A new multigene family encoding calcium-dependent calmodulin-binding membrane proteins of Paramecium tetraurelia

Gene 231 (1999) 21–32

A new multigene family encoding calcium-dependent calmodulinbinding membrane proteins of Paramecium tetraurelia Catherine W.M. Chan 1, Yoshiro Saimi, Ching Kung * Laboratory of Molecular Biology, University of Wisconsin-Madison, Madison, WI 53706, USA Received 14 December 1998; received in revised form 19 February 1999; accepted 23 February 1999; Received by M. Schartl

Abstract Ca2+/calmodulin (CaM ) regulates various physiological processes in a wide variety of organisms, metazoa and protists alike. To better understand Ca2+/CaM-dependent processes, particularly those with membrane-associated components, we studied Ca2+/CaM-binding membrane proteins in Paramecium tetraurelia, a unicellular model system. A CaM-binding protein, PCM1 (paramecium CaM-binding membrane-bound protein), from a detergent-solubilized ciliary membrane fraction was identified and purified through Ca2+-dependent CaM-affinity chromatography. PCM1 has an apparent molecular mass of approx. 65 kDa. It binds radiolabeled CaM in blot overlay assays and binds to CaM-affinity columns, both only in the presence of 10 mM or higher Ca2+. Three peptide sequences from PCM1 were obtained, and polymerase chain reaction (PCR) and Southern hybridization experiments were designed accordingly, leading to a partial cDNA clone for PCM1 and the discovery of three homologs: PCM2, PCM3 and PCM4. Amino-acid sequences predicted by the full-length coding sequence for PCM3 and partial genes for PCM1, PCM2 and PCM4 are very similar (approx. 85% amino-acid identities). Their sequences indicate that they are hitherto novel proteins with b/c-crystallin domains, cysteine-rich regions and potential CaM-binding domains. These protein motifs are suggested to mediate protein–protein interaction important for Ca2+/CaM signal transduction event(s) through the PCM family of proteins. © 1999 Elsevier Science B.V. All rights reserved. Keywords: b/c-crystallin domain; Cysteine-rich region; Signal transduction

1. Introduction Ca2+ is an important second messenger in many biological systems, regulating a wide variety of physiological processes including cell proliferation, organization of the cytoskeleton, cell motility, and modulation of other second-messenger systems (Crivici and Ikura, 1995; Clapham, 1995). For example, in many cell types, transient increases in the intracellular concentration of Ca2+ are closely correlated with entry into mitosis. Stimulus-dependent exocytosis, which is crucial for horAbbreviations: BAA, basic amphiphilic alpha; CaM, calmodulin; EGF, epidermal growth factor; OG, n-octyl-b--glucopyranoside; ORF, open reading frame; PCM, Paramecium calmodulin-binding membrane-bound protein; PCR, polymerase chain reaction; SDS– PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis. * Corresponding author. Present address: 1525 Linden Drive, Madison, WI 53706, USA. Tel.: +1 (608) 262-7976, +1 (608) 262-9472; Fax: +1 (608) 262-4570 E-mail address: [email protected] (Ching Kung) 1 Present address: Biotechnology Center, University of WisconsinMadison, 425 Henry Mall, Madison, WI 53706, USA.

mone and neurotransmitter secretion, is also dependent upon increases in intracelluar Ca2+ concentration (Clapham, 1995). Analogous to observations made in other systems, Ca2+ signaling is important for cellular functions in Paramecium. For instance, a cytosolic Ca2+ wave is believed to lead an elaborate scheme of duplicating and re-organizing the pattern of ciliary basal bodies and their associated cytoskeletal structures and networks during each cell division, such that its characteristic asymmetry and polarity is maintained (Jerka-Dziadosz et al., 1992). Ca2+ is also the main charge carrier of the Ca2+ action potential of Paramecium and, therefore, has a major role in controlling membrane excitability and consequently swimming behavior (Schultz et al., 1990). The discharge of trichocysts (secretory organelles), a process similar to regulated secretion in other organisms, is also regulated by Ca2+ in Paramecium ( Kerboeuf et al., 1993). Ca2+ acts through Ca2+-binding proteins, the most ubiquitous of which is calmodulin (CaM ). CaM is a

0378-1119/99/$ – see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 9 9 ) 0 0 10 1 - 8

22

C.W.M. Chan et al. / Gene 231 (1999) 21–32

highly conserved protein. Paramecium CaM is 88% identical and 94% similar to bovine CaM ( Kung et al., 1992). The crystal structure of native or heterologously expressed Paramecium CaM is also nearly identical to that of bovine CaM (Ling et al., 1994). It typically has four functional Ca2+-binding pockets of the EF-hand type (Crivici and Ikura, 1995). Upon Ca2+-binding, CaM changes its conformation, thereby enabling its interaction with target proteins. This interaction, in turn, induces conformational changes in the target proteins and results in their altered activities (Crivici and Ikura, 1995). The roles of CaM in various Ca2+-regulated processes in eukaryotes are still under investigation (e.g., see Zhang et al., 1998 and Xia et al., 1998). However, Paramecium is one of the few experimental systems where viable CaM mutants have been found ( Kung et al., 1992; Ling et al., 1994), and analyses of these CaM mutants support the notion that CaM mediates Ca2+ signaling in many cellular events. Phenotypes of Paramecium CaM mutants suggest that CaM regulates ion channel functions, particularly those controlling membrane excitation ( Kung et al., 1992; Ling et al., 1994). Moreover, regulation of one of these channels, the Ca2+-dependent Na+ channel, has been indicated to be through direct binding of CaM (Saimi and Kung, 1994). These CaM mutants also show pleiotropic defects that are consistent with a role of CaM in regulating motility, stimulus-dependent exocytosis and growth and development ( Kung et al., 1992; Ling et al., 1994; Kerboeuf et al., 1993). Biochemical and pharmacological studies in Paramecium offer additional collaborative evidence. For example, CaM has been shown to stimulate the activity of a guanylyl cyclase whose increased activity is probably correlated with various stimulatory events and the resulting swimming behavior (Schultz et al., 1990), and application of anti-CaM drugs inhibits exocytosis in wild-type cells ( Kerboeuf et al., 1993). To further our understanding of Ca2+/CaMregulated processes, we investigated CaM-binding proteins of Paramecium, a model system for studying various biological processes. We focused on membranebound CaM-binding proteins because there is relatively little knowledge on the participation of Ca2+/CaM in membrane-associated signal transduction processes. As opposed to the abundance of information on its role in regulating more than 20 cytosolic enzymes (Crivici and Ikura, 1995), Ca2+/CaM has been shown to modulate the activities of only several membrane proteins that are involved in Ca2+ homeostasis and ion channel functions. Some examples are: the plasma membrane Ca2+ATPase (Crivici and Ikura, 1995), the sarcoplasmic recticulum ryanodine receptor (Tripathy et al., 1995), the cyclic nucleotide-gated channel in olfactory neurons and rod outer segments (Molday, 1996), a light-activated channel TRPL (Scott et al., 1997), the N-methyl-

-aspartate receptor ( Zhang et al., 1998), and the smallconductance Ca2+-activated K+ channel ( Xia et al., 1998). We do not wish to further study known Ca2+/CaM targets and, therefore, did not try to clone their homologs in Paramecium by sequence homology. We instead directed our research towards finding new Ca2+/CaM-binding proteins in the ciliary membrane. This membrane is interesting because it contains important components of signal transduction, such as depolarization-activated Ca2+ channels, guanylyl and adenylyl cyclases, type I protein phosphatases and Ca2+-ATPases (Schultz et al., 1990). Here, we report that we have identified and purified a Ca2+-dependent CaM-binding protein, PCM1 (Paramecium CaM-binding membrane-bound protein), from the ciliary membrane of Paramecium. A corresponding partial cDNA clone for PCM1 has been obtained, and we further discovered a family of PCM1 homologs, suggesting that the PCM family consists of at least four members. Predicted amino-acid sequences are consistent with the idea that the PCM proteins are novel, with b/c-crystallin domains and cysteine-rich regions that confer structures possibly important for their function(s).

2. Materials and methods 2.1. Obtaining ciliary membrane proteins of P. tetraurelia P. tetraurelia strain nd-6 (Ling et al., 1994) was cultured in an axenic medium in bioreactors, and deciliation was done by a standard procedure (Schultz et al., 1990). The Paramecium culture and resulting cilia preparation was kindly provided by Professor J. E. Schultz ( University of Tu¨bingen, Germany). Frozen cilia were mixed with a solubilization buffer (1:10 v/v), containing 2% n-octyl-b--glucopyranoside (OG), 50 mM NaCl, 5 mM EDTA, 0.02% NaN , 50 mM Hepes (pH 7.6), 3 and then centrifuged at 165 000×g for 1.5 h to remove the detergent-insoluble material, yielding a fraction enriched with ciliary membrane proteins. 2.2. 35S-labeling of CaM 35S-labeled wild-type Paramecium CaM was produced in Escherichia coli JM109 ( Kink et al., 1991). Bacterial cultures were grown in M9 medium supplemented with vitamins and all amino acids (Gross et al., 1984) except cysteine and methionine. CaM expression was induced in mid-log phase cultures with 1 mM IPTG for 20 min at 37°C in the presence of Tran35S-label (a mixture of 35S -methionine, 35S -cysteine, and various 35S-labeled amino acids; ICN, Costa Mesa, CA, USA). 35S-labeled CaM was then purified as by Kink et al. (1991). Parallel

C.W.M. Chan et al. / Gene 231 (1999) 21–32

experiments substituting unlabeled -methionine and cysteine for Tran35S-label were done to estimate the total yield of CaM and, therefore, the specific activity of the labeled CaM. Typical specific activity of the 35Slabeled CaM was 1500–2000 cpm/ng protein. 2.3. CaM blot overlay CaM blot overlay experiments were performed essentially as described by Evans and Nelson (1989), except that renaturation of proteins on blots was done according to Hubbard and Klee (1987). The Ca2+ concentration stated throughout this paper refers to the concentration of free Ca2+ in the buffer. In each experiment, 3 nM or 105 cpm/ml 35S-CaM was used. Autoradiography was performed using either Kodak X-OMAT AR film or Phosphoimager screens (Molecular Dynamics, Sunnyvale, CA, USA). 2.4. CaM affinity chromatography CaM affinity chromatography was carried out with commercially available CaM-Sepharose (bovine testes CaM immobilized on Sepharose 4B, Pharmacia, Piscataway, NJ, USA) since Paramecium CaM and bovine CaM are very similar and, as further demonstrated in the Results section, Paramecium CaM-binding proteins bind bovine CaM. OG-extracted cilia were loaded onto a CaM–Sepharose column pre-equilibrated with a loading buffer, consisting of 1% OG, 100 mM NaCl, 1 mM CaCl , 0.5 mM MgCl , 0.02% NaN , 2 2 3 50 mM Hepes (pH 7.3). The column was washed with at least 10 column-volume of loading buffer before CaM-binding proteins were eluted by replacing 1 mM Ca2+ with 5 mM EGTA in the buffer. The EGTA eluate was analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) under reducing conditions and/or CaM blot overlay experiments. 2.5. Peptide sequencing of PCM1 PCM1-enriched fractions from CaM-affinity chromatography of OG-extracted cilia were pooled and concentrated, and proteins were separated by SDS–PAGE. The band corresponding to PCM1, estimated to be about 5 mg, was cut out and prepared for peptide sequencing according to the instructions provided by the W.M. Keck Biotechnology facility at Yale University. 2.6. Cloning the corresponding gene for PCM1 and its homologs To clone the corresponding gene for PCM1, degenerate primers were made according to Peptides A, B and C (obtained from peptide sequencing, see Section 3.2) as follows (from 5∞ to 3∞): A sense, AYATHGAYCAYACNGGNGA; A antisense, TCNCCNGTR-

23

TGRTCDATRTC; B sense, GARYARWSITTYYTIGARGAYAA; B antisense, TTRTCYTCIARRAAISWYTRYTC; C sense, YARATHTTYAAYMMIYARGCICC; C antisense, GCYTRIKKRTTRAADATYTRIYC, where standard International Union of Biochemistry codes are used. PCR was carried out on total Paramecium DNA with the degenerate primers in all possible combinations, using Taq DNA polymerase (Promega, Madison, WI, USA) with the provided buffer supplemented with 1.5–2.0 mM MgCl . Cycling parame2 ters were: (94°C, 2 min; 44°C, 1 min; 72°C, 1 min) for 3 cycles; (94°C, 1 min; 44°C, 45 s; 72°C, 1 min) for 35 cycles and a final extension at 72°C for 5 min. PCR products were screened with 32P end-labeled oligonucleotides that were presumed to be internal to the pairs used in PCR. A fragment of approx. 0.6 kb, k0.6 (a PCR product amplified with A sense and C antisense, and hybridized to both B sense and B antisense) was thereby identified and cloned. k0.6 was labeled with 32 P with a random primer labeling kit (Rediprime, Amersham, Arlington Heights, IL, USA) according to the manufacturer’s instructions and was then used as a probe to screen for PCM1 and its homologs in PCR products and various DNA libraries. cDNA was reverse transcribed from purified mRNA (polyATtract I, Promega, Madison, WI, USA) using Superscript II reverse transcriptase (Stratagene, La Jolla, CA, USA) with ( T ) V at 46°C. The cDNA was used 24 as the template in PCR with Taq DNA polymerase, using the provided buffer supplemented with 3 mM MgCl . ck0.8 was obtained and cloned after two rounds 2 of PCR. The first round of PCR was performed with a sense strand primer GATRTAGATCATACKGGYGA (based on the sequence of Peptide A and taking into account the nucleotide sequences of various PCM1 homologs in that region) and an anti-sense primer ( T ) V. The cycling parameters were : (94°C, 1 min 30 s; 24 46°C, 45 s; 72°C, 2 min) for 3 cycles; (94°C, 45 s; 46°C, 45 s; 72°C, 2 min) for 40 cycles and a final extension at 72°C for 5 min. The products from the first round of PCR were then used as the template for the second round of PCR, with a sense strand primer GAATAATCWTTYTTGGAAGATAA (based on the sequence of Peptide B and the sequences of PCM1 homologs in that region) and anti-sense primer ( T ) V. The cycling parameters were: (94°C, 45 s; 46°C, 24 45 s; 72°C, 2 min) for 40 cycles with a final extension at 72°C for 5 min. The cDNA described above was also used in PCR with Pfu DNA polymerase (Stratagene, La Jolla, CA, USA), using the provided buffer (containing 2 mM MgSO ) and primers based on the DNA sequence of 4 one PCM1 homolog, gk2.4. The 5∞ primer was GAGAAGATTCTAATGGTTTGAGGG; the 3∞ primer was TATTCTACTTCAATCCAGCCTCC. The cycling parameters were: (94°C, 2 min; 62°C, 1 min; 72°C,

24

C.W.M. Chan et al. / Gene 231 (1999) 21–32

1 min) for 3 cycles; (94°C, 1 min; 62°C, 45 s; 72°C, 1 min) for 35 cycles and a final extension at 72°C for 5 min. pck1.1 was thus obtained and cloned. All molecular biological procedures were done using standard protocols (Ausubel et al., 1995). All DNA fragments obtained through PCR and library screening were cloned into pBluescript KS II − (Stratagene, La Jolla, CA, USA) before further analyses. DNA sequencing reactions were prepared using a dye terminator cycle sequencing kit (PE Applied Biosystems, Warrington, UK ) following the manufacturer’s instructions and were run on ABI automated sequencers (Perkin Elmer, Norwalk, CT, USA). Analyses of all clones, including secondary structure and hydrophilicity/hydrophobicity predictions, were aided by the use of the DNASTAR program (Madison, WI, USA). Potential transmembrane domains were located by manually searching for hydrophobic segments with a peak Kyte–Doolittle hydrophobic index of at least 1.5 and a length of at least 17 amino acids, essentially as described by Klein et al. (1985). Alternatively, transmembrane domain predictions were carried out with the program TMpred (see documentation therein from ISREC, Switzerland ). Database searches were performed using MPsrch (Release 2.1D, Biocomputing Research Unit, University of Edinburgh, UK ) or WU-BLAST (BLASTP 2.0aMP, Washington University, USA) with default parameters. The nucleotide sequences for all the clones described in this study have been deposited in the GenBank database under the accession numbers AF022488 (pck1.1), AF050518 (ck0.8), AF050519 (gk2.4), and AF050520 (gk2.5).

shown) and were eluted from the column when Ca2+ was subsequently chelated by EGTA. This EGTA-eluted fraction consistently contained a major protein with an apparent molecular mass of approx. 65 kDa, PCM1 ( Fig. 1a). The CaM-binding activity of PCM1 was further corroborated by CaM blot overlay experiments ( Fig. 1b). Binding of PCM1 to 35S-CaM requires a minimum of 10 mM Ca2+. Under our blot overlay conditions (10–1000 mM Ca2+ and 3 nM 35S-CaM ), only high-affinity CaM-binding proteins like calcineurin A and cyclic nucleotide phosphodiesterase (Crivici and Ikura, 1995) bind 35S-CaM, whereas those of lower affinity such as spectrin (Crivici and Ikura, 1995), or non-CaM-binding proteins such as the ones included in the molecular weight standards ( low-range SDS–PAGE standards, Biorad, Hercules, CA, USA) do not (data not shown). PCM1 is also found in purified ciliary membrane vesicle preparations (Adoutte et al., 1980) as assayed by CaM affinity chromatography and 35S-CaM overlay, and is absent from the cytosolic fraction as indicated by 35S-CaM overlay assays (data not shown). PCM1 is, therefore, most likely a high-affinity Ca2+-dependent CaM-binding protein in the ciliary membrane of Paramecium and was chosen for further analyses. Starting with about 50 g of cilia and through

3. Results 3.1. Identification and purification of a CaM-binding protein, PCM1, in the ciliary membrane of Paramecium This project was directed towards finding new elements in Ca2+/CaM signal transduction in an excitable membrane and not towards homologs of known Ca2+/CaM targets. Our study focused on CaM-binding proteins in the ciliary membrane which contains important components of signaling cascades. Furthermore, the ciliary membrane represents about 50% of surface membrane area but only about 1% of total proteins (Schultz et al., 1990; Adoutte et al., 1980), making it a good source for Paramecium surface membrane proteins. Cilia were extracted with a non-ionic detergent OG to enrich for ciliary membrane proteins ( Evans and Nelson, 1989), and CaM-binding proteins were purified by CaMaffinity chromatography. Several proteins were retained on CaM–Sepharose in the presence of 1 mM Ca2+ (and also in the presence of 10 and 100 mM Ca2+, data not

Fig. 1. PCM1 is a CaM-binding protein. (a) Purification of PCM1 using CaM affinity chromatography. Coomassie Blue (R-250) stained SDS–polyacrylamide gels loaded with various CaM affinity chromatography fractions are shown. Lane 1: OG-solubilized ciliary membrane proteins, approx. 60 mg of total protein. Lane 2: void volume (in 1 mM Ca2+), approx. 120 mg. Lane 3: wash with the loading buffer (with 1 mM Ca2+), approx. 0.5 mg. Lane 4: EGTA (5 mM ) eluate, approx. 0.3 mg. PCM1 (right-pointing arrowhead ) is the major protein eluted from the column. (b) PCM1 binds 35S-CaM. An EGTA-eluted fraction from a CaM affinity chromatography was assayed using 35SCaM blot overlay and the autoradiogram is shown. PCM1 ( left-pointing arrowhead ), among other proteins, binds 35S-CaM in 0.1 mM Ca2+ after being immobilized on nitrocellulose membrane. The other 35S-CaM-binding activities identified here may represent other CaMbinding proteins or proteolytic fragments of PCM1. However, since they represent a small percentage of the total protein content of the EGTA-eluted fraction, as judged by the relative intensities of their Coomassie-Blue staining, they were not studied further.

C.W.M. Chan et al. / Gene 231 (1999) 21–32

CaM-affinity chromatography, we obtained approx. 6 mg of PCM1. 3.2. Peptide sequencing of PCM1 Initial peptide sequencing attempts suggested that PCM1 is N-terminally blocked. Therefore, PCM1 was digested with trypsin and three internal peptide sequences were then obtained as follows: Peptide A, {T E V D I D H T G E Q A K} ; Peptide B, {F I L L E Q S F L E D K}; Peptide C, {G V D(g) Q I F N H(t) Q A P}, where standard single letter amino-acid codes are used and possible alternative amino acids are indicated in parentheses. 3.3. Cloning of the corresponding genes for PCM1 and its homologs Using the peptide information available, degenerate oligonucleotides were synthesized for PCR. As described in Materials and methods (Section 2.6), all possible combinations of primers were attempted, and only one primer combination yielded a product which hybridized to the presumed internal oligonucleotides. This PCR product, k0.6, was amplified from Paramecium total DNA with the primers A sense and C antisense and was recognized by the oligonucleotides B sense and B antisense in Southern hybridization experiments. The conceptual translation of k0.6 contains Peptides A, B and C with a few mismatches (single base pair changes; one each in Peptide A and Peptide C ) that are not explained by the degeneracy of the primers. k0.6 thus probably

25

encodes a section of a PCM1 homolog and not PCM1 itself. To gain more information on the genes encoding PCM1 and its homologs, k0.6 was used as a probe to screen various DNA libraries. Two genomic DNA clones were found to hybridize to k0.6. One was identified from a Paramecium genomic DNA library in EMBL4 l phage, a gift from Professor J. Forney (Purdue University). The positively hybridizing species was narrowed down to an XbaI fragment of approx. 2.5 kb, gk2.5. The second genomic DNA clone, gk2.4 (an approx. 2.4 kb NheI/PstI fragment), was obtained from a size-fractionated Paramecium genomic DNA library. However, as explained further below, gk2.4 and gk2.5 also likely encode PCM1 homologs (PCM3 and PCM4, see below) but not PCM1. Other approaches were taken to obtain the gene for PCM1. PCR was performed on cDNA with primers based on the three sequenced peptides of PCM1 and sequence information on PCM1 homologs. A nested PCR product (see Materials and methods, Section 2.6), ck0.8, was amplified using primers made to the sequences of Peptides A and B and the poly-dA region of the corresponding mRNA. Another cDNA fragment, pck1.1, was amplified with primers based on the sequence of gk2.4 identified above. Both PCR products hybridized to 32P-labeled k0.6. As explained in the following sections, pck1.1 most likely codes for a portion of PCM1, whereas ck0.8 encodes a section of yet another PCM1 homolog (PCM2, see below). The relative positions of all clones mentioned above, pck1.1, ck0.8, gk2.4 and gk2.5 (encoding PCM1, 2, 3 and 4, respectively), are shown schematically in Fig. 2.

Fig. 2. Schematic representation of pck1.1, ck0.8, gk2.4 and gk2.5. The relative positions of the two partial cDNA clones, pck1.1 and ck0.8, and the two genomic DNA clones, gk2.4 and gk2.5, are shown, along with the probe used in Southern hybridizations (k0.6). Coding sequences (or presumed coding sequences) are shaded, and the names of the corresponding encoded proteins are indicated in parentheses. Nucleotide positions of the two genomic DNA clones are marked, with the first base in the assigned start codon defined as position 1, and the nucleotide sequences 5∞ to that first base are labeled with negative numbers accordingly. Putative introns are denoted by , above the genomic DNA clones, and those in equivalent positions are aligned and marked by dash lines. The positions of these putative introns are 205–231, 434–460, 881–908, 1386–1410, and 1671–1694 in gk2.4; 297–324, 539–564, 767–792, 1213–1237, and 1715–1740 in gk2.5. Interruptions in pck1.1 and ck0.8 mark the absence of putative introns in these cDNA clones. Nucleotide identities to pck1.1 are: 82% for ck0.8, 77% for gk2.4, and 79% for gk2.5.

26

C.W.M. Chan et al. / Gene 231 (1999) 21–32

3.4. PCM1 and PCM2 The cDNA clone pck1.1 contains 1047 nucleotides and one contiguous open reading frame (ORF ), the conceptual translation of which corresponds to 349 residues (Figs. 2 and 3). This ORF contains all three sequenced peptides (Peptides A, B, and C ) with no

mismatches, and is approx. 60% of the predicted length of PCM1 based on its apparent molecular mass. Therefore, pck1.1 is a partial cDNA clone for PCM1. The other cDNA clone, ck0.8, contains 778 nucleotides and shares 82% nucleotide identity with pck1.1 ( Fig. 2). ck0.8 has one contiguous ORF that contains Peptide B and Peptide C with two conserved amino acid

Fig. 3. Alignment and notable regions of PCM1–4. The amino-acid alignment of PCM1–4 is shown. Identical residues are marked in black, and conserved substitutions are lightly shaded. Amino-acid identities among the four proteins, with that of PCM1 as the standard, are: PCM2, 85%; PCM3, 89%; PCM4, 87%. The period at the end of PCM2 and PCM3, respectively, indicates the stop codon in each of the corresponding DNA clones. Notable regions are indicated as follow. The putative b/c-crystallin domain is marked by a shaded bar below, and the two types of cysteinerich regions are marked with double-headed arrows (The Type I cysteine-rich region is C-terminal to Type II ). Peptides A, B, and C in PCM1 (the three sequenced peptides, from N-terminal to C-terminal ), and their counterparts in PCM2–4, are indicated by dash lines underneath. All four PCM proteins contain ‘D’ in residue three and ‘H’ in residue eight of Peptide C and, therefore, the possible alternative amino acids in Peptide C according to peptide sequencing analysis have not been found. The positions of putative BAA helices are: residues 17–40 and 208–233 for PCM1, residues 102–127 for PCM2, residues 209–232 and 399–424 for PCM3, and residues 57–80, 311–334 and 501–526 for PCM4. Standard singleletter amino acid codes are used. Dash lines indicate gaps introduced to optimize the alignment. Residue positions are indicated on the side. The alignment is generated with the Clustal method of MegAlign (DNASTAR) with default parameters.

C.W.M. Chan et al. / Gene 231 (1999) 21–32

substitutions (Fig. 3). This ORF also contains the stop codon TGA, and encodes a polypeptide of 243 amino acids. Its deduced protein is 85% identical to PCM1 and, therefore, the entire predicted protein may also be homologous to PCM1. This suggests that ck0.8 encodes the C-terminal approx. 40% of a PCM1 homolog. We call this protein PCM2. 3.5. PCM3 and PCM4 Nucleotide sequences of gk2.4 and gk2.5 are very similar to each other and to that of pck1.1 and ck0.8, sharing approx. 80% identities in their corresponding regions ( Fig. 2). To determine the longest possible ORFs in these two sequences, we considered their distributions of A/T and the presence of putative introns. The Paramecium genome contains a high percentage of A/T nucleotides. However, coding sequences are typically less A/T rich (approx. 65%) than their surrounding, non-coding regions (approx. 80%) ( Elwess and Van Houten, 1997). Introns can be predicted by the presence of intron consensus, characterized by the length and A/T content of intron areas and specific sequences that border the introns (Russell et al., 1994). We also took into account that homologous genes may have conserved exon–intron boundaries, a phenomenon previously observed in Paramecium (Russell et al., 1994). The lack of putative introns but conservation of the surrounding sequences in the corresponding regions of pck1.1 and ck0.8 further supports our assignment of introns (Fig. 2). Conceptual translations thus obtained from the two genomic fragments yield predicted proteins that are similar to PCM1 and PCM2, and are close to the apparent molecular mass of PCM1, as explained in more detail below. The longest ORF in gk2.4 consists of 1754 nucleotides (Fig. 2), starting with the initiation codon (the nearest in-frame stop codon is three nucleotides upstream) and ending with the stop codon. The stop codon is in a position equivalent to that in ck0.8, and very close to the last predicted amino acid of pck1.1 (Fig. 3), suggesting that all members of the PCM protein family have similar C-termini and that pck1.1 codes for the C-terminal approx. 60% of PCM1. This longest ORF has an A/T content of 63% and is surrounded by regions of higher % A/T (approx. 80% A/T for about 70 nucleotides in the 5∞ and 76% for 428 nucleotides in the 3∞). Therefore, gk2.4 most likely encompasses the entire coding region of a protein of 540 amino acids, corresponding to approx. 61 kDa, which is very similar to the apparent molecular mass of PCM1 of approx. 65 kDa. The predicted amino-acid sequence of gk2.4 is 89% identical to PCM1, and contains Peptides A, B, and C with a few conserved substitutions (Fig. 3). The present data support the notion that gk2.4 encodes a third member of the PCM family, PCM3, and that the

27

entire coding sequence for PCM3 is contained within gk2.4. The longest possible ORF in gk2.5 has 1861 nucleotides (Fig. 2). This ORF begins with a start codon (the nearest in-frame stop codon is 63 nucleotides upstream), has an A/T composition of 62%, and is preceded by a region of higher % A/T (77% for 657 nucleotides in the 5∞). Therefore, this ORF encompasses the N-terminal 577 amino acids of its corresponding protein (Fig. 3). If we assume that all members of the PCM family have homologous C-termini, as suggested above, then gk2.5 covers approx. 90% of the complete coding sequence (or that gk2.5 is approx. 220 nucleotides short of the 3∞ end ). This also implies that the entire protein consists of 642 amino acids, corresponding to approx. 72 kDa. However, if we omit the first putative intron, the predicted protein of the resulting shorter ORF contains 552 amino acids, or approx. 62 kDa, making it even more similar in size to PCM1 and PCM3. This possible variation in the N-terminal sequence of the deduced protein of gk2.5 does not affect its high degree of similarity to other members of the PCM family: It is 87% identical to PCM1, and contains Peptides A, B, and C with a few conserved substitutions (Fig. 3). Therefore, gk2.5 seems to code for a fourth member of the PCM family, PCM4. 3.6. The PCM family The existence of at least four to five members in the PCM family is supported by results from genomic Southern hybridization experiments. When Paramecium genomic DNA was digested to completion with various restriction enzymes and then probed with 32P-labeled k0.6 (a section of a putative PCM1 homolog), four or more bands hybridized ( Fig. 4a). However, Northern hybridization analysis on mRNA with k0.6 as the probe revealed only one major hybridizing species at approx. 1.9 kb ( Fig. 4b). Assuming the length of the untranslated region is minimal, this suggests that the majority of the expressed proteins from the PCM family are approx. 70 kDa. These approx. 70 kDa PCM proteins can consist mainly of PCM1, as suggested by our biochemical data, or they can contain various PCM proteins very similar in sizes, a notion consistent with our assignment of ORFs and the predicted proteins thereof. 3.7. Predicted amino-acid sequences and corresponding protein motifs of the PCM family Database searches with sequences of the PCM family did not reveal any strong candidates for homologs as of writing, suggesting that they are novel proteins. However, they share similar protein motifs, with all members of the family expected to contain putative

28

C.W.M. Chan et al. / Gene 231 (1999) 21–32

Fig. 4. Southern and Northern hybridizations showing the number of members in the PCM family and the size of their mRNA. (a) Southern hybridization. About 10 mg each of Paramecium genomic DNA was digested with the restriction enzymes ClaI (Lane 1) and BglII (Lane 2), separated by agarose gel electrophoresis, transferred onto nitrocellulose membrane, and hybridized to 32P-labeled k0.6. The resulting autoradiograph shows four or more hybridizing bands ( judging from the relative intensities of bands, the second band from the top in Lane 2 can be interpreted as a doublet), suggesting that there are at least four members in the PCM family. This interpretation is consistent with our cloning data which include sequences of four members of the PCM family ( Their sequences indicate that ClaI and BglII do not have restriction sites within the regions that hybridize to k0.6). (b) Northern hybridization. Approx. 15 mg of oligo-dT purified mRNA was separated by agarose gel electrophoresis in the presence of formamide, transferred onto uncharged nylon membrane, and hybridized to 32Plabeled k0.6. The autoradiograph shows one major hybridizing band at approx. 1.9 kb, which may represent the mRNA of the major expressed protein from the PCM family or several mRNA species of very similar sizes.

transmembrane domains, potential basic amphiphilic alpha (BAA) helices, cysteine-rich regions, and putative b/c-crystallin domains ( Fig. 3 and see below). Members of the PCM family have very similar predicted hydrophilicity/hydrophobicity profiles. Two of the hydrophobic segments in PCM1 can be considered as potential transmembrane domains (residues 89–108 and 139–155), and they are also conserved in other members of the family (residues 33–49 in PCM2, residues 280–299 and 330–346 in PCM3, and residues 382– 401 and 432–448 in PCM4). The unique N-terminal region of PCM4 contains an extra hydrophobic segment (residues 4–30) that may represent an additional transmembrane segment. The PCM family also contains several potential BAA helices. BAA helical regions tend to form a-helices with positively charged amino acids facing one side of the helix and hydrophobic ones on the other side, and they have been found to be the major CaM-binding determinant in a variety of CaM-binding proteins (Crivici and

Ikura, 1995). PCM1 is a CaM-binding protein and contains at least two putative BAA helices, residues 17– 40 and 208–233. These two putative BAA helices are conserved correspondingly in PCM3 (residues 209–232 and residues 399–424) and PCM4 (residues 311–334 and residues 501–526), and PCM2 appropriately contains the more C-terminal one (residues 102–127) ( Fig. 3). In addition, PCM4 appears to contain another potential BAA helix (residues 57–80). Two types of cysteine-rich regions are found in the PCM proteins. The Type I cysteine-rich region contains 20% cysteines in a window of 30 amino acids, and is in equivalent positions in PCM1 (residues 68–97), PCM3 (residues 259–283) and PCM4 (residues 361–390), respectively (double-headed arrows in Fig. 3). PCM3 and PCM4 contain an additional type of cysteine-rich region that is N-terminal to the first (residues 83–91 of PCM3 and residues 185–201 of PCM4). This Type II cysteine-rich region contains four cysteines in a window of 17 amino acids (or approx. 24% cysteines). The position and spacing of the cysteines in the two types of cysteine-rich regions are absolutely conserved. The presence of conserved cysteine-dense regions in proteins that are not particularly cysteine-rich (4% or less cysteine residues overall ) argues for their functional significance. Another kind of protein motif present in the PCM family is the b/c-crystallin domain. b- and c-crystallins belong to the same protein superfamily and were discovered as two of the major classes of lens proteins in vertebrates. However, some b-crystallins are expressed at lower levels in tissues other than the lens, such as the retina. Non-lens members of the b/c-crystallin superfamily have also been found in a variety of organisms ( Ray et al., 1997). All members of the family share a conserved domain containing two homologous motifs. Each of these motifs consists of four b strands folded into a characteristic ‘Greek key’ pattern (Bagby et al., 1994). The C-terminal (or presumed C-terminal ) regions of all members of the PCM family (shaded bars in Fig. 3) share significant sequence similarities with members of the b/c-crystallin family. For example, the amino-acid identities between the C-terminal regions of the PCM family and various mammalian c-crystallins are approx. 30%, similar to the sequence identities shared between b- and c-crystallins. Furthermore, the alignment of these C-termini with selected members of the b/c-crystallin family (Fig. 5) shows that they contain all the conserved residues important for the structural integrity of the b/c-crystallin domain ( Y6, Y10, G13, and S36 in each motif of PCM1, shaded residues in Fig. 5). Of particular importance is the conservation of G13 because it plays a crucial role in maintaining the characteristic b hairpin formed by the first two b strands of the ‘Greek key’ motif (Bagby et al., 1994). These putative b/c-crystallin domains of the PCM family are also predicted to be mainly b in secondary structure (e.g., Protean of

C.W.M. Chan et al. / Gene 231 (1999) 21–32

29

Fig. 5. b/c-Crystallin domains. The alignment of the putative b/c-crystallin domains of the PCM family with the corresponding domains of selected members of the b/c-crystallin family is shown. Based on published structural data and models, the first four entries are aligned manually according to structurally important residues (shaded ), and residues that make up the four known b sheets (underlined). Conserved core hydrophobic residues, marked with filled circles above ($), are also taken into consideration. The C-terminal regions of PCM1–4 are then aligned accordingly. The alignment shows that every member of the PCM family contains all of the conserved elements of typical b/c-crystallin domains. Moreover, residues 260–266, 293–297, 303–308, 317–319, and 332–336 of PCM1 (and corresponding residues from PCM2–4) are predicted to form b sheets by various secondary structure prediction programs (e.g., PROTEAN from DNASTAR, PSSP from the Baylor College of Medicine, and PHD from EMBLHeidelberg), and they correspond to assigned b sheets of other members of the b/c-crystallin family. c-Crystallin II and b-crystallin B2 are major lens proteins in bovine, Protein S is a major spore coat protein in Myxococcus xanthus (a soil bacterium), and Spherulin 3A is a major encystment protein in Physarum polycephalum (a slime mold ). Dash lines indicate gaps introduced to optimize alignment. Residue positions are indicated on the side.

DNASTAR, PSSP from the Baylor College of Medicine and PHD from EMBL-Heidelberg) and can indeed be modeled as several anti-parallel b sheets (data not shown; SWISS-MODEL at ExPASy), consistent with structural data on other members of the b/c-crystallin family (Bagby et al., 1994; Rosinke et al., 1997).

4. Discussion 4.1. PCM1: a CaM-binding membrane protein in cilia of Paramecium Our knowledge of Ca2+/CaM-regulated processes through membrane-associated proteins lags behind that via their cytosolic counterparts. Therefore, it is important to identify and characterize membrane-bound participants of Ca2+/CaM-modulated pathways. In the model system Paramecium, we have identified and purified a Ca2+-dependent CaM-binding protein, PCM1, from a ciliary membrane-enriched fraction. (Although we purified PCM1 from the ciliary membrane, PCM1 may not be localized exclusively to this membrane and may indeed be present in other surface membranes. C.W.M. Chan, unpublished results). PCM1 was also present in highly purified ciliary membrane vesicles, obtained by physically disrupting the surface membrane from cilia and subsequently isolating the membrane vesicles by centrifugation in a sucrose gradient (Adoutte et al., 1980), but not in the cytosolic fraction. Therefore,

PCM1 is consistently associated with the membrane fraction despite being prepared by different methods. Moreover, PCM1 remains associated with the membrane fraction after high salt washes (up to approx. 0.4 M NaCl ), a procedure typically used to separate peripherally-associated membrane proteins from membranebound proteins (data not shown), indicating that PCM1 is an integral membrane protein, or is tightly associated with the membrane. PCM1 is one of the major CaM-binding proteins in the ciliary membrane and binds CaM at near physiological Ca2+ concentrations (approx. 10 mM ). Its affinity for CaM is comparable to other high affinity CaMbinding proteins such as calcineurin and cyclic nucleotide phosphodiesterase (see Section 3.1). Although the location of the CaM-binding site(s) within PCM1 has yet to be experimentally determined, present data strongly suggest that PCM1 is a physiologically relevant CaM target protein in vivo. 4.2. The PCM protein family Based on the peptide sequences of PCM1, we cloned the genes for a family of PCM proteins, PCM1–4. The protein encoded by k0.6 may also belong to the PCM family, although at present we do not know whether it shares the same protein motifs found in all other members of the family. The results from genomic Southern hybridization experiments support the existence of at least four members in the PCM family (Fig. 4a). The

30

C.W.M. Chan et al. / Gene 231 (1999) 21–32

three sequenced peptides of PCM1 is found in the conceptual translation of only one of the four DNA clones described in this study (pck1.1), whereas the other three clones contain various conserved substitutions in their corresponding regions. Therefore, pck1.1 is the partial cDNA clone for PCM1, covering approx. 60% of the predicted length of the protein. Moreover, we have the partial coding sequences for PCM2 and PCM4 (covering approx. 40% and approx. 90% of their respective proteins), and the entire gene for PCM3. The coding region for PCM3 is approx. 1.8 kb, in good agreement with the approx. 1.9 kb mRNA species detected in our Northern hybridization analysis (Fig. 4b). Since all PCM proteins are predicted to be similar in sizes, the approx. 1.9 mRNA band may represent the expression of several PCM proteins, including the two for which cDNA clones have been obtained, PCM1 and PCM2. On the other hand, since PCM1 is likely to have the highest expression level among various members of the PCM family, as evidenced by our biochemical and peptide sequencing data, this mRNA band may consist mainly of the message for PCM1. All members of the PCM family have very similar conceptual translations (approx. 85% identical ). They all contain conserved protein motifs, potential CaMbinding domains and putative transmembrane segments. No candidates for homologs of the PCM family in other organisms have yet been reported. In particular, the PCM family of proteins do not share significant sequence similarities with the handful of membrane-bound CaMbinding proteins identified to date, nor with other CaMdependent enzymes (Crivici and Ikura, 1995; Tripathy et al., 1995; Molday, 1996; Scott et al., 1997; Xia et al., 1998; Zhang et al., 1998). Furthermore, they do not have any identifiable catalytic domain or substratebinding site of any characterized enzyme. They also do not contain any recognizable ion channel structure, nor do they belong to any of the known classes of membraneassociated structural proteins. Thus, the genes identified here seem to be truly novel, and likely encode a new family of CaM-binding membrane proteins. 4.3. Protein motifs for protein–protein interaction and multimer formation, and implications for Ca2+/CaM signal transduction The PCM family contains recognizable protein motifs that may give clues to their function(s). All PCM proteins are predicted to contain putative b/c-crystallin domains at their C-terminal (or presumed C-terminal ) regions (Figs. 3 and 5). These C-terminal regions share significant sequence similarity with other members of the b/c-crystallin superfamily, contain all the conserved and structurally important residues for the domain, and are predicted to form several b sheets (Section 3.7). Structural studies on b- and c-crystallins indicate that

the two homologous b/c-crystallin domains interact through some of their component b strands, contributing to the characteristic structural stability of c-crystallins and dimer formation among various b-crystallins (Bagby et al., 1994). Dimers of b-crystallins can further associate to form different populations of homo- and hetero-oligomers under various conditions (Slingsby and Bateman, 1990). Non-lens members of the b/c-crystallin family, such as Protein S in Myxococcus xanthus and Spherulin 3A in Physarum polycephalum, are also known to form homomultimers (Rosinke et al., 1997; Bagby et al., 1994). We propose that in PCM1–4, their C-terminal regions are folded into ‘Greek key’ motifs through which they interact with each other and multimerize, similar to other members of the b/c-crystallin superfamily. Various members of the PCM family (and possibly other proteins bearing similar b/c-crystallin motifs) may be co-expressed and can then form a variety of homomultimers and even heteromultimers. If the expression of PCM family members is alternatively regulated, different populations of homomultimers may be formed according to their modes of regulation. The PCM proteins of Paramecium are part of an expanding group of non-lens members of the b/c-crystallin superfamily, and they seem to have a general role of managing cellular differentiation and morphological changes. For instance, Protein S and its homolog Protein S1 from M. xanthus (Bagby et al., 1994) and Spherulin 3A from P. polycephalum (Rosinke et al., 1997) are induced under adverse environmental conditions that lead to dormancy. EDSP (epidermis differentiationspecific protein) from Cynops pyrrhogaster and AIM1 (absent in melanoma) from a model of human melanoma ( Ray et al., 1997) are expressed in tissues with ectodermal origins, are possibly associated with the cytoskeleton and may have roles in managing cell morphology and shape. Even in lens, b- and c-crystallins are specifically expressed in differentiating and elongating fiber cells which are undergoing large changes in cellular architecture and composition, and it has been suggested that these proteins may have functions other than their structural role (Ray et al., 1997). By inference, the PCM proteins of Paramecium may belong to a class of Ca2+-sensing molecules that respond to changing environmental conditions and/or developmental stages. One hypothesis is that during increases in internal Ca2+ concentration, CaM binds to PCM1 (and may also bind to PCM1 homologs), which then leads to a change in the conformation of the PCM-containing protein complex or its state/composition of multimerization. This then serves as a mechanism for regulating the function(s) of PCM-containing multimers and subsequently bringing about appropriate physiological changes. In Paramecium, Ca2+/CaM is known to (or likely) participate in a wide range of processes, including cellular morphogenesis, trichocysts discharge, and swimming

C.W.M. Chan et al. / Gene 231 (1999) 21–32

31

Fig. 6. Cysteine-rich regions. The alignment of the consensus sequence of the Type I cysteine-rich regions in the PCM family with the consensus sequence of EGF-like domains is shown. Both consensus sequences are given in the PROSITE format, where ‘x’ stands for any amino acids, ‘a’ stands for aromatic residues, the figure in (n) indicates the number of residues, and the figures in (n,n) indicate the range of the number of residues. Shaded boxes mark the regions where the two consensus sequences agree with each other, showing that the Type I cysteine-rich regions in the PCM family resemble EGF-like domains. Of the two glycines given in the consensus sequence of EGF-like domains, at least one is usually present, and each of the Type I cysteine-rich regions contains one glycine correspondingly.

behavior, and the PCM family of proteins may be an integral part of these signaling/response systems. The Ca2+/CaM-dependent signaling and response pathway through the PCM proteins may be further modulated by other domains in these proteins. One such possibility is the cysteine-rich regions. The Type I cysteine-rich region contains six conserved cysteines in a window of 30 amino acids (20% cysteines). The Type II cysteine-rich region contains four conserved cysteines in a total of 17 residues (approx. 24% cysteines). The conservation of cysteine-dense regions in a protein family that is otherwise not cysteine-rich suggests that these regions are of functional significance. Of particular interest is the Type I cysteine-rich region, which is reminiscent of an epidermal growth factor (EGF )-like domain, as shown in Fig. 6. The EGF-like domain was first found in EGF and subsequently in the extracellular domains (or putative extracellular domains) of a variety of membrane-bound or secreted proteins. In EGF the six cysteines are disulfide-bonded in a (1–3, 2–4, 5–6) pattern, resulting in a tri-stranded b sheet structure (Rebay et al., 1991). The function of the domain is still under investigation. In certain cases, however, it has been shown to mediate protein–protein interaction, as in the example of EGF binding to its receptor, and cell surface interactions of the neurogenic proteins Notch and Delta in Drosophila (Rebay et al., 1991). It is possible that the six cysteines in the Type I cysteine-rich region are disulfide-bonded in a pattern analogous to that in EGF, implying a similar protein folding pattern and even a role in interacting with yet unidentified ligands or proteins on the cell surface. The resulting tertiary structure and/or interaction with ligands and proteins may be important for the activities of PCMcontaining protein complexes.

5. Summary and future directions We have discovered a new family of membranebound, Ca2+-dependent CaM-binding proteins, and have obtained the genes for four members of this family, PCM1–4. Although only the gene for PCM3 is complete, the partial coding sequences for other members of the PCM family also contain all the protein motifs shared among the family. Thus, current data have revealed the essence of the PCM family: a collection of closely related

proteins with characteristic protein–protein interaction domains, and they participate in Ca2+/CaM signal transduction. The PCM proteins represent new membrane-associated transducers of Ca2+/CaM-dependent cascades, and it is important to further analyze these proteins, particularly with regard to how they propagate the Ca2+/CaM signal. Biochemical analyses concerning the details of CaM binding to PCM1 and its homologs and the conditions for multimerization are most interesting. Immunological and Western blot studies using antibodies generated against the PCM family of proteins will provide information on their expression and sub-cellular localization, and whether these parameters change with varying environmental and cellular conditions. In Paramecium, we can also investigate the in vivo function(s) of the PCM family by altering their expression levels, which can be achieved through microinjecting appropriate DNA fragments (Haynes et al., 1996; Meyer and Duharcourt, 1996; Ruiz et al., 1998). Ca2+/CaM is vital in regulating membrane-associated signal transduction processes. However, the details on how Ca2+/CaM and its associated proteins participate in these signaling cascades await more extensive studies. On-going and future research of the PCM family will enhance our understanding of Ca2+/CaM signal transduction in Paramecium, and will likely shed light on the subject in other organisms as well.

Acknowledgements We thank Professor J.E. Schultz for providing Paramecium culture and the resulting cilia preparation, and Professor J. Forney for providing the Paramecium genomic DNA library. We also thank L. Olds for aid in preparing the figures, and the staff of the W.M. Keck Biotechnology Center for their expert technical service. This work is supported by NIH GM22714, GM36386, and the W.F. Vilas Trust.

References Adoutte, A., Ramanathan, R., Lewis, R.M., Dute, R.R., Ling, K.Y., Kung, C., Nelson, D.L., 1980. Biochemical studies of the excitable

32

C.W.M. Chan et al. / Gene 231 (1999) 21–32

membrane of Paramecium tetraurelia. III. Proteins of cilia and ciliary membranes. J. Cell Biol. 84, 717–738. Ausubel, F.M., Brent, R., Kingston, R.E.Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. ( Eds.), Current Protocols in Molecular Biology 1995. John Wiley. Bagby, S., Harvey, T.S., Eagle, S.G., Inouye, S., Ikura, M., 1994. Structural similarity of a developmentally regulated bacterial spore coat protein to beta gamma-crystallins of the vertebrate eye lens. Proc. Natl. Acad. Sci. USA 91, 4308–4312. Clapham, D. E., 1995. Calcium signaling. Cell 80, 259–268. Crivici, A., Ikura, M., 1995. Molecular and structural basis of target recognition by calmodulin. Annu. Rev. Biophys. Biomol. Struct. 24, 85–116. Elwess, N.L., Van Houten, J. L., 1997. Cloning and molecular analysis of the plasma membrane Ca(2+)-ATPase gene in Paramecium tetraurelia. J. Euk. Microbiol 44, 250–257. Evans, T.C., Nelson, D. L., 1989. The cilia of Paramecium tetraurelia contain both Ca2+-dependent and Ca2+-inhibitable calmodulinbinding proteins. Biochem. J. 259, 385–396. Gross, C.A., Grossman, A.D., Liebke, H., Walter, W., Burgess, R.R., 1984. Effects of the mutant sigma allele rpoD800 on the synthesis of specific macromolecular components of the Escherichia coli K12 cell. J. Mol. Biol. 172, 283–300. Haynes, W.J., Ling, K.-Y., Saimi, Y., Kung, C., 1996. Toward cloning genes by complementation in Paramecium. J. Neurogenet. 11, 81–98. Hubbard, M.J., Klee, C.B., 1987. Calmodulin binding by calcineurin. Ligand-induced renaturation of protein immobilized on nitrocellulose. J. Biol. Chem. 262, 15062–15070. Jerka-Dziadosz, M., Garreau de Loubresse, N., Beisson, J., 1992. Development of surface pattern during division in Paramecium. II. Defective spatial control in the mutant kin241. Development 115, 319–335. Kerboeuf, D., Le Berre, A., Dedieu, J.C., Cohen, J., 1993. Calmodulin is essential for assembling links necessary for exocytotic membrane fusion in Paramecium. EMBO J. 12, 3385–3390. Kink, J.A., Maley, M.E., Ling, K.Y., Kanabrocki, J.A., Kung, C., 1991. Efficient expression of the Paramecium calmodulin gene in Escherichia coli after four TAA-to-CAA changes through a series of polymerase chain reactions. J. Protozool. 38, 441–447. Klein, P., Kanehisa, M., DeLisi, C., 1985. The detection and classification of membrane-spanning proteins. Biochim. Biophys. Acta 815, 468–476. Kung, C., Preston, R.R., Maley, M.E., Ling, K.Y., Kanabrocki, J.A., Seavey, B.R., Saimi, Y., 1992. In vivo Paramecium mutants show that calmodulin orchestrates membrane responses to stimuli. Cell Cal. 13, 413–425. Ling, K.Y., Maley, M.E., Preston, R.R., Saimi, Y., Kung, C., 1994. New non-lethal calmodulin mutations in Paramecium. A structural

and functional bipartition hypothesis. Eur. J. Biochem. 222, 433–439. Meyer, E., Duharcourt, S., 1996. Epigenetic regulation of programmed genomic rearrangements in Paramecium aurelia. J. Euk. Microbiol. 43, 453–461. Molday, R.S., 1996. Calmodulin regulation of cyclic-nucleotide-gated channels. Curr. Opin. Neurobiol. 6, 445–452. Ray, M.E., Wistow, G., Su, Y.A., Meltzer, P.S., Trent, J.M., 1997. AIM1, a novel non-lens member of the betagamma-crystallin superfamily, is associated with the control of tumorigenicity in human malignant melanoma. Proc. Natl. Acad. Sci. USA 94, 3229–3234. Rebay, I., Fleming, R.J., Fehon, R.G., Cherbas, L., Cherbas, P., Artavanis-Tsakonas, S., 1991. Specific EGF repeats of Notch mediate interactions with Delta and Serrate: implications for Notch as a multifunctional receptor. Cell 67, 687–699. Rosinke, B., Renner, C., Mayr, E.M., Jaenicke, R., Holak, T.A., 1997. Ca2+-loaded spherulin 3a from Physarum polycephalum adopts the prototype gamma-crystallin fold in aqueous solution. J. Mol. Biol. 271, 645–655. Ruiz, F., Vayssie, L., Klotz, C., Sperling, L., Madeddu, L., 1998. Homology-dependent gene silencing in Paramecium. Mol. Biol. Cell. 9, 931–943. Russell, C.B., Fraga, D., Hinrichsen, R.D., 1994. Extremely short 20–33 nucleotide introns are the standard length in Paramecium tetraurelia. Nucleic Acids Res. 22, 1221–1225. Saimi, Y., Kung, C., 1994. Ion channel regulation by calmodulin binding. FEBS Lett. 350, 155–158. Schultz, J.E., Klumpp, S., Hinrichsen, R.D., 1990. . In: O’Day, D.H. ( Ed.), Calcium as an Intracellular Messenger in Eukaryotic Microbes. American Society for Microbiology, Washington, DC, pp. 124–150. Scott, K., Sun, Y., Beckingham, K., Zuker, C. S., 1997. Calmodulin regulation of Drosophila light-activated channels and receptor function mediates termination of the light response in vivo. Cell 91, 375–383. Slingsby, C., Bateman, O.A., 1990. Quaternary interactions in eye lens beta-crystallins: basic and acidic subunits of beta-crystallins favor heterologous association. Biochemistry 29, 6592–6599. Tripathy, A., Xu, L., Mann, G., Meissner, G., 1995. Calmodulin activation and inhibition of skeletal muscle Ca2+ release channel (ryanodine receptor). Biophys. J. 69, 106–119. Xia, X.M., Fakler, B., Rivard, A., Wayman, G., Johnsonpais, T., Keen, J.E., Ishii, T., Hirschberg, B., Bond, C.T., Lutsenko, S., Maylie, J., Adelman, J.P., 1998. Mechanism of calcium gating in small-conductance calcium-activated potassium channels. Nature 395, 503–507. Zhang, S., Ehlers, M.D., Bernhardt, J.P., Su, C.T., Huganir, R.L., 1998. Calmodulin mediates calcium-dependent inactivation of N-methyl-D-aspartate receptors. Neuron 21, 443–453.