity (Fig. 4A). A modifier that restores activity might have been selected in ACE-R mosquitoes. However, comparison of the global activities of the recombinant mutated enzymes suggests that it is not the case. Furthermore, it appears clearly that AChE1 and AChE2 behave differently in term of insensitivity to insecticides. These data suggest important differences in the tridimensional structures of the paralogous AChEs. A key difference was already shown in the width of the catalytic gorge, which is narrower in D. melanogaster AChE2 than in T. californica AChE (Harel et al., 2000). Structural differences of the active site could thus explain, at least partially, why different types of mutations (positions and substituted amino acids) have been selected in AChE1 or AChE2. The same F290V substitution was described recently in the AChE1 of a C. pomonella (L.) moth resistant to carbaryl and suggested to be responsible for the resistance observed (Cassanelli et al., 2006). Our results on recombinant mutated AChE1 confirm that the F290V substitution is probably responsible for the resistance observed in this Lepidopteran. Moreover, the observation that F290V homozygous resistant moths are viable suggests that the mutation does not dramatically decrease AChE1 activity. The reason why the F290V substitution is presently known only in Cyprus Island remains to be addressed. First, this mutation might be actually more largely spread but was not identified so far in other natural populations because of inadequate biochemical tests or excessive insecticide doses used in bioassays. Indeed, the F290V mutants do not survive at the propoxur concentration (10 ppm final) used to detect the G119S mutation. Bioassays at lower insecticide concentrations combined with a PASA molecular detection test will be needed to evaluate the geographic distribution of this mutation in natural populations worldwide. Second, the selection of F290V may depend on the nature of the insecticides used locally, regardless of its class. Indeed, the mosquito control program in Cyprus Island relied on OP treatment, in particular with dichlorvos, temephos and pirmimiphos methyl (Wirth and Georghiou, 1996). In agreement, our data established that although conferring a resistance to
ARTICLE IN PRESS H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
several insecticides weaker than the G119S mutation, the F290V mutation confers a 10-fold higher resistance to dichlorvos. As the F290V mutation appears less costly than the G119S, it is expected to prevail in areas treated with this specific insecticide. Acknowledgements We would like to thank P. Fort, J.P. Leonetti, M. Raymond and N. Pasteur for helpful comments on the manuscript, and V. Durand for assistance with the references. This work was financed in part by the ANR Morevol Sante-Environnement (Ministe`re de´le´gue´ a` la Recherche). Contribution 2006-082 of the Institut des Sciences de l’Evolution de Montpellier (UMR CNRS 5554). References Alout, H., Berthomieu, A., Cui, F., Tan, Y., Berticat, C., Qiao, C., Weill, M. Different amino-acid substitutions confer insecticide resistance through acetylcholinesterase 1 insensitivity in Culex vishnui and Culex tritaeniorhynchus (Diptera: Culicidae) mosquitoes from China. J. Med. Entomol. in press. Berticat, C., Boquien, G., Raymond, M., Chevillon, C., 2002. Insecticide resistance genes induce a mating competition cost in Culex pipiens mosquitoes. Genet. Res. 79, 41–47. Berticat, C., Duron, O., Heyse, D., Raymond, M., 2004. Insecticide resistance genes confer a predation cost on mosquitoes, Culex pipiens. Genet. Res. 83, 189–196. Bourguet, D., Lenormand, T., Guillemaud, T., Marcel, V., Fournier, D., Raymond, M., 1997. Variation of dominance of newly arisen adaptive genes. Genetics 147, 1225–1234. Bourguet, D., Pasteur, N., Bisset, J., Raymond, M., 1996. Determination of Ace.1 genotypes in single mosquitoes: toward an ecumenical biochemical test. Pest. Biochem. Physiol. 55, 122–128. Cassanelli, S., Reyes, M., Rault, M., Manicardi, G.C., Sauphanor, B., 2006. Acetylcholinesterase mutation in an insecticide-resistant population of the codling moth Cydia pomonella (L.). Insect Biochem. Mol. Biol. 36, 642–653. Fournier, D., Karch, F., Bride, J.M., Hall, L.M.C., Berge´, J.B., Spierer, P., 1989. Drosophila melanogaster acetylcholinesterase gene, structure, evolution and mutations. J. Mol. Evol. 210, 15–22. Fournier, D., Bride, J.M., Hoffmann, F., Karch, F., 1992. Acetylcholinesterase. Two types of modifications confer resistance to insecticide. J. Biol. Chem. 267, 14270–14274. Georghiou, G.P., Metcalf, R.L., Gidden, F.E., 1966. Carbamatesresistance in mosquitoes; selection of Culex pipiens fatiguans Wied ( ¼ Culex quinquefasciatus) for resistance to baygon. WHO 35, 691–708. Harel, M., Kryger, G., Rosenberry, T.L., Mallender, W.D., Lewis, T., Fletcher, R.J., Guss, J.M., Silman, I., Sussman, J.L., 2000. Threedimensional structures of Drosophila melanogaster acetylcholinesterase and of its complexes with two potent inhibitors. Protein Sci. 9, 1063–1072. Huchard, E., Martinez, M., Alout, H., Douzery, E.J.P., Lutfalla, G., Berthomieu, A., Berticat, C., Raymond, M., Weill, M., 2006. Acetylcholinesterase genes within the Diptera: takeover and loss in true flies. Proc. R. Soc. Lond. B. Biol. Sci. 273, 2595–2604.
47
Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive acetylcholinesterases of the housefly, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31, 991–997. Menozzi, P., Shi, M.A., Lougarre, A., Tang, Z.H., Fournier, D., 2004. Mutations of acetylcholinesterase which confer insecticide resistance in Drosophila melanogaster populations. BMC. Evol. Biol. 4, 4. Mute´ro, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistanceassociated point mutations in insecticide-insensitive acetylcholinesterase. Proc. Natl. Acad. Sci. USA 91, 5922–5926. Nabeshima, T., Mori, A., Kozaki, T., Iwata, Y., Hidoh, O., Harada, S., Kasai, S., Severson, D.W., Kono, Y., Tomita, T., 2004. An amino acid substitution attribuable to insecticide-resistance in a Japanese encephalitis vector mosquito, Culex tritaeniorhynchus. Biochem. Biophy. Res. Commun. 313, 794–801. Oakeshott, J.G., Devonshire, A.L., Claudianos, C., Sutherland, T.D., Horne, I., Campbell, P.M., Ollis, D.L., Russell, R.J., 2005. Comparing the organophosphorus and carbamate insecticide resistance mutations in cholin- and carboxyl-esterases. Chem. Biol. Interact. 157, 269–275. Ordentlich, A., Barak, D., Kronman, C., Flashner, Y., Leitner, M., Segall, Y., Ariel, N., Cohen, S., Velan, B., Shafferman, A., 1993. Dissection of the human acetylcholinesterase active center determinants of substrate specificity. Identification of residues constituting the anionic site, the hydrophobic site, and the acyl pocket. J. Biol. Chem. 268, 17083–17095. Raymond, M., Berticat, C., Weill, M., Pasteur, N., Chevillon, C., 2001. Insecticide resistance in the mosquito Culex pipiens: what have we learned about adaptation? Genetica 112/113, 287–296. Rogers, S.O., Bendich, A.J., 1988. Extraction of DNA from plant tissues. In: Gelvin, S.B., Schilperoort, R.A. (Eds.), Plant Molecular Biology Manuel, vol. A6. Kluwer Academic Publishers, Boston, pp. 1–10. Sussman, J.L., Harel, M., Frolow, F., Oefner, C., Goldman, A., Toker, L., Silman, I., 1991. Atomic structure of acetylcholinesterase from Torpedo californica: a prototypic acetylcholine-binding protein. Science 253, 872–879. Vellom, D.C., Radic, Z., Li, Y., Pickering, N.A., Camp, S., Taylor, P., 1993. Amino-acid residues controlling acetylcholinesterase and butylcholinesterase specificity. Biochemistry 32, 12–17. Villatte, F., Ziliani, P., Marcel, V., Menozzi, P., Fournier, D., 2000. A high number of mutations in insect acetylcholinesterase may provide insecticide resistance. Pest. Bioch. Physiol. 67, 95–102. Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M., Hemingway, J., 2002. Resistance-associated point mutations of organophosphate acetylcholinesterase, in the olive fruit fly Bactrocera oleae. Insect Mol. Biol. 11, 329–336. Walsh, S.B., Dolden, T.A., Moores, G.D., Kristensen, M., Lewis, T., Devonshire, A.L., Williamson, M.S., 2001. Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance. Biochem. J. 359, 175–181. Weill, M., Fort, P., Berthomieu, A., Dubois, M.P., Pasteur, N., Raymond, M., 2002. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is non-homologous to the ace gene in Drosophila. Proc. R. Soc. Lond. B Biol. Sci. 269, 2007–2016. Weill, M., Lutfalla, G., Mogensen, K., Chandre, F., Berthomieu, A., Berticat, C., Pasteur, N., Phillips, A., Fort, P., Raymond, M., 2003. Insecticide resistance in mosquito vector. Nature 423, 136–137. Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marquine, M., Raymond, M., 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Mol. Biol. 13, 1–7. Wirth, M.C., 1998. Isolation and characterization of two novel organophosphate resistance mechanisms in Culex pipiens from Cyprus. J. Am. Mosq. Control Assoc. 14, 397–405. Wirth, M.C., Georghiou, G.P., 1996. Organophosphate resistance in Culex pipiens from Cyprus. J. Am. Mosq. Control Assoc. 12, 112–118.
A new amino-acid substitution in acetylcholinesterase 1 confers insecticide resistance to Culex pipiens mosquitoes from Cyprus Haoues Alouta, Arnaud Berthomieua, Andreas Hadjivassilisb, Myle`ne Weilla, a
Team Genetics of Adaptation, Laboratoire Ge´ne´tique et Environnement Institut des Sciences de l’Evolution (UMR CNRS 5554), Universite´ de Montpellier II (C.C. 065), F-34095 Montpellier cedex 05, France b ea, Hlois street. 3086 Limassol, Cyprus Received 26 July 2006; received in revised form 29 September 2006; accepted 2 October 2006
Abstract In insects, selection of insecticide-insensitive acetylcholinesterase (AChE) is a very common resistance mechanism. Mosquitoes possess both AChE1 and AChE2 enzymes and insensitivity is conferred by single amino-acid changes located near the active site of the synaptic AChE1. Only two positions have been reported so far to be involved in resistance, suggesting a very high structural constraint of the AChE1 enzyme. In particular, the G119S substitution was selected in several mosquitoes’ species and is now largely spread worldwide. Yet, a different type of AChE1 insensitivity was described 10 years ago in a Culex pipiens population collected in Cyprus in 1987 and fixed thereafter as the ACE-R strain. We report here the complete amino-acid sequence of the ACE-R AChE1 and show that resistance is associated with a single Phe-to-Val substitution of residue 290, which also lines the active site. Comparison of AChE1 activities of the recombinant F290 V protein and ACE-R mosquito extracts confirmed the causal role of the substitution in insensitivity. Biochemical characteristics of the mutated protein indicated that the resistance level varies with the insecticide used. A molecular diagnosis test was designed to detect this mutation and was used to show that it is still present in Cyprus Island. r 2006 Elsevier Ltd. All rights reserved. Keywords: Resistance; Insecticides; Insensitive AchE; Mosquito
1. Introduction Acetylcholinesterase (AChE, EC 3.1.1.7), responsible for neurotransmitter degradation at the cholinergic nerve synapse, is the target of both organophosphate (OP) and carbamate (CX) insecticides. Selection of a modified AChE less sensitive to these insecticides has been shown to be a common resistance mechanism, and was observed in numerous arthropod pest species. In few Diptera such as true flies, only the ace-2 gene is present and encodes the synaptic acetylcholinesterase (Fournier et al., 1989; Weill et al., 2002; Huchard et al., 2006). As we discovered that in mosquitoes a second ace gene, ace-1, encodes the synaptic AChE1 responsible for insensitivity to insecticides (Weill et al., 2002, 2003), it was confirmed that most insects analyzed so far possess both Corresponding author. Fax: 33 4 67 14 36 22.
E-mail address: [email protected] (M. Weill). 0965-1748/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2006.10.001
ace-1 and ace-2 genes. Resistance to OP and CX insecticides results mainly from mutations in the ace-1 gene and, to date, only a few positions have been involved in insensitivity, suggesting a high structural constraint of the enzyme (rewieved in Oakeshott et al., 2005). In flies (with only ace-2), substitutions at several positions led to moderate AChE2 insensitivity when unique and more pronounced insensitivity when in combination (Mute´ro et al., 1994; Menozzi et al., 2004; Kozaki et al., 2001; Walsh et al., 2001; Vontas et al., 2002). Whatever the ace gene involved in resistance, changes that confer insecticide insensitivity affect residues lining the active site. In mosquitoes, despite heavy insecticide control, only the substitutions G119S and F331W (numbering according to the Torpedo californica AChE nomenclature) have been identified so far. F331W was found only in resistant Culex tritaeniorhynchus in East-Asia (Nabeshima et al., 2004). In contrast, the G119S substitution was selected independently in several species including Anopheles gambiae,
ARTICLE IN PRESS 42
H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Anopheles albimanus, Culex vishnui and Culex pipiens in which it is largely spread worldwide (Weill et al., 2003, 2004; Alout et al., in press). G119S frequency in C. pipiens natural populations varies in relation to the nature and intensity of insecticide control as it is associated with a high fitness cost (Raymond et al., 2001; Berticat et al., 2002, 2004). Interestingly, an unusual type of AChE insensitivity was described in C. pipiens mosquitoes collected in Cyprus in 1987 (Wirth and Georghiou, 1996). The corresponding ACE-R strain, fixed by single pair crosses and selection, displayed resistance characteristics distinct from strains known since then to harbour the G119S mutation (Wirth, 1998; Bourguet et al., 1997). Using mosquitoes of the ACER strain stored in liquid nitrogen, we show here that their ace-1 gene contains a F290V substitution responsible for the resistance. This conclusion was brought by comparing AChE1 characteristics from the recombinant F290V mutant protein and resistant ACE-R mosquito head extracts. Biochemical analysis shows that the G119S and F290V mutated proteins display differential sensitivity levels depending on the insecticide used. A molecular diagnostic PASA test was designed to detect the F290V mutation specifically. Analysis of field samples showed that this substitution is still present in Cyprus Island.
Exon4: dir -50 TGGGTCCGCGACAACATCCAC30 / rev50 AAGCGTAGCTTCTTCGCGCGA30 , Exon5: dir -50 GTCTGGCCGAGGCCGTCA30 / rev-50 GCCAGTCTTGGCAAAGTTGGA30 , Exon6: dir -50 AACCCGAGTACGCCGAGCG30 / rev-50 GGTAGCTGCTACTAGTTGCGG30 , Exon7: dir -50 AACCTCCAAGTAACTCCCG30 / rev-50 TTAAATCTTGAACCGCGTTACT 30 . PCR products were purified with the QIAquick gel extraction kit (Qiagen) and sequenced directly on an ABI Prism 310 sequencer, using the Big Dye Terminator kit. 2.3. Site-directed mutagenesis pAc5.1/V5-His vectors (Invitrogen) containing C. pipiens WT and G119S AChE1 complete coding sequences were already described (Weill et al., 2003). The F290 mutation was introduced into the WT vector by means of a PCRbased strategy, using the expand high fidelity PCR system (Roche) with oligomers:
2. Experimental procedures
Cpmut290Vdir (50 GGATCTGCGAGGTTCCGTTCGTTCCGGT30 ) and Cpmut290Vrev (50 AACGAACGGAACCTCGCAGATCCCCAGC30 ) containing the mutation. After reconstruction, the mutated coding sequence was verified by DNA sequencing.
2.1. Mosquito samples
2.4. Extraction of AChE1 from mosquito heads
The ACE-R strain was established from the Mitsero population collected in Cyprus in 1987 (Wirth, 1998). Mosquitoes were stored in liquid nitrogen in the laboratory. Two C. pipiens reference strains were used: the susceptible Slab strain (Georghiou et al., 1966) and the resistant homozygous G119S SR strain (Berticat et al., 2002). Mosquito larvae were collected in 2003 in Cyprus Island and were named Kene. They were raised to the adult stage and then stored in liquid nitrogen for further analyses.
Adult heads were cut from frozen mosquitoes and homogenised in phosphate buffer (0.25 M, pH 7) containing 1% Triton X-100. Homogenates were centrifuged (9000 g for 3 min) and the supernatants were used as AChE1 source for kinetics and inhibition assays.
2.2. Sequencing the ace-1 gene of the ACE-R strain As the extraction of mRNA of ACE-R mosquitoes conserved in liquid nitrogen failed, the coding sequence was acquired from each exon by PCR on genomic DNA. Mosquito DNA was extracted using a CTAB protocol (Rogers and Bendich, 1988). For each exon, PCR was run for 30 cycles (94 1C for 30 s, 52 1C for 30 s and 72 1C for 1 min) using the following primers : Exon1: dir-50 ATGGAGATCCGAGGCCTAATAAC30 / rev-50 TGAATCTTTATTCAGCGTGG30 , Exon2: dir -50 GCATTTTTTACACCATATATAGGT30 / rev-50 ACTCCCTCCGCGTCAGGCC30 , Exon3: dir -50 CGACTCGGACCCACTGGT30 / rev-50 TCTGATCAAACAGCCCCGC30 ,
2.5. Production of wild-type and mutated AChE1 in drosophila S2 cells S2 cells (20 106) were transfected with pAc5.1/V5-His vectors, using Fugene6 (Roche) as transfection reagent, in OptiMEM medium, according to the manufacturer’s protocol. Cells were maintained in serum-free Schneider’s medium to prevent AChE activity from foetal bovine serum. Four days after transfection, cells were collected by centrifugation at 250 g for 3 min and homogenised in 500 ml phosphate buffer (0.25 M, pH 7) containing 1% Triton X-100. The homogenate was centrifuged for 10 min at 9000 g and the supernatant was used as a source of enzyme, after dilution in phosphate buffer. 2.6. AChE1 inhibition characteristics The relative AChE1 activity was determined spectrophotometrically at room temperature, as described by Ellman (1961), using 100 ml of supernatant containing the recombinant AChE1 WT, G119S or F290V. Inhibition
ARTICLE IN PRESS H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
curves were performed by incubating samples (100 ml) for 15 min with 10 ml of inhibitor solutions at various concentrations. We then added 100 ml of 1.6 mM substrate and the residual AChE1 activity was estimated by measuring changes in optical density. Colour development was measured at 412 nm for 15 min. We analysed three to five replicates for each assay. Replicates were performed with distinct batches of production. The irreversible inhibiton reaction is pseudo-first order and the remaining activity follows the equation [E]/ [Eo] ¼ ekit[I]o, when inhibitors are in excess compared to enzyme. ki is the bimolecular rate constant, t is the time of incubation and [I]o is the initial inhibitor concentration. Estimation of ki was performed by linear regression and resistance ratios were calculated by dividing the ki of WT recombinant AChE1 by the ki of mutated recombinant AChE1. 2.7. PASA diagnostic test to detect the F290V mutation in single C. pipiens mosquitoes A PASA test was defined in the coding exon 5 of the ace-1 gene (Weill et al., 2003) to discriminate individuals with a valine at position 290 from and those having the wild-type phenylalanine. DNA was amplified in a 50 ml total volume with 0.6 mM of the primer Valdir (50 acgctggggatctgcgagg30 ) and with 0.25 mM of each of the following three primers: CxEx5dir (50 GTCTGGCCGAGGCCGTCA30 ), CxKrev2 (50 tgcttctgtgcgtgtacagg30 ) and Valrev (50 TCCACAACCGGAACGAACGGAAA30 ). The PCR reaction conditions were 30 s at 94 1C, 30 s at 51 1C and 40 s at 72 1C, for thirty cycles with an initial denaturation step at 94 1C for 5 min and a final extension step at 721 for 5 min. CxEx5dir and CxKrev2 were used to amplify the 543 bp control band. The primer pairs CxEx5dir/Valrev and Valdir/CxKrev2 allowed to amplify a 148 bp fragment specific of phenylalanine and a 435 bp fragment specific of valine. Amplified fragments were analysed by electrophoresis on 1.5% agarose gel. 2.8. Te´moin propoxur propoxur (TPP) test This test was performed to identify ace-1 genotypes. One mosquito head is homogenized in 400 ml of 0.25 M phosphate buffer containing 1% Triton X-100 and centrifuged at 9000g for 3 min. Then, 100 ml of supernatant was distributed in three wells of a 96-well microtitre plate; 10 ml of ethanol (95%), 10 ml of 0.01 M propoxur and 10 ml of 0.0001 M propoxur were added in each well. After a 15min incubation, 100 ml of substrate at a concentration of 1.6 mM was added. Rate of reaction is measured at 412 nm during 15 min with a microtitre plate reader. 2.9. Three-dimensional modelling Three-dimensional structure (3D) of C. pipiens AChE1 were created by automated homology modelling as
43
previously described (Weill et al., 2004). The structural templates used were AChE from Torpedo californica (PDB: 1EA5; Sussman et al., 1991) and Drosophila melanogaster (PDB: 1DX4; Harel et al., 2000). The alpha-carbon skeleton of the modelled 3D structure of AChE1 was superimposed on that of the AChE of T. californica. RMS deviation is 1.1 A˚ on 528 carbon atoms. 3. Results 3.1. Detection of mutations conferring AChE1 insensitivity in culex mosquitoes from Cyprus DNA sequence of each ACE-R ace-1 gene exon was acquired for one resistant mosquito and compared to the susceptible Slab sequence (accession N1 AJ428047). We detected only two non-conservative mutations: A264 T and F416V, corresponding, respectively, to A136 T and F290V using the T. californica nomenclature. We next searched for these two mutations in other individuals from the ACE-R strain. The A136 T mutation was found only twice in 12 individuals analysed, whereas the F290V was always present in resistant mosquitoes. Thus, the A136 T cannot be involved in resistance as most resistant mosquitoes did not display this substitution. Protein modelling based on the structural model of T. californica AChE (PDB: 1EA5) indicated that F290V is located in the acyl pocket, close enough to the catalytic residues to hamper the binding of inhibitors (Fig. 1). The acyl pocket determines the orientation of the ligand in the active site by hydrophobic interaction implicating residues F288 and F290 (Ordentlich et al., 1993; Vellom et al., 1993). It plays an important role in substrate specificity by interacting with the acyl moiety. Substitution to valine, a less hydrophobic residue, and loss of the aryl function might impede ligand stabilization or induce steric hindrance because one of the valine methyl groups is closer to the catalytic serine (Ser200) than is the wild-type phenylalanine side chain (Fig. 1). Furthermore, the fact that a mutation providing resistance has already been described at this position in flies (Fournier et al., 1992) and the recent description of the same F290V substitution in resistant Cydia pomonella (Cassanelli et al., 2006) are good arguments to suspect that the presence of a valine at position 290 might perturb the binding of the enzyme substrate and inhibitors. 3.2. Inhibition of recombinant F290V AChE1 activity by various insecticides To address this issue, we introduced the F290V mutation by site-directed mutagenesis into the ace-1 cDNA of the susceptible Slab strain, produced the recombinant mutated protein in Drosophila S2 cells and compared its characteristics with that of the resistant ACE-R mosquito head extracts. Recombinant F290V and ACE-R extracted enzymes were similar for their sensitivity to propoxur, eserine, chlorpyriphos-oxon, malaoxon, fenitroxon, dichlorvos, paraoxon-ethyl
ARTICLE IN PRESS 44
H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Fig. 1. Position of the F290V mutation with respect to the active site. The C. pipiens AChE1 sequence was fit to the X-ray structure of the T. californica AChE (pdb 1EA5). The catalytic triad (S200, E327 and H440) appears as Van der Waals spheres. The 3D view points to the entrance of the catalytic gorge. (A) WT AChE1 structure, and (B) F290V mutated AChE1 structure.
and aldicarb (Fig. 2). This indicates that the presence of the F290V substitution in a wild-type context is sufficient to recover the pattern of ACE-R AChE1 insensitivity. Furthermore, it appears clearly that F290V mutated AChE1 and AChE2 behave differently in terms of insensitivity to insecticides. Comparisons of resistance ratio with data obtained by Villatte et al. (2000) on the mutated AChE2 show that F290V mutated AChE1 is less susceptible to propoxur, malaoxon and dichlorvos insecticides than F290V mutated AChE2. We next compared the two recombinant G119S and F290V mutated proteins for their sensitivity to various OP and CX insecticides. In the presence of propoxur, eserine, chlorpyriphos-oxon, paraoxon-ethyl and malaoxon, the G119S protein was much less inhibited than the F290V protein (Table 1). In contrast, the F290V protein was less susceptible to dichlorvos, aldicarb and fenitroxon. These results show that both mutated proteins display differential sensitivity to insecticides, in agreement with previous data acquired with enzyme extracted from the resistant mosquito heads of G119S and ACE-R strains (Bourguet et al., 1997). Interestingly, the global AChE1 activity measured in S2 cells supernatant differed considerably between the recombinant enzymes. Activity of the F290V mutated AChE1 was slightly weaker or similar to that of the susceptible enzyme, whereas the activity of the G119S mutated AChE1 was highly reduced (Fig. 3). 3.3. Is F290V mutation still present in Cyprus C. pipiens populations? We analysed 32 C. pipiens individuals from the Kene sample collected in Cyprus in 2003 and compared their susceptibility to propoxur with that of ACE-R mosquitoes using the TPP diagnostic test (Bourguet et al., 1996) (Fig. 4A). For six mosquitoes, TPP profiles were very similar to that of ACE-R, which suggested that they harbour the F290V mutation. Other individuals were either
susceptible (16) or displayed a G119S heterozygous RS profile (10). As the TPP test previously failed to characterize the different genotypes of the ACE-R strain (Bourguet et al., 1996), we developed a PASA molecular test to unambiguously detect the presence of valine substitution (Figs. 4B and 5). The PASA assay was next used to genotype the DNA extracted from the abdomen of the individuals previously analysed with the TPP assay (Fig. 4A). The six individuals that exhibited the ACE-R TPP profile carried the 435 bp valine-specific fragment, thus confirming that the F290V substitution is still present in Cyprus mosquitoes collected in 2003. ACE-R individuals appear homozygous for the F290V mutation but do not present a great decrease in AChE1 activity counter to homozygous individuals for the G119S mutation (Fig. 4). 4. Discussion We show here that the peculiar AChE1 insensitivity, described in a C. pipiens mosquito population collected in Cyprus in 1987 (Wirth and Georghiou, 1996), results from a new substitution, F290V, and is still present in Cyprus. F290 is a conserved amino acid in most vertebrate and invertebrate AChE. This aromatic residue is part of the acyl pocket, which determines substrate specificity through interaction with the alkyl portion of the acyl moiety (Ordentlich et al., 1993). AChE2 insecticide-insensitivity affecting the same relative position was reported previously in Drosophila melanogaster and Musca domestica. In these species, the F290Y substitution alone provides a low level of resistance to a range of insecticides (Villatte et al., 2000) and combination with amino-acid replacement at other positions is frequent in natural populations (Menozzi et al., 2004; Walsh et al., 2001). Substituting phenylalanine to a bulkier residue like tyrosine may block the access to the active site. Although the F290V resistance described here is associated with a substitution to a smaller residue, the most probable orientation of the valine side chain, shown in Fig. 1, may prevent large substrate or inhibitor molecules
ARTICLE IN PRESS H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Residual AChE activity (%)
Residual AChE activity (%)
Dichlorvous 100 80 60 40 20 0 10-10
10-8 10-6 Concentration (M)
Paraoxon-ethyl
100 80 60 40 20 0
10-4
10-8
Residual AChE activity (%)
Residual AChE activity (%)
Propoxur 100 80 60 40 20 0 10-10
10-8 10-6 10-4 Concentration (M)
10-2
100 80 60 40 20 0 10-10
10-8 10-6 10-4 Concentration (M)
10-6
Residual AChE activity (%)
100 80 60 40 20 0 10-11
10-7
10-9
10-7 10-5 Concentration (M)
10-3
Eserine Residual AChE activity (%)
Residual AChE activity (%)
Aldicarb 100 80 60 40 20 0 10-8
10-2
Fenitroxon Residual AChE activity (%)
10-10 10-8 Concentration (M)
10-7 10-6 10-5 Concentration (M) Malaoxon
Chlorpyrifos-oxon 100 80 60 40 20 0 10-12
45
10-6 10-5 10-4 Concentration (M)
10-3
100 80 60 40 20 0 10-12
10-10 10-8 10-6 Concentration (M)
10-4
Fig. 2. Comparison of residual AChE1 activities of recombinant F290V protein (black crosses) and ACE-R mosquito head extracts (grey crosses) incubated in the presence of increasing doses of various insecticides. Residual activities of recombinant susceptible (black squares) and G119S mutated (black diamonds) AChE1 are included as controls. Error bars (o5%) were omitted for clarity. Table 1 Resistance ratio of WT and mutated (G119S and F290V) recombinant AchEl to various organophosphate (OP) and carbamate (CX) insecticides Insecticides
Aldicarb Propoxur Eserine Dichlorvos Malaoxon Paraoxon-ethyl Fenitroxon Chlorpyrifos-oxon
ki (l/mol/s)
Resistance ration (WT/mutant)
WT
G119S
F290V
G119S
F290V
167 2895 48135 1711 3209 4557 17115 54237
50 0 948 374 43 38 253 90
7 58 8852 25 372 917 181 14531
3 99624 51 5 75 120 68 604
25 50 5 68 9 5 95 4
to interact efficiently with the catalytic serine (Ser200). This is supported by data on propionylthiocholine, whose hydrolysis was much less efficient by ACE-R extracts than by Slab extracts (Bourguet et al., 1997). Thus, insensitivity
more likely results from a reduced stability of the noncovalent complex due to the loss of the aromatic cycle. Interestingly, the F290V site-directed mutagenesis of Drosophila AChE2 also led to a decreased susceptibility to
ARTICLE IN PRESS 46
H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
Fig. 5. Schematic representation of the PASA molecular test designed in the coding exon 5 of ace-1 gene, to detect the valine substitution. The specific locations of the primers and the expected sizes of the amplified fragments are indicated.
Fig. 3. WT, F290V and G119S recombinant AChE1 activity produced in S2 cells. Several dilutions of each supernatant were used. Experiments were repeated five times with the same amount of S2 cells and vector, and were reproducible.
Fig. 4. Detection of F290V in single individuals. (A) Relative residual AChE1 activities in the head extracts of individual mosquitoes from ACER and Cyprus were determined in the absence of insecticide (black), or in the presence of 104 M (white) or 102 M of propoxur (grey). Susceptible (SS), as well as homozygous (RR) and heterozygous (RS) resistant G119S profiles, were obtained with Slab and SR laboratory strains. (B) Diagnostic PASA tests were performed on the same individuals as in (A) to detect the F290V mutation. The 148 and 435 bp fragments are specific of the presence of a phenylalanine and a valine, respectively.
many distinct insecticides (Villatte et al., 2000). However, this mutation was also associated with a drastic decrease in substrate hydrolysis, predicted to considerably affect the viability of the mutant flies. Similar results were obtained with the F290V mutated human AChE (Ordentlich et al., 1993). In contrast, in C. pipiens and even when homozygous, this mutation does not seem to affect strongly the
AChE1 activity (Fig. 4A). A modifier that restores activity might have been selected in ACE-R mosquitoes. However, comparison of the global activities of the recombinant mutated enzymes suggests that it is not the case. Furthermore, it appears clearly that AChE1 and AChE2 behave differently in term of insensitivity to insecticides. These data suggest important differences in the tridimensional structures of the paralogous AChEs. A key difference was already shown in the width of the catalytic gorge, which is narrower in D. melanogaster AChE2 than in T. californica AChE (Harel et al., 2000). Structural differences of the active site could thus explain, at least partially, why different types of mutations (positions and substituted amino acids) have been selected in AChE1 or AChE2. The same F290V substitution was described recently in the AChE1 of a C. pomonella (L.) moth resistant to carbaryl and suggested to be responsible for the resistance observed (Cassanelli et al., 2006). Our results on recombinant mutated AChE1 confirm that the F290V substitution is probably responsible for the resistance observed in this Lepidopteran. Moreover, the observation that F290V homozygous resistant moths are viable suggests that the mutation does not dramatically decrease AChE1 activity. The reason why the F290V substitution is presently known only in Cyprus Island remains to be addressed. First, this mutation might be actually more largely spread but was not identified so far in other natural populations because of inadequate biochemical tests or excessive insecticide doses used in bioassays. Indeed, the F290V mutants do not survive at the propoxur concentration (10 ppm final) used to detect the G119S mutation. Bioassays at lower insecticide concentrations combined with a PASA molecular detection test will be needed to evaluate the geographic distribution of this mutation in natural populations worldwide. Second, the selection of F290V may depend on the nature of the insecticides used locally, regardless of its class. Indeed, the mosquito control program in Cyprus Island relied on OP treatment, in particular with dichlorvos, temephos and pirmimiphos methyl (Wirth and Georghiou, 1996). In agreement, our data established that although conferring a resistance to
ARTICLE IN PRESS H. Alout et al. / Insect Biochemistry and Molecular Biology 37 (2007) 41–47
several insecticides weaker than the G119S mutation, the F290V mutation confers a 10-fold higher resistance to dichlorvos. As the F290V mutation appears less costly than the G119S, it is expected to prevail in areas treated with this specific insecticide. Acknowledgements We would like to thank P. Fort, J.P. Leonetti, M. Raymond and N. Pasteur for helpful comments on the manuscript, and V. Durand for assistance with the references. This work was financed in part by the ANR Morevol Sante-Environnement (Ministe`re de´le´gue´ a` la Recherche). Contribution 2006-082 of the Institut des Sciences de l’Evolution de Montpellier (UMR CNRS 5554). References Alout, H., Berthomieu, A., Cui, F., Tan, Y., Berticat, C., Qiao, C., Weill, M. Different amino-acid substitutions confer insecticide resistance through acetylcholinesterase 1 insensitivity in Culex vishnui and Culex tritaeniorhynchus (Diptera: Culicidae) mosquitoes from China. J. Med. Entomol. in press. Berticat, C., Boquien, G., Raymond, M., Chevillon, C., 2002. Insecticide resistance genes induce a mating competition cost in Culex pipiens mosquitoes. Genet. Res. 79, 41–47. Berticat, C., Duron, O., Heyse, D., Raymond, M., 2004. Insecticide resistance genes confer a predation cost on mosquitoes, Culex pipiens. Genet. Res. 83, 189–196. Bourguet, D., Lenormand, T., Guillemaud, T., Marcel, V., Fournier, D., Raymond, M., 1997. Variation of dominance of newly arisen adaptive genes. Genetics 147, 1225–1234. Bourguet, D., Pasteur, N., Bisset, J., Raymond, M., 1996. Determination of Ace.1 genotypes in single mosquitoes: toward an ecumenical biochemical test. Pest. Biochem. Physiol. 55, 122–128. Cassanelli, S., Reyes, M., Rault, M., Manicardi, G.C., Sauphanor, B., 2006. Acetylcholinesterase mutation in an insecticide-resistant population of the codling moth Cydia pomonella (L.). Insect Biochem. Mol. Biol. 36, 642–653. Fournier, D., Karch, F., Bride, J.M., Hall, L.M.C., Berge´, J.B., Spierer, P., 1989. Drosophila melanogaster acetylcholinesterase gene, structure, evolution and mutations. J. Mol. Evol. 210, 15–22. Fournier, D., Bride, J.M., Hoffmann, F., Karch, F., 1992. Acetylcholinesterase. Two types of modifications confer resistance to insecticide. J. Biol. Chem. 267, 14270–14274. Georghiou, G.P., Metcalf, R.L., Gidden, F.E., 1966. Carbamatesresistance in mosquitoes; selection of Culex pipiens fatiguans Wied ( ¼ Culex quinquefasciatus) for resistance to baygon. WHO 35, 691–708. Harel, M., Kryger, G., Rosenberry, T.L., Mallender, W.D., Lewis, T., Fletcher, R.J., Guss, J.M., Silman, I., Sussman, J.L., 2000. Threedimensional structures of Drosophila melanogaster acetylcholinesterase and of its complexes with two potent inhibitors. Protein Sci. 9, 1063–1072. Huchard, E., Martinez, M., Alout, H., Douzery, E.J.P., Lutfalla, G., Berthomieu, A., Berticat, C., Raymond, M., Weill, M., 2006. Acetylcholinesterase genes within the Diptera: takeover and loss in true flies. Proc. R. Soc. Lond. B. Biol. Sci. 273, 2595–2604.
47
Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive acetylcholinesterases of the housefly, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31, 991–997. Menozzi, P., Shi, M.A., Lougarre, A., Tang, Z.H., Fournier, D., 2004. Mutations of acetylcholinesterase which confer insecticide resistance in Drosophila melanogaster populations. BMC. Evol. Biol. 4, 4. Mute´ro, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistanceassociated point mutations in insecticide-insensitive acetylcholinesterase. Proc. Natl. Acad. Sci. USA 91, 5922–5926. Nabeshima, T., Mori, A., Kozaki, T., Iwata, Y., Hidoh, O., Harada, S., Kasai, S., Severson, D.W., Kono, Y., Tomita, T., 2004. An amino acid substitution attribuable to insecticide-resistance in a Japanese encephalitis vector mosquito, Culex tritaeniorhynchus. Biochem. Biophy. Res. Commun. 313, 794–801. Oakeshott, J.G., Devonshire, A.L., Claudianos, C., Sutherland, T.D., Horne, I., Campbell, P.M., Ollis, D.L., Russell, R.J., 2005. Comparing the organophosphorus and carbamate insecticide resistance mutations in cholin- and carboxyl-esterases. Chem. Biol. Interact. 157, 269–275. Ordentlich, A., Barak, D., Kronman, C., Flashner, Y., Leitner, M., Segall, Y., Ariel, N., Cohen, S., Velan, B., Shafferman, A., 1993. Dissection of the human acetylcholinesterase active center determinants of substrate specificity. Identification of residues constituting the anionic site, the hydrophobic site, and the acyl pocket. J. Biol. Chem. 268, 17083–17095. Raymond, M., Berticat, C., Weill, M., Pasteur, N., Chevillon, C., 2001. Insecticide resistance in the mosquito Culex pipiens: what have we learned about adaptation? Genetica 112/113, 287–296. Rogers, S.O., Bendich, A.J., 1988. Extraction of DNA from plant tissues. In: Gelvin, S.B., Schilperoort, R.A. (Eds.), Plant Molecular Biology Manuel, vol. A6. Kluwer Academic Publishers, Boston, pp. 1–10. Sussman, J.L., Harel, M., Frolow, F., Oefner, C., Goldman, A., Toker, L., Silman, I., 1991. Atomic structure of acetylcholinesterase from Torpedo californica: a prototypic acetylcholine-binding protein. Science 253, 872–879. Vellom, D.C., Radic, Z., Li, Y., Pickering, N.A., Camp, S., Taylor, P., 1993. Amino-acid residues controlling acetylcholinesterase and butylcholinesterase specificity. Biochemistry 32, 12–17. Villatte, F., Ziliani, P., Marcel, V., Menozzi, P., Fournier, D., 2000. A high number of mutations in insect acetylcholinesterase may provide insecticide resistance. Pest. Bioch. Physiol. 67, 95–102. Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M., Hemingway, J., 2002. Resistance-associated point mutations of organophosphate acetylcholinesterase, in the olive fruit fly Bactrocera oleae. Insect Mol. Biol. 11, 329–336. Walsh, S.B., Dolden, T.A., Moores, G.D., Kristensen, M., Lewis, T., Devonshire, A.L., Williamson, M.S., 2001. Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance. Biochem. J. 359, 175–181. Weill, M., Fort, P., Berthomieu, A., Dubois, M.P., Pasteur, N., Raymond, M., 2002. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is non-homologous to the ace gene in Drosophila. Proc. R. Soc. Lond. B Biol. Sci. 269, 2007–2016. Weill, M., Lutfalla, G., Mogensen, K., Chandre, F., Berthomieu, A., Berticat, C., Pasteur, N., Phillips, A., Fort, P., Raymond, M., 2003. Insecticide resistance in mosquito vector. Nature 423, 136–137. Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marquine, M., Raymond, M., 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Mol. Biol. 13, 1–7. Wirth, M.C., 1998. Isolation and characterization of two novel organophosphate resistance mechanisms in Culex pipiens from Cyprus. J. Am. Mosq. Control Assoc. 14, 397–405. Wirth, M.C., Georghiou, G.P., 1996. Organophosphate resistance in Culex pipiens from Cyprus. J. Am. Mosq. Control Assoc. 12, 112–118.