- Email: [email protected]
A new vector, pGID052, for genetic transfer in Oenococcus oeni
FEMS Microbiology Letters 236 (2004) 53–60 www.fems-microbiology.org
A new vector, pGID052, for genetic transfer in Oenococcus oeni Charlotte Beltramo, Mona Oraby, Gerald Bourel, Dominique Garmyn, Jean Guzzo
*
Laboratoire de Microbiologie, UMR-UB-INRA 1232, ENSBANA, 1 Esplanade Erasme, 21000 Dijon, France Received 27 November 2003; received in revised form 2 March 2004; accepted 15 May 2004 First published online 31 May 2004
Abstract Despite the large number of techniques available for the transformation of bacteria, several species are still resistant to the introduction of foreign DNA. Oenococcus oeni are among the organisms that are particularly refractory to transformation. However, conjugal experiments from Lactococcus lactis to O. oeni with a new plasmid, pGID052, were performed via mobilization with success. This plasmid, a derivative of pORI19, encompasses: (i) the oriT of pIP501, which permitted the transfer to O. oeni, (ii) the replication genes of a native Leuconostoc citreum plasmid. Frequencies of 107 conjugants per recipient were found. The transfer did not affect the structure of this low-copy-number plasmid. Moreover, pGID052 seems segregationally stable and could be used in the future as an expression vector. Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Lactic acid bacteria; Oenococcus oeni; Conjugal transfer; Mobilization; Shuttle vector
1. Introduction Oenococcus oeni, formerly called Leuconostoc oenos [1], is a lactic acid bacterium most often responsible for malolactic fermentation in wine and tolerant to various stresses. O. oeni, which is introduced into starter cultures, is able to grow after alcoholic fermentation in acid conditions and in the presence of high ethanol concentrations. The study of the stress tolerance of O. oeni [2] or other interesting pathways [3–5] could be useful for a better understanding of malolactic fermentation. Despite the increase in the molecular studies on this species, like the characterisation of the expression pattern of several stress genes [6–9], analyses were hampered due to the lack of a genetic transfer tool. Transformation by electroporation of O. oeni has been described [10] but the described procedure appeared to be difficult to reproduce. Two studies have dealt with conjugal transfer in O. oeni [11,12]. These works have set up methods and parameters to obtain reproducible conjugal frequencies. However, even if two conjugative transposons (Tn916 *
Corresponding author. Tel./fax: +33-3-80-39-66-75. E-mail address: [email protected] (J. Guzzo).
and Tn925) or plasmids of the family pAMb1/pIP501 were transferred, they could be used only in particular cases. Indeed, the transposons were not integrated randomly [11] and the plasmids pIP501 and pVA797 presented structural instability and were too big for easy genetic manipulation [12]. To our knowledge, no suitable vector allowing genetic study has been developed for O. oeni until now. In order to set up such a method, conjugal transfer in O. oeni was investigated with particular attention to the transferred plasmid. The present study reports the development of a new plasmid, called pGID052, transferred with success by mobilization from Lactococcus lactis to O. oeni.
2. Materials and methods 2.1. Bacterial strains The bacterial strains and plasmids used in this study are listed in Table 1. The O. oeni recipient strains were grown on FT80 medium modified by addition of meat extract instead of casaminoacids (pH 5.3) at 30 °C [13]. The donor strains were grown on
0378-1097/$22.00 Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsle.2004.05.029
54
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
Table 1 Strains and plasmids used in this study Species
Strain
Description
Plasmid content
References
Strains Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Leuconostoc citreum Enterococcus faecalis Lactococcus lactis Lactococcus lactis Escherichia coli
8413 8417 8403 GM 23277 M1 107 20252 20255 20257 22R JH22 MG1363 DG52 EC101
VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type Wild-type Derivative of NCDO712 Derivative of NCDO712 KmR , JM101 derivative carrying a single copy of pWV01 repA gene in glgB
pLO13 (3.9 kb) None None None pUBL05 (4.3 kb) pUBL03 (3.9 kb) None None pUBL02 (4.3 kb) None pLC22R None None pVA797, pGID052 None
IOB, [27] IOB, [32] IOB, [32] IOB, [32] ATCC, [32] LOUB, [32] ENSBANA, [32] DSMZ, [32] DSMZ, [32] DSMZ, [32] CNRZ collection [23] [33] This work [24]
Size (kb)
Description
References
2.69 2.23 2.74 2.28 5.66
AmpR , lacZ EmR /LmR , Oriþ RepA- a-lacZ, derivative of pWV01 EmR /LmR , oriT of pIP501 in EcoRI–BamHI of pUC19 EmR /LmR , oriT of pIP501 in StuI of pORI19 EmR /LmR , 3.38 kb HindIII DNA fragment of pLC22R, oriR of pLC22R
[34] [24] This work This work This work
Plasmids PUC19 PORI19 PGID700 PGID701 PGID052
Van: vancomycin, Amp: ampicillin, Em: erythromycin, Lm: lincomycin, Km: kanamycin. DSMZ: Deutsche Sammlung von Mikroorganismen und Zelkulturen, ATCC: American Type Culture Collection. CNRZ: Centre National de Recherches Zootechniques. NCDO: National Collection of Food Bacteria, formerly the National Collection of Dairy Organisms. IOB: Institute of Oenology, Bordeaux university, France, LOUB: Lab of Oenology, Burgundy University, France. ENSBANA: Ecole Nationale Superieure de Biologie Appliquee a la Nutrition et a l’Alimentation, France.
M17 medium [14] in which glucose (5 g l1 ) replaced lactose at 30 °C for Lactococcus lactis or 37 °C for Enterococcus faecalis. Media were supplemented as necessary with antibiotics added to the following final concentrations: chloramphenicol 5 lg ml1 , vancomycin 20 lg ml1 , lincomycin 20 lg ml1 and erythromycin 20 lg ml1 . 2.2. Mating procedure Mating experiments between donors and O. oeni were performed on solid surface as described previously [11], with the following modifications: the medium for culture of recipient strains was the modified FT80 (FT80m) broth. The mating filters were placed on non-selective FT80m agar plates and incubated 4 h at 30 °C. Transconjugants were selected on FT80m agar plates containing vancomycin, used for O. oeni selection, and erythromycin/lincomycin, used for transferred plasmid selection. Recipient CFU counting was done on FT80m supplemented with vancomycin and donor CFU on M17 plates with erythromycin and lincomycin. Transfer frequencies are expressed as the number of transconjugants per recipient colony forming unit (CFU) after the mating period.
2.3. Plasmid segregational stability Transconjugants strains were grown at 30 °C in the presence of erythromycin, lincomycin and vancomycin as selective antibiotics. The segregational stability of pGID052 plasmid under non-selective conditions was tested. Each 24 h, the overnight culture was diluted 1:70 into fresh, antibiotic-free FT80m broth to determine plasmid stability during continuous exponential growth phase. At 48 h intervals (corresponding to approximately 12 generations), samples were removed and dilutions were spread plated for single colonies onto selective and non-selective FT80m agar. The same procedure was repeated until 100 generations were reached. 2.4. DNA procedures Genomic DNA was extracted according to the method described by Sambrook et al. [15]. The Alkaline lysis was used for plasmid extraction [16]. In both cases, samples were pre-treated with 20 mg ml1 lysozyme for 30 min at 37 °C. Restriction enzymes were purchased from Invitrogen. The amplifications of DNA were performed by PCR technique using Taq polymerase (Qbiogen) and a
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
thermocycler Eppendorf Mastercycler with appropriate primers (Table 2) using the following program: initial denaturation at 92 °C for 5 min, 30 cycles of 92 °C for 30 s, 55 °C for 20 s and 72 °C for 60 s and a final extension step at 72 °C for 5 min. Electroporation of L. lactis was performed using a Bio-Rad Gene Pulser apparatus as described by Platteeuw et al. [17]. Southern hybridizations were performed as described by Sambrook et al. [15]. DNA was separated in a 0.8% agarose gel. The nucleic acids were transferred to NytranN membranes (Schleicher and Schuell) by capillarity. The probe was obtained by pGID052 plasmid extraction from E. coli and digestion by EcoRI. The probe was radiolabelled using a Random-primer DNA labelling system kit (Invitrogen) with [a-32 P]dATP purchased from Perkin–Elmer. 2.5. Cell preparation and electroporation of O. oeni O. oeni 8413 was inoculated into 500 ml FT80m broth supplemented with 0.4 M sorbitol and 1% glycine and incubated at 30 °C to OD600 ¼ 0.4. The cells were har-
55
vested by centrifugation, washed four times with 500 ml of sterile incubation buffer (5 mM potassium phosphate, 1 mM MgCl2 , 4 M sorbitol and 10% glycerol, pH 4.8). Then, the cells were gently resuspended in 0.5 ml of buffer (10% P.E.G. 3000, 10% glycerol) and 100 ll of the solution was mixed together with 1 lg of plasmid DNA, transferred to a sterile 2-mm Gene Pulser cuvette (Eurogentec) and left on ice for 30 min. Electroporation was performed with a Bio-Rad pulse gene controller (25 lF, 200 ohm at 1600 V cm1 ). The cells were immediately rescued into 0.5 ml of FT80m supplemented with 0.4 M sorbitol and incubated for 2 h at 30 °C and plated onto FT80m containing erythromycin and lincomycin. 2.6. Relative-copy-number determination Genomic DNA was diluted in sterile water and 5 ll of each dilution was added to 20 ll of PCR mixture, which contained 12.5 ll of Master mix (Eurogentec), 1 ll of each primer at 7 pM and 5.5 ll of sterile water. Appropriate primers (Table 2) were designed to amplify and quantify specific plasmidic and chromosomal DNA fragments in a real-time PCR assay.
Table 2 Primers used in this work Primer pair name
Sequence (50 –30 )
Function (target)
Source or Accession Number
Rm19-Rev
CCTGCCTTTTTTGTAGCAGA CACAGGAAACAGCTATGACC CGTGGAATACGGGTTTGCTA CTCTTGGAACCATACTTAATATAG TGGTCGGGAATTTCTTTATGC CCAAGAGAAAAAACTATG T CGAGGTGACATAACGTATGAA GCTATAAGTAGTTTGCTGATTAA CGAGAGGTAAATGTAGCATTG CGTCTGCAATCATTCCTTCATT GCATTTAACGACGAAACTGGC GAAACTGTAGAATATCTTGGTG GCAATTATGGAAGTTGTAAATAA CAGATTCAGTCCAAATGTTAG GCCGCAGTAAAGAACTTGATG TGCCGACAACACCAACTGTTT GGCGCAATCCTTATTCGATT CCAGCATTTGAAGTAGCGATT CGCAGGCAGAAAAGAACAATC GCTGAAGACGAAGCAGTTGC GTGTGAACCAAAAACCAGGAC GATTAGAAGCAATTACAAAAATAC CCAGACAAGGCAATCAAAGG GTTGCATCATTAGAAAGTCCC CCCAACTTTGAGTGAAGCAA CACCACGAGCATCATATTCA GATTACCGTCCTAACGCAGT GCCACATCGTCAATGCCAC CATTTCTGATTCTTTATTGGCAC GAAATCATTAAAACACGCAGAAG CGTGATATCCACTACACTAAG GTTGGGACATTCGTTGCTCA
Q-RT-PCR (pGID052)
AJ628448
Q-RT-PCR (pGID052)
AJ628448
Q-RT-PCR (pGID052)
AJ628448
Q-RT-PCR (pVA797 and pIP501)
X65462
Q-RT-PCR (pVA797 and pIP501)
L39769
Q-RT-PCR (pIP501)
U00453
Q-RT-PCR (pVA797)
X65462
Q-RT-PCR (O. oeni chromosome)
[35]
Q-RT-PCR (O. oeni chromosome)
Our lab
Q-RT-PCR (O. oeni chromosome)
Our lab
Q-RT-PCR (L. lactis chromosome)
AY236961
Q-RT-PCR (L. lactis chromosome)
AY189901
Q-RT-PCR (L. lactis chromosome)
AJ001007
Q-RT-PCR (E. faecalis chromosome)
AJ011113
Q-RT-PCR (E. faecalis chromosome)
AF414352
Q-RT-PCR (E. faecalis chromosome)
AF210458
Ery Rm18C Cat1 Nick Epip Cat2 LdhD ClpL GrpE LdhB OppA AdhE CcpA Div Sig
Q-RT-PCR ¼ quantitative-real-time PCR.
56
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
Chromosomal genes of each strain were chosen as reference (Table 2) in the real-time PCR assay. Amplifications were performed on a Biorad-I-Cycler with the SYBR GreenÒ system. Thermal cycling conditions included the following steps: initial denaturation at 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 30 s. Fluorescence measurements were recorded during each annealing step. Assays were duplicated and three dilutions of DNA were used for CT determination. The specificity of real-time PCR for each primer pair was determined with a melting curve. For each primer pair, the efficiency of real-time amplification was determined by running a standard curve with three dilutions of DNA. A PCR that amplifies the target sequence with 100% efficiency (E) can double the amount of PCR products in each cycle. The efficiency E is calculated by the formula E ¼ ½10ð1=sÞ 1 100 where s is the slope of standard curve. The results were calculated using the comparative critical threshold (DCT ) method in which the amount of target DNA is compared to a reference DNA. The pLC22R and pGID052 nucleotide sequences reported in this paper have been submitted to EMBL/ Genbank databases under Accession Number AJ493278 and AJ628448 respectively.
selection. In the two species, whose could be used as donors, the plasmid pIP501 was demonstrated to be able to replicate [18,19]. Each conjugation was carried out two to four times. After filter mating, potential transconjugants were selected on plates containing vancomycin, lincomycin and erythromycin. The selection with these antibiotics allowed us to eliminate the spontaneous mutants. No erythromycin or lincomycin resistant mutants were obtained in control assays. Likewise, no vancomycin-resistant mutants were obtained with donor cells. Frequencies obtained in case of transfer from E. faecalis to O. oeni were given in Table 3, confirming that there is some variability between different strains of O. oeni. Frequencies of the same order were obtained with L. lactis as the donor strain (data not shown). Only the strains with frequencies higher than 107 conjugants per recipient were used for further conjugation experiments. Among the 10 strains, strains 8413, 8417, GM and M1 had such frequencies. For these four strains, conjugations were done four times. These frequencies were close of which found in other studies by conjugation in Leuconostoc sp. [18] and O. oeni [11,12]. It could be noted that frequencies drop dramatically when the optical density, that is to say the age of the culture, exceeded 0.3 at 600 nm, as described by Zu~ niga et al. [11]. Evidence for transfer of the antibiotic resistant plasmid in O. oeni transconjugants was confirmed by PCR. Amplifications by PCR with specific primer pair of pIP501 nickase gene (Accession Number AJ628448) and specific primer pair of O. oeni hsp18 gene [20] have been obtained on randomly presumptive conjugants (data not shown). The segregational stability of the plasmid was analysed by growing O. oeni transconjugants in antibiotic-free medium, then by counting viable cells and determining percentages of resistant cells. This plasmid exhibited instability, whose loss rate could be calculated as described by Boe and Rasmussen [21].
3. Results and discussion 3.1. Conjugal transfer of pIP501 to O. oeni The group of pAMb1 and the pIP501 plasmid have been shown to conjugate with a wide variety of lactic acid bacteria, particularly with Leuconostoc [18] or very recently with Oenococcus [12]. Mating experiments were first performed from Enterococcus faecalis and Lactococcus lactis to ten different strains of O. oeni to make a
Table 3 Frequencies of conjugal transfer Donor (plasmid content)
Recipient
Frequency of transfer a (mean SD)
Enterococcus faecalis JH2-2 (pIP501)
O. O. O. O. O. O. O. O. O. O.
2.2 (1.3) 107 2.6 (1.8) 107 1.2 (0.2) 107 1.4 (0.3) 107 0.5 107 0.5 107 0.23 107 NDb NDb NDb
Lactococcus lactis DG52 (pVA797, pGID052)
O. oeni 8413 O. oeni 8417
a
oeni oeni oeni oeni oeni oeni oeni oeni oeni oeni
8417 8413 M1 GM 8403 23277 107 20252 20255 20257
0.9 (0.3) 107 2.4 (0.9) 107
The frequencies of transfer were expressed as the number of transconjugants per recipient CFU after the mating period. Two to four independent experiments were performed for each recipient strain. The standard deviations are given where available. b ND: not detected.
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
57
The plasmid loss rate is described as the probability of a cell division of a plasmid-carrying cell resulting in the birth of a plasmid-free daughter cell and a plasmidcarrying daughter cell. We found a plasmid loss rate of approximately 19%, which confirmed the instability of pIP501 in O. oeni as described by Zu~ niga et al. [12]. This data was also in accordance with the study of Thompson and Collins in Streptococcus sp. [22], in which regions of spontaneous deletions were identified in pIP501. 3.2. Construction of a new shuttle vector pGID052 In order to overcome the limits of size and instability of the pIP501, the construction of a tool for the genetic transfer in O. oeni was performed. As shown in first section, the oriT of pIP501 could be used for conjugation with Oenococcus. A synthetic 49 bp oriT site of pIP501, described by Wang and Macrina [23], was created by annealing two oligonucleotides (50 -AATTCCCGGGTACTAAGGGCGCACTTATACGCAGTAACTTCGTTACTTCGTATTTATCCCGG-30 and 50 GATCCCGGGATAAATACGAAGTAACGAAGTTATCCCGGGATAAATACGAAGTAACGAAGTTACTGCGTATAAGTGCGCCCTTAGTACCCGGG-30 ). This fragment was cloned into EcoRI–BamHI restricted pUC19 giving the plasmid pGID700. The oriT region of plasmid pGID700 was isolated by a SmaI restriction and then inserted into StuI digested pORI19 to give pGID701. Therefore, Plasmid pGID701 could be mobilizable by a plasmid of the family pAMb1/pIP501 [23]. The choice of the plasmid pORI19, a conditional replication vector, was justified by its ability to be replicated via rolling-circle type in an Escherichia coli EC101 strain. This latter is a helper strain in which the repA gene was integrated into the chromosome of the E. coli JM101 strain [24]. On the other hand, we took advantage of the fact that Leuconostoc and Oenococcus are linked phylogenetically. To increase the ability to have transconjugants, a DNA fragment from a native plasmid of Leuconostoc citreum was used. This plasmid, called pLC22R, was completely sequenced, revealing a circular genome of 9935 bp with a total G+C content of 33%. The nucleotide sequence has been submitted to EMBL/Genbank databases under Accession Number AJ493278. The sequence analysis enabled us to identify two ORFs, which showed high identity to a family of known replication genes. Indeed, the deduced products of the two genes shared significant amino acid sequence similarities with replication proteins encoded by plasmids from other Gram-positive genera, including a large number of lactococcal plasmids related to pJW565 [25]. These plasmids replicate via theta mechanism. The first ORF, called repB, shared high identity with RepB protein, an initiator of plasmid replication. The function of the following gene, named orfX, is still unknown but could be related to replication. Finally, a non-coding
Fig. 1. Genetic map of the plasmid pGID052. The components of this vector are: (i) a 2.28 kbp fragment containing the pORI19 vector and the oriT of pIP501 (grey line); (ii) a HindIII fragment encompassing repA, repB, orfX genes of pLC22R (black line). Only relevant restriction sites are shown. Heavy arrows indicate the direction of transcription of the genes.
region, repA, containing the proposed origin of replication, precedes the repB gene. The region repA contained an AT-rich domain followed by a 22-bp iterons, sequence tandemly repeated three and a half times. Thus, a large fragment of 3.38 kbp encompassing replication region of pLC22R containing repA, repB, and orfX was inserted into pGID701 to give pGID052. This shuttle vector retains the following properties: (i) its size of 5.66 kbp, (ii) its double selection by erythromycin and lincomycin (iii) its mobilization by a plasmid of pIP501/ pAMb1 family and (iv) its replication via rolling circle in E. coli or via theta mechanism in Oenococcus. The map of this plasmid is given in Fig. 1. 3.3. Conjugal transfer of pGID052 to O. oeni In order to test mating experiments with the pGID052 plasmid, a conjugative plasmid is necessary to mobilize pGID052. L. lactis DG52 harboring the conjugative plasmid pVA797 was chosen as donor since the pIP501 could not be used for mobilization because it possesses the same antibiotic resistance marker as pGID052. On the contrary, pVA797 plasmid is useful because it only contains a chloramphenicol resistance gene [26]. This strain was used as the donor for the mating experiments with two O. oeni strains, named 8413 and 8417. The 8413 O. oeni strain contains at least one plasmid, called pLo13, from which the replication type was different from the plasmid pGID052. Features commonly found in plasmids that replicate via a rolling-circle mechanism were identified within pLo13 [27]. The replication of pGID052 in Oenococcus was certainly due to the fragment encompassing the replication region of pLC22R. As described above, this latter might replicate via theta mechanism. In addition, to overcome the eventual
58
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
problem due to plasmid incompatibility, the strain 8417 was used since it does not contain any plasmid [28]. Each conjugation by mobilization was repeated four times. The frequencies were about 107 transconjugants for 8413 and 8417 strains (Table 3). These frequencies were close to those obtained with pIP501. Amplifications by PCR with two primer pairs specific to pGID052 (Accession Number AJ628448) and one specific to O. oeni hsp18 gene [20] were obtained (data not shown). Physical evidence of the presence of pGID052 in O. oeni transconjugants was shown by analysis of the restricted plasmid content by agarose gel electrophoresis (data not shown). Southern hybridizations of PstI or EcoRI-restricted genomic DNA (Fig. 2(a)) or plasmidic DNA (Fig. 2(c)) from transconjugants chosen randomly, with pGID052 plasmid as a probe, were realized. Neither chromosomal insertion nor sizeable deletions of pGID052 were detected. The pGID052 plasmid seemed to be stable in the recipient strain, since the transconjugants retained erythromycin and lincomycin resistant phenotype after growth in antibiotic free FT80m for 100 generations. A Southern blot experiment has been realized with restricted DNA extracted from cells after growth in antibiotic-free medium. The results showed that the plasmid was detected without detectable size change (Fig. 2(b)). The second band obtained with digested pGID052 plasmid extracted from E. coli corresponded to single-strand DNA and was due to rolling-circle replication. This phenomenon has already been described in the case of plasmids of the pWV01 family [29].
Extractions of plasmid DNA from O. oeni yielded very few quantities of DNA, suggesting that the copy number of the plasmid was low in that host. To determine it, quantitative real-time PCR was used. This method enables to quantify accurately any DNA sequence to any other. In our case, the number of plasmid was compared to the number of chromosome thanks to amplifications of specific fragments DNA. First, it has been verified that different chromosomal primers pair (Table 2) gave the same CT in L. lactis, E. faecalis and O. oeni. Second, the copy number of plasmid was obtained by calculating the 2DCT between chromosomal amplifications and plasmidic amplifications. For each strain, amplifications were made twice from DNA extracted from two independent cultures. To verify correlation between results with hybridizations and real-time PCR, the pVA797 and pIP501 copy number were determined in L. lactis and E. faecalis with specific primers pair (Table 2). The pVA797 was found at about four copies in L. lactis while pIP501 at about three copies in E. faecalis. These results were similar to those previously obtained by Evans and Macrina in Streptococcus sanguis [26]. Amplifications of pGID052 were made with primer pairs indicated in Table 2. This plasmid is maintained at four copies in L. lactis while it is estimated at around one copy in O. oeni. Interestingly, pGID052 is a verylow-copy number plasmid in both L. lactis and O. oeni strains and it will be used as expression vector for studying accurate promoter activities in vivo thanks to transcriptional fusions [30].
Fig. 2. Presence of the conjugative plasmid pGID052 in transconjugants by Southern blot analysis. (a) Lane 1, 2: Plasmidic DNA extracted from E. coli EC101. Lanes 3, 4: Genomic DNA extracted from three different 8417 O. oeni transconjugant. Lanes 5, 6, 7, 8, 9, 10: Genomic DNA extracted from 8413 O. oeni transconjugant. (b) Lane 1, 2: Plasmidic DNA extracted from E. coli EC101. Lanes 3, 4: Genomic DNA extracted from transconjugant having grown in antibiotic-free medium. (c) Lane 1: Plasmidic DNA extracted from L. lactis DG52. Lanes 2, 3: Plasmidic DNA extracted respectively from 8413 or 8417 O. oeni transconjugant. The DNAs were restricted by EcoRI (a: lanes 1, 3, 5, 7, 8, 9; b: lanes 1, 3; c: lanes 1, 2, 3) or PstI (a: lanes 2, 4, 6, 8, 10; b: lanes 2, 4) and separated in a 0.8% agarose gel by electrophoresis. Southern hybridizations were performed with a radiolabelled pGID052 probe. The experiment was carried out twice.
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
As pGID052 was shown to be transferred and could replicate in O. oeni, we have tried to transfer this plasmid by electroporation as described in Section 2. Unfortunately, all attempts to introduce plasmids into O. oeni using electroporation protocol were unsuccessful. This could be due to the presence of a restriction system in O. oeni. Indeed, during conjugative transfer of plasmids between bacteria, DNA is transferred in the single-strand form. This would suggest that transfer by conjugative means should be little affected by restriction–modification system. Moreover, it has been shown that for Gram positive bacteria like Clostridium difficile, conjugation experiments but not electroporation, allowed genetic transfer [31]. Therefore, the mobilization procedure reported in this paper could be very useful for this species. In conclusion, the plasmid pGID052 has been shown to be helpful for genetic transfer in O. oeni. Ongoing studies will focus on the use of a shuttle vector derived from pGID052 to allow analysis of gene regulation by transcriptional fusions in O. oeni.
Acknowledgements We are grateful to K. Leenhouts for supplying plasmid pORI19 and E. coli EC101 strain. This study was supported by the Ministere de l’Education Nationale de la Recherche et de la Technologie, the Universite de Bourgogne, the Institut national de la recherche agronomique and the Conseil Regional de Bourgogne.
References [1] Dicks, L.M., Dellaglio, F. and Collins, M.D. (1995) Proposal to reclassify Leuconostoc oenos as Oenococcus oeni [corrig.] gen. nov., comb. nov. Int. J. Syst. Bacteriol. 45, 395–397. [2] Guzzo, J., Jobin, M.P., Delmas, F., Fortier, L.C., Garmyn, D., Tourdot-Marechal, R., Lee, B. and Divies, C. (2000) Regulation of stress response in Oenococcus oeni as a function of environmental changes and growth phase. Int. J. Food Microbiol. 55, 27–31. [3] Garmyn, D., Monnet, C., Martineau, B., Guzzo, J., Cavin, J.F. and Divies, C. (1996) Cloning and sequencing of the gene encoding alpha-acetolactate decarboxylase from Leuconostoc oenos. FEMS Microbiol. Lett. 145, 445–450. [4] Leit~ ao, M.C., Teixeira, H.C., Barreto Crespo, M.T. and San Rom~ ao, M.V. (2000) Biogenic amines occurrence in wine. Amino acid decarboxylase and proteolytic activities expression by Oenococcus oeni. J. Agric. Food Chem. 48, 2780–2784. [5] Tonon, T. and Lonvaud-Funel, A. (2000) Metabolism of arginine and its positive effect on growth and revival of Oenococcus oeni. J. Appl. Microbiol. 89, 526–531. [6] Jobin, M.P., Garmyn, D., Divies, C. and Guzzo, J. (1999) The Oenococcus oeni clpX homologue is a heat shock gene preferentially expressed in exponential growth phase. J. Bacteriol. 181, 6634–6641. [7] Jobin, M.P., Garmyn, D., Divies, C. and Guzzo, J. (1999) Expression of the Oenococcus oeni trxA gene is induced by hydrogen peroxide and heat shock. Microbiology 145, 1245–1251.
59
[8] obin, M.P., Delmas, F., Garmyn, D., Divies, C. and Guzzo, J. (1997) Molecular characterization of the gene encoding an 18kilodalton small heat shock protein associated with the membrane of Leuconostoc oenos. Appl. Environ. Microbiol. 63, 609–614. [9] Bourdineaud, J.P., Nehme, B., Tesse, S. and Lonvaud-Funel, A. (2003) The ftsH gene of the wine bacterium Oenococcus oeni is involved in protection against environmental stress. Appl. Environ. Microbiol. 69, 2512–2520. [10] Dicks, L.M.T. (1994) Transformation of Leuconostoc Oenos by electroporation. Biotechnol. Tech. 8, 901–904. [11] Zu~ niga, M., Pardo, I. and Ferrer, S. (1996) Transposons Tn916 and Tn925 can transfer from Enterococcus faecalis to Leuconostoc oenos. FEMS Microbiol. Lett. 135, 179–185. [12] Zu~ niga, M., Pardo, I. and Ferrer, S. (2003) Conjugative plasmid pIP501 undergoes specific deletions after transfer from Lactococcus lactis to Oenococcus oeni. Arch. Microbiol. 180, 367–373. [13] Cavin, J.F., Prevost, H., Lin, J., Schmitt, P. and Divies, C. (1989) Medium for screening Leuconostoc oenos strains defective in malolactic fermentation. Appl. Environ. Microbiol. 55, 751–753. [14] Terzaghi, B.E. and Sandine, W.E. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl. Environ. Microbiol. 29, 807–809. [15] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [16] Birnboim, H.C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1513–1523. [17] Platteeuw, C., Simons, G. and de Vos, W.M. (1994) Use of the Escherichia coli beta-glucuronidase (gusA) gene as a reporter gene for analyzing promoters in lactic acid bacteria. Appl. Environ. Microbiol. 60, 587–593. [18] Pucci, M.J., Monteschio, M.E. and Kemker, C.L. (1988) Intergeneric and intrageneric conjugal transfer of plasmid-encoded antibiotic resistance determinants in Leuconostoc spp. Appl. Environ. Microbiol. 54, 281–287. [19] Langella, P., Le Loir, Y., Ehrlich, S.D. and Gruss, A. (1993) Efficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis. J. Bacteriol. 175, 5806–5813. [20] Jobin, M.P., Delmas, F., Garmyn, D., Divies, C. and Guzzo, J. (1997) Molecular characterization of the gene encoding an 18kilodalton small heat shock protein associated with the membrane of Leuconostoc oenos. Appl. Environ. Microbiol. 63, 609–614. [21] Boe, L. and Rasmussen, K.V. (1996) Suggestions as to quantitative measurements of plasmid loss. Plasmid 36, 153–159. [22] Thompson, J.K. and Collins, M.A. (2003) Completed sequence of plasmid pIP501 and origin of spontaneous deletion derivatives. Plasmid 50, 28–35. [23] Wang, A. and Macrina, F.L. (1995) Streptococcal plasmid pIP501 has a functional oriT site. J. Bacteriol. 177, 4199–4206. [24] Law, J., Buist, G., Haandrikman, A., Kok, J., Venema, G. and Leenhouts, K. (1995) A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes. J. Bacteriol. 177, 7011–7018. [25] Gravesen, A., von Wright, A., Josephsen, J. and Vogensen, F.K. (1997) Replication regions of two pairs of incompatible lactococcal theta-replicating plasmids. Plasmid 38, 115–127. [26] Evans Jr., R.P. and Macrina, F.L. (1983) Streptococcal R plasmid pIP501: endonuclease site map, resistance determinant location, and construction of novel derivatives. J. Bacteriol. 154, 1347–1355. [27] Fremaux, C., Aigle, M. and Lonvaud-Funel, A. (1993) Sequence analysis of Leuconostoc oenos DNA: organization of pLo13, a cryptic plasmid. Plasmid 30, 212–223. [28] Cavin, J.F., Schmitt, P., Arias, A., Lin, J. and Divies, C. (1988) Plasmid profiles in Leuconostoc species. Microbiol. Alim. Nut. 5, 55–62.
60
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
[29] Jeong, J.Y., Yoon, G.M., Seo, H.S., Cho, M.J., Sakai, H., Komano, T. and Bahk, J.D. (1997) Functional features of an ssi signal of plasmid pGKV21 in Escherichia coli. J. Bacteriol. 179, 5795–5801. [30] Poyart, C. and Trieu-Cuot, P. (1997) A broad-host-range mobilizable shuttle vector for the construction of transcriptional fusions to beta-galactosidase in gram-positive bacteria. FEMS Microbiol. Lett. 156, 193–198. [31] Purdy, D., O’Keeffe, T.A., Elmore, M., Herbert, M., McLeod, A., Bokori-Brown, M., Ostrowski, A. and Minton, N.P. (2002) Conjugative transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile through circumvention of the restriction barrier. Mol. Microbiol. 46, 439–452.
[32] Prevost, H., Cavin, J.F., Lamoureux, M. and Divies, C. (1995) Plasmid and chromosome characterization of Leuconostoc oenos strains. Am. J. Enol. Vitic. 46, 43–47. [33] Gasson, M.J. (1983) Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154, 1–9. [34] Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. [35] Beltramo, C., Grandvalet, C., Pierre, F. and Guzzo, J. (2004) Evidence for multiple levels of regulation of Oenococcus oeni clpPclpL locus expression in response to stress. J. Bacteriol. 186, 2200–2205.
A new vector, pGID052, for genetic transfer in Oenococcus oeni Charlotte Beltramo, Mona Oraby, Gerald Bourel, Dominique Garmyn, Jean Guzzo
*
Laboratoire de Microbiologie, UMR-UB-INRA 1232, ENSBANA, 1 Esplanade Erasme, 21000 Dijon, France Received 27 November 2003; received in revised form 2 March 2004; accepted 15 May 2004 First published online 31 May 2004
Abstract Despite the large number of techniques available for the transformation of bacteria, several species are still resistant to the introduction of foreign DNA. Oenococcus oeni are among the organisms that are particularly refractory to transformation. However, conjugal experiments from Lactococcus lactis to O. oeni with a new plasmid, pGID052, were performed via mobilization with success. This plasmid, a derivative of pORI19, encompasses: (i) the oriT of pIP501, which permitted the transfer to O. oeni, (ii) the replication genes of a native Leuconostoc citreum plasmid. Frequencies of 107 conjugants per recipient were found. The transfer did not affect the structure of this low-copy-number plasmid. Moreover, pGID052 seems segregationally stable and could be used in the future as an expression vector. Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Lactic acid bacteria; Oenococcus oeni; Conjugal transfer; Mobilization; Shuttle vector
1. Introduction Oenococcus oeni, formerly called Leuconostoc oenos [1], is a lactic acid bacterium most often responsible for malolactic fermentation in wine and tolerant to various stresses. O. oeni, which is introduced into starter cultures, is able to grow after alcoholic fermentation in acid conditions and in the presence of high ethanol concentrations. The study of the stress tolerance of O. oeni [2] or other interesting pathways [3–5] could be useful for a better understanding of malolactic fermentation. Despite the increase in the molecular studies on this species, like the characterisation of the expression pattern of several stress genes [6–9], analyses were hampered due to the lack of a genetic transfer tool. Transformation by electroporation of O. oeni has been described [10] but the described procedure appeared to be difficult to reproduce. Two studies have dealt with conjugal transfer in O. oeni [11,12]. These works have set up methods and parameters to obtain reproducible conjugal frequencies. However, even if two conjugative transposons (Tn916 *
Corresponding author. Tel./fax: +33-3-80-39-66-75. E-mail address: [email protected] (J. Guzzo).
and Tn925) or plasmids of the family pAMb1/pIP501 were transferred, they could be used only in particular cases. Indeed, the transposons were not integrated randomly [11] and the plasmids pIP501 and pVA797 presented structural instability and were too big for easy genetic manipulation [12]. To our knowledge, no suitable vector allowing genetic study has been developed for O. oeni until now. In order to set up such a method, conjugal transfer in O. oeni was investigated with particular attention to the transferred plasmid. The present study reports the development of a new plasmid, called pGID052, transferred with success by mobilization from Lactococcus lactis to O. oeni.
2. Materials and methods 2.1. Bacterial strains The bacterial strains and plasmids used in this study are listed in Table 1. The O. oeni recipient strains were grown on FT80 medium modified by addition of meat extract instead of casaminoacids (pH 5.3) at 30 °C [13]. The donor strains were grown on
0378-1097/$22.00 Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsle.2004.05.029
54
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
Table 1 Strains and plasmids used in this study Species
Strain
Description
Plasmid content
References
Strains Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Oenococcus oeni Leuconostoc citreum Enterococcus faecalis Lactococcus lactis Lactococcus lactis Escherichia coli
8413 8417 8403 GM 23277 M1 107 20252 20255 20257 22R JH22 MG1363 DG52 EC101
VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type VanR , wild-type Wild-type Derivative of NCDO712 Derivative of NCDO712 KmR , JM101 derivative carrying a single copy of pWV01 repA gene in glgB
pLO13 (3.9 kb) None None None pUBL05 (4.3 kb) pUBL03 (3.9 kb) None None pUBL02 (4.3 kb) None pLC22R None None pVA797, pGID052 None
IOB, [27] IOB, [32] IOB, [32] IOB, [32] ATCC, [32] LOUB, [32] ENSBANA, [32] DSMZ, [32] DSMZ, [32] DSMZ, [32] CNRZ collection [23] [33] This work [24]
Size (kb)
Description
References
2.69 2.23 2.74 2.28 5.66
AmpR , lacZ EmR /LmR , Oriþ RepA- a-lacZ, derivative of pWV01 EmR /LmR , oriT of pIP501 in EcoRI–BamHI of pUC19 EmR /LmR , oriT of pIP501 in StuI of pORI19 EmR /LmR , 3.38 kb HindIII DNA fragment of pLC22R, oriR of pLC22R
[34] [24] This work This work This work
Plasmids PUC19 PORI19 PGID700 PGID701 PGID052
Van: vancomycin, Amp: ampicillin, Em: erythromycin, Lm: lincomycin, Km: kanamycin. DSMZ: Deutsche Sammlung von Mikroorganismen und Zelkulturen, ATCC: American Type Culture Collection. CNRZ: Centre National de Recherches Zootechniques. NCDO: National Collection of Food Bacteria, formerly the National Collection of Dairy Organisms. IOB: Institute of Oenology, Bordeaux university, France, LOUB: Lab of Oenology, Burgundy University, France. ENSBANA: Ecole Nationale Superieure de Biologie Appliquee a la Nutrition et a l’Alimentation, France.
M17 medium [14] in which glucose (5 g l1 ) replaced lactose at 30 °C for Lactococcus lactis or 37 °C for Enterococcus faecalis. Media were supplemented as necessary with antibiotics added to the following final concentrations: chloramphenicol 5 lg ml1 , vancomycin 20 lg ml1 , lincomycin 20 lg ml1 and erythromycin 20 lg ml1 . 2.2. Mating procedure Mating experiments between donors and O. oeni were performed on solid surface as described previously [11], with the following modifications: the medium for culture of recipient strains was the modified FT80 (FT80m) broth. The mating filters were placed on non-selective FT80m agar plates and incubated 4 h at 30 °C. Transconjugants were selected on FT80m agar plates containing vancomycin, used for O. oeni selection, and erythromycin/lincomycin, used for transferred plasmid selection. Recipient CFU counting was done on FT80m supplemented with vancomycin and donor CFU on M17 plates with erythromycin and lincomycin. Transfer frequencies are expressed as the number of transconjugants per recipient colony forming unit (CFU) after the mating period.
2.3. Plasmid segregational stability Transconjugants strains were grown at 30 °C in the presence of erythromycin, lincomycin and vancomycin as selective antibiotics. The segregational stability of pGID052 plasmid under non-selective conditions was tested. Each 24 h, the overnight culture was diluted 1:70 into fresh, antibiotic-free FT80m broth to determine plasmid stability during continuous exponential growth phase. At 48 h intervals (corresponding to approximately 12 generations), samples were removed and dilutions were spread plated for single colonies onto selective and non-selective FT80m agar. The same procedure was repeated until 100 generations were reached. 2.4. DNA procedures Genomic DNA was extracted according to the method described by Sambrook et al. [15]. The Alkaline lysis was used for plasmid extraction [16]. In both cases, samples were pre-treated with 20 mg ml1 lysozyme for 30 min at 37 °C. Restriction enzymes were purchased from Invitrogen. The amplifications of DNA were performed by PCR technique using Taq polymerase (Qbiogen) and a
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
thermocycler Eppendorf Mastercycler with appropriate primers (Table 2) using the following program: initial denaturation at 92 °C for 5 min, 30 cycles of 92 °C for 30 s, 55 °C for 20 s and 72 °C for 60 s and a final extension step at 72 °C for 5 min. Electroporation of L. lactis was performed using a Bio-Rad Gene Pulser apparatus as described by Platteeuw et al. [17]. Southern hybridizations were performed as described by Sambrook et al. [15]. DNA was separated in a 0.8% agarose gel. The nucleic acids were transferred to NytranN membranes (Schleicher and Schuell) by capillarity. The probe was obtained by pGID052 plasmid extraction from E. coli and digestion by EcoRI. The probe was radiolabelled using a Random-primer DNA labelling system kit (Invitrogen) with [a-32 P]dATP purchased from Perkin–Elmer. 2.5. Cell preparation and electroporation of O. oeni O. oeni 8413 was inoculated into 500 ml FT80m broth supplemented with 0.4 M sorbitol and 1% glycine and incubated at 30 °C to OD600 ¼ 0.4. The cells were har-
55
vested by centrifugation, washed four times with 500 ml of sterile incubation buffer (5 mM potassium phosphate, 1 mM MgCl2 , 4 M sorbitol and 10% glycerol, pH 4.8). Then, the cells were gently resuspended in 0.5 ml of buffer (10% P.E.G. 3000, 10% glycerol) and 100 ll of the solution was mixed together with 1 lg of plasmid DNA, transferred to a sterile 2-mm Gene Pulser cuvette (Eurogentec) and left on ice for 30 min. Electroporation was performed with a Bio-Rad pulse gene controller (25 lF, 200 ohm at 1600 V cm1 ). The cells were immediately rescued into 0.5 ml of FT80m supplemented with 0.4 M sorbitol and incubated for 2 h at 30 °C and plated onto FT80m containing erythromycin and lincomycin. 2.6. Relative-copy-number determination Genomic DNA was diluted in sterile water and 5 ll of each dilution was added to 20 ll of PCR mixture, which contained 12.5 ll of Master mix (Eurogentec), 1 ll of each primer at 7 pM and 5.5 ll of sterile water. Appropriate primers (Table 2) were designed to amplify and quantify specific plasmidic and chromosomal DNA fragments in a real-time PCR assay.
Table 2 Primers used in this work Primer pair name
Sequence (50 –30 )
Function (target)
Source or Accession Number
Rm19-Rev
CCTGCCTTTTTTGTAGCAGA CACAGGAAACAGCTATGACC CGTGGAATACGGGTTTGCTA CTCTTGGAACCATACTTAATATAG TGGTCGGGAATTTCTTTATGC CCAAGAGAAAAAACTATG T CGAGGTGACATAACGTATGAA GCTATAAGTAGTTTGCTGATTAA CGAGAGGTAAATGTAGCATTG CGTCTGCAATCATTCCTTCATT GCATTTAACGACGAAACTGGC GAAACTGTAGAATATCTTGGTG GCAATTATGGAAGTTGTAAATAA CAGATTCAGTCCAAATGTTAG GCCGCAGTAAAGAACTTGATG TGCCGACAACACCAACTGTTT GGCGCAATCCTTATTCGATT CCAGCATTTGAAGTAGCGATT CGCAGGCAGAAAAGAACAATC GCTGAAGACGAAGCAGTTGC GTGTGAACCAAAAACCAGGAC GATTAGAAGCAATTACAAAAATAC CCAGACAAGGCAATCAAAGG GTTGCATCATTAGAAAGTCCC CCCAACTTTGAGTGAAGCAA CACCACGAGCATCATATTCA GATTACCGTCCTAACGCAGT GCCACATCGTCAATGCCAC CATTTCTGATTCTTTATTGGCAC GAAATCATTAAAACACGCAGAAG CGTGATATCCACTACACTAAG GTTGGGACATTCGTTGCTCA
Q-RT-PCR (pGID052)
AJ628448
Q-RT-PCR (pGID052)
AJ628448
Q-RT-PCR (pGID052)
AJ628448
Q-RT-PCR (pVA797 and pIP501)
X65462
Q-RT-PCR (pVA797 and pIP501)
L39769
Q-RT-PCR (pIP501)
U00453
Q-RT-PCR (pVA797)
X65462
Q-RT-PCR (O. oeni chromosome)
[35]
Q-RT-PCR (O. oeni chromosome)
Our lab
Q-RT-PCR (O. oeni chromosome)
Our lab
Q-RT-PCR (L. lactis chromosome)
AY236961
Q-RT-PCR (L. lactis chromosome)
AY189901
Q-RT-PCR (L. lactis chromosome)
AJ001007
Q-RT-PCR (E. faecalis chromosome)
AJ011113
Q-RT-PCR (E. faecalis chromosome)
AF414352
Q-RT-PCR (E. faecalis chromosome)
AF210458
Ery Rm18C Cat1 Nick Epip Cat2 LdhD ClpL GrpE LdhB OppA AdhE CcpA Div Sig
Q-RT-PCR ¼ quantitative-real-time PCR.
56
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
Chromosomal genes of each strain were chosen as reference (Table 2) in the real-time PCR assay. Amplifications were performed on a Biorad-I-Cycler with the SYBR GreenÒ system. Thermal cycling conditions included the following steps: initial denaturation at 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 30 s. Fluorescence measurements were recorded during each annealing step. Assays were duplicated and three dilutions of DNA were used for CT determination. The specificity of real-time PCR for each primer pair was determined with a melting curve. For each primer pair, the efficiency of real-time amplification was determined by running a standard curve with three dilutions of DNA. A PCR that amplifies the target sequence with 100% efficiency (E) can double the amount of PCR products in each cycle. The efficiency E is calculated by the formula E ¼ ½10ð1=sÞ 1 100 where s is the slope of standard curve. The results were calculated using the comparative critical threshold (DCT ) method in which the amount of target DNA is compared to a reference DNA. The pLC22R and pGID052 nucleotide sequences reported in this paper have been submitted to EMBL/ Genbank databases under Accession Number AJ493278 and AJ628448 respectively.
selection. In the two species, whose could be used as donors, the plasmid pIP501 was demonstrated to be able to replicate [18,19]. Each conjugation was carried out two to four times. After filter mating, potential transconjugants were selected on plates containing vancomycin, lincomycin and erythromycin. The selection with these antibiotics allowed us to eliminate the spontaneous mutants. No erythromycin or lincomycin resistant mutants were obtained in control assays. Likewise, no vancomycin-resistant mutants were obtained with donor cells. Frequencies obtained in case of transfer from E. faecalis to O. oeni were given in Table 3, confirming that there is some variability between different strains of O. oeni. Frequencies of the same order were obtained with L. lactis as the donor strain (data not shown). Only the strains with frequencies higher than 107 conjugants per recipient were used for further conjugation experiments. Among the 10 strains, strains 8413, 8417, GM and M1 had such frequencies. For these four strains, conjugations were done four times. These frequencies were close of which found in other studies by conjugation in Leuconostoc sp. [18] and O. oeni [11,12]. It could be noted that frequencies drop dramatically when the optical density, that is to say the age of the culture, exceeded 0.3 at 600 nm, as described by Zu~ niga et al. [11]. Evidence for transfer of the antibiotic resistant plasmid in O. oeni transconjugants was confirmed by PCR. Amplifications by PCR with specific primer pair of pIP501 nickase gene (Accession Number AJ628448) and specific primer pair of O. oeni hsp18 gene [20] have been obtained on randomly presumptive conjugants (data not shown). The segregational stability of the plasmid was analysed by growing O. oeni transconjugants in antibiotic-free medium, then by counting viable cells and determining percentages of resistant cells. This plasmid exhibited instability, whose loss rate could be calculated as described by Boe and Rasmussen [21].
3. Results and discussion 3.1. Conjugal transfer of pIP501 to O. oeni The group of pAMb1 and the pIP501 plasmid have been shown to conjugate with a wide variety of lactic acid bacteria, particularly with Leuconostoc [18] or very recently with Oenococcus [12]. Mating experiments were first performed from Enterococcus faecalis and Lactococcus lactis to ten different strains of O. oeni to make a
Table 3 Frequencies of conjugal transfer Donor (plasmid content)
Recipient
Frequency of transfer a (mean SD)
Enterococcus faecalis JH2-2 (pIP501)
O. O. O. O. O. O. O. O. O. O.
2.2 (1.3) 107 2.6 (1.8) 107 1.2 (0.2) 107 1.4 (0.3) 107 0.5 107 0.5 107 0.23 107 NDb NDb NDb
Lactococcus lactis DG52 (pVA797, pGID052)
O. oeni 8413 O. oeni 8417
a
oeni oeni oeni oeni oeni oeni oeni oeni oeni oeni
8417 8413 M1 GM 8403 23277 107 20252 20255 20257
0.9 (0.3) 107 2.4 (0.9) 107
The frequencies of transfer were expressed as the number of transconjugants per recipient CFU after the mating period. Two to four independent experiments were performed for each recipient strain. The standard deviations are given where available. b ND: not detected.
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
57
The plasmid loss rate is described as the probability of a cell division of a plasmid-carrying cell resulting in the birth of a plasmid-free daughter cell and a plasmidcarrying daughter cell. We found a plasmid loss rate of approximately 19%, which confirmed the instability of pIP501 in O. oeni as described by Zu~ niga et al. [12]. This data was also in accordance with the study of Thompson and Collins in Streptococcus sp. [22], in which regions of spontaneous deletions were identified in pIP501. 3.2. Construction of a new shuttle vector pGID052 In order to overcome the limits of size and instability of the pIP501, the construction of a tool for the genetic transfer in O. oeni was performed. As shown in first section, the oriT of pIP501 could be used for conjugation with Oenococcus. A synthetic 49 bp oriT site of pIP501, described by Wang and Macrina [23], was created by annealing two oligonucleotides (50 -AATTCCCGGGTACTAAGGGCGCACTTATACGCAGTAACTTCGTTACTTCGTATTTATCCCGG-30 and 50 GATCCCGGGATAAATACGAAGTAACGAAGTTATCCCGGGATAAATACGAAGTAACGAAGTTACTGCGTATAAGTGCGCCCTTAGTACCCGGG-30 ). This fragment was cloned into EcoRI–BamHI restricted pUC19 giving the plasmid pGID700. The oriT region of plasmid pGID700 was isolated by a SmaI restriction and then inserted into StuI digested pORI19 to give pGID701. Therefore, Plasmid pGID701 could be mobilizable by a plasmid of the family pAMb1/pIP501 [23]. The choice of the plasmid pORI19, a conditional replication vector, was justified by its ability to be replicated via rolling-circle type in an Escherichia coli EC101 strain. This latter is a helper strain in which the repA gene was integrated into the chromosome of the E. coli JM101 strain [24]. On the other hand, we took advantage of the fact that Leuconostoc and Oenococcus are linked phylogenetically. To increase the ability to have transconjugants, a DNA fragment from a native plasmid of Leuconostoc citreum was used. This plasmid, called pLC22R, was completely sequenced, revealing a circular genome of 9935 bp with a total G+C content of 33%. The nucleotide sequence has been submitted to EMBL/Genbank databases under Accession Number AJ493278. The sequence analysis enabled us to identify two ORFs, which showed high identity to a family of known replication genes. Indeed, the deduced products of the two genes shared significant amino acid sequence similarities with replication proteins encoded by plasmids from other Gram-positive genera, including a large number of lactococcal plasmids related to pJW565 [25]. These plasmids replicate via theta mechanism. The first ORF, called repB, shared high identity with RepB protein, an initiator of plasmid replication. The function of the following gene, named orfX, is still unknown but could be related to replication. Finally, a non-coding
Fig. 1. Genetic map of the plasmid pGID052. The components of this vector are: (i) a 2.28 kbp fragment containing the pORI19 vector and the oriT of pIP501 (grey line); (ii) a HindIII fragment encompassing repA, repB, orfX genes of pLC22R (black line). Only relevant restriction sites are shown. Heavy arrows indicate the direction of transcription of the genes.
region, repA, containing the proposed origin of replication, precedes the repB gene. The region repA contained an AT-rich domain followed by a 22-bp iterons, sequence tandemly repeated three and a half times. Thus, a large fragment of 3.38 kbp encompassing replication region of pLC22R containing repA, repB, and orfX was inserted into pGID701 to give pGID052. This shuttle vector retains the following properties: (i) its size of 5.66 kbp, (ii) its double selection by erythromycin and lincomycin (iii) its mobilization by a plasmid of pIP501/ pAMb1 family and (iv) its replication via rolling circle in E. coli or via theta mechanism in Oenococcus. The map of this plasmid is given in Fig. 1. 3.3. Conjugal transfer of pGID052 to O. oeni In order to test mating experiments with the pGID052 plasmid, a conjugative plasmid is necessary to mobilize pGID052. L. lactis DG52 harboring the conjugative plasmid pVA797 was chosen as donor since the pIP501 could not be used for mobilization because it possesses the same antibiotic resistance marker as pGID052. On the contrary, pVA797 plasmid is useful because it only contains a chloramphenicol resistance gene [26]. This strain was used as the donor for the mating experiments with two O. oeni strains, named 8413 and 8417. The 8413 O. oeni strain contains at least one plasmid, called pLo13, from which the replication type was different from the plasmid pGID052. Features commonly found in plasmids that replicate via a rolling-circle mechanism were identified within pLo13 [27]. The replication of pGID052 in Oenococcus was certainly due to the fragment encompassing the replication region of pLC22R. As described above, this latter might replicate via theta mechanism. In addition, to overcome the eventual
58
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
problem due to plasmid incompatibility, the strain 8417 was used since it does not contain any plasmid [28]. Each conjugation by mobilization was repeated four times. The frequencies were about 107 transconjugants for 8413 and 8417 strains (Table 3). These frequencies were close to those obtained with pIP501. Amplifications by PCR with two primer pairs specific to pGID052 (Accession Number AJ628448) and one specific to O. oeni hsp18 gene [20] were obtained (data not shown). Physical evidence of the presence of pGID052 in O. oeni transconjugants was shown by analysis of the restricted plasmid content by agarose gel electrophoresis (data not shown). Southern hybridizations of PstI or EcoRI-restricted genomic DNA (Fig. 2(a)) or plasmidic DNA (Fig. 2(c)) from transconjugants chosen randomly, with pGID052 plasmid as a probe, were realized. Neither chromosomal insertion nor sizeable deletions of pGID052 were detected. The pGID052 plasmid seemed to be stable in the recipient strain, since the transconjugants retained erythromycin and lincomycin resistant phenotype after growth in antibiotic free FT80m for 100 generations. A Southern blot experiment has been realized with restricted DNA extracted from cells after growth in antibiotic-free medium. The results showed that the plasmid was detected without detectable size change (Fig. 2(b)). The second band obtained with digested pGID052 plasmid extracted from E. coli corresponded to single-strand DNA and was due to rolling-circle replication. This phenomenon has already been described in the case of plasmids of the pWV01 family [29].
Extractions of plasmid DNA from O. oeni yielded very few quantities of DNA, suggesting that the copy number of the plasmid was low in that host. To determine it, quantitative real-time PCR was used. This method enables to quantify accurately any DNA sequence to any other. In our case, the number of plasmid was compared to the number of chromosome thanks to amplifications of specific fragments DNA. First, it has been verified that different chromosomal primers pair (Table 2) gave the same CT in L. lactis, E. faecalis and O. oeni. Second, the copy number of plasmid was obtained by calculating the 2DCT between chromosomal amplifications and plasmidic amplifications. For each strain, amplifications were made twice from DNA extracted from two independent cultures. To verify correlation between results with hybridizations and real-time PCR, the pVA797 and pIP501 copy number were determined in L. lactis and E. faecalis with specific primers pair (Table 2). The pVA797 was found at about four copies in L. lactis while pIP501 at about three copies in E. faecalis. These results were similar to those previously obtained by Evans and Macrina in Streptococcus sanguis [26]. Amplifications of pGID052 were made with primer pairs indicated in Table 2. This plasmid is maintained at four copies in L. lactis while it is estimated at around one copy in O. oeni. Interestingly, pGID052 is a verylow-copy number plasmid in both L. lactis and O. oeni strains and it will be used as expression vector for studying accurate promoter activities in vivo thanks to transcriptional fusions [30].
Fig. 2. Presence of the conjugative plasmid pGID052 in transconjugants by Southern blot analysis. (a) Lane 1, 2: Plasmidic DNA extracted from E. coli EC101. Lanes 3, 4: Genomic DNA extracted from three different 8417 O. oeni transconjugant. Lanes 5, 6, 7, 8, 9, 10: Genomic DNA extracted from 8413 O. oeni transconjugant. (b) Lane 1, 2: Plasmidic DNA extracted from E. coli EC101. Lanes 3, 4: Genomic DNA extracted from transconjugant having grown in antibiotic-free medium. (c) Lane 1: Plasmidic DNA extracted from L. lactis DG52. Lanes 2, 3: Plasmidic DNA extracted respectively from 8413 or 8417 O. oeni transconjugant. The DNAs were restricted by EcoRI (a: lanes 1, 3, 5, 7, 8, 9; b: lanes 1, 3; c: lanes 1, 2, 3) or PstI (a: lanes 2, 4, 6, 8, 10; b: lanes 2, 4) and separated in a 0.8% agarose gel by electrophoresis. Southern hybridizations were performed with a radiolabelled pGID052 probe. The experiment was carried out twice.
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
As pGID052 was shown to be transferred and could replicate in O. oeni, we have tried to transfer this plasmid by electroporation as described in Section 2. Unfortunately, all attempts to introduce plasmids into O. oeni using electroporation protocol were unsuccessful. This could be due to the presence of a restriction system in O. oeni. Indeed, during conjugative transfer of plasmids between bacteria, DNA is transferred in the single-strand form. This would suggest that transfer by conjugative means should be little affected by restriction–modification system. Moreover, it has been shown that for Gram positive bacteria like Clostridium difficile, conjugation experiments but not electroporation, allowed genetic transfer [31]. Therefore, the mobilization procedure reported in this paper could be very useful for this species. In conclusion, the plasmid pGID052 has been shown to be helpful for genetic transfer in O. oeni. Ongoing studies will focus on the use of a shuttle vector derived from pGID052 to allow analysis of gene regulation by transcriptional fusions in O. oeni.
Acknowledgements We are grateful to K. Leenhouts for supplying plasmid pORI19 and E. coli EC101 strain. This study was supported by the Ministere de l’Education Nationale de la Recherche et de la Technologie, the Universite de Bourgogne, the Institut national de la recherche agronomique and the Conseil Regional de Bourgogne.
References [1] Dicks, L.M., Dellaglio, F. and Collins, M.D. (1995) Proposal to reclassify Leuconostoc oenos as Oenococcus oeni [corrig.] gen. nov., comb. nov. Int. J. Syst. Bacteriol. 45, 395–397. [2] Guzzo, J., Jobin, M.P., Delmas, F., Fortier, L.C., Garmyn, D., Tourdot-Marechal, R., Lee, B. and Divies, C. (2000) Regulation of stress response in Oenococcus oeni as a function of environmental changes and growth phase. Int. J. Food Microbiol. 55, 27–31. [3] Garmyn, D., Monnet, C., Martineau, B., Guzzo, J., Cavin, J.F. and Divies, C. (1996) Cloning and sequencing of the gene encoding alpha-acetolactate decarboxylase from Leuconostoc oenos. FEMS Microbiol. Lett. 145, 445–450. [4] Leit~ ao, M.C., Teixeira, H.C., Barreto Crespo, M.T. and San Rom~ ao, M.V. (2000) Biogenic amines occurrence in wine. Amino acid decarboxylase and proteolytic activities expression by Oenococcus oeni. J. Agric. Food Chem. 48, 2780–2784. [5] Tonon, T. and Lonvaud-Funel, A. (2000) Metabolism of arginine and its positive effect on growth and revival of Oenococcus oeni. J. Appl. Microbiol. 89, 526–531. [6] Jobin, M.P., Garmyn, D., Divies, C. and Guzzo, J. (1999) The Oenococcus oeni clpX homologue is a heat shock gene preferentially expressed in exponential growth phase. J. Bacteriol. 181, 6634–6641. [7] Jobin, M.P., Garmyn, D., Divies, C. and Guzzo, J. (1999) Expression of the Oenococcus oeni trxA gene is induced by hydrogen peroxide and heat shock. Microbiology 145, 1245–1251.
59
[8] obin, M.P., Delmas, F., Garmyn, D., Divies, C. and Guzzo, J. (1997) Molecular characterization of the gene encoding an 18kilodalton small heat shock protein associated with the membrane of Leuconostoc oenos. Appl. Environ. Microbiol. 63, 609–614. [9] Bourdineaud, J.P., Nehme, B., Tesse, S. and Lonvaud-Funel, A. (2003) The ftsH gene of the wine bacterium Oenococcus oeni is involved in protection against environmental stress. Appl. Environ. Microbiol. 69, 2512–2520. [10] Dicks, L.M.T. (1994) Transformation of Leuconostoc Oenos by electroporation. Biotechnol. Tech. 8, 901–904. [11] Zu~ niga, M., Pardo, I. and Ferrer, S. (1996) Transposons Tn916 and Tn925 can transfer from Enterococcus faecalis to Leuconostoc oenos. FEMS Microbiol. Lett. 135, 179–185. [12] Zu~ niga, M., Pardo, I. and Ferrer, S. (2003) Conjugative plasmid pIP501 undergoes specific deletions after transfer from Lactococcus lactis to Oenococcus oeni. Arch. Microbiol. 180, 367–373. [13] Cavin, J.F., Prevost, H., Lin, J., Schmitt, P. and Divies, C. (1989) Medium for screening Leuconostoc oenos strains defective in malolactic fermentation. Appl. Environ. Microbiol. 55, 751–753. [14] Terzaghi, B.E. and Sandine, W.E. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl. Environ. Microbiol. 29, 807–809. [15] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [16] Birnboim, H.C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7, 1513–1523. [17] Platteeuw, C., Simons, G. and de Vos, W.M. (1994) Use of the Escherichia coli beta-glucuronidase (gusA) gene as a reporter gene for analyzing promoters in lactic acid bacteria. Appl. Environ. Microbiol. 60, 587–593. [18] Pucci, M.J., Monteschio, M.E. and Kemker, C.L. (1988) Intergeneric and intrageneric conjugal transfer of plasmid-encoded antibiotic resistance determinants in Leuconostoc spp. Appl. Environ. Microbiol. 54, 281–287. [19] Langella, P., Le Loir, Y., Ehrlich, S.D. and Gruss, A. (1993) Efficient plasmid mobilization by pIP501 in Lactococcus lactis subsp. lactis. J. Bacteriol. 175, 5806–5813. [20] Jobin, M.P., Delmas, F., Garmyn, D., Divies, C. and Guzzo, J. (1997) Molecular characterization of the gene encoding an 18kilodalton small heat shock protein associated with the membrane of Leuconostoc oenos. Appl. Environ. Microbiol. 63, 609–614. [21] Boe, L. and Rasmussen, K.V. (1996) Suggestions as to quantitative measurements of plasmid loss. Plasmid 36, 153–159. [22] Thompson, J.K. and Collins, M.A. (2003) Completed sequence of plasmid pIP501 and origin of spontaneous deletion derivatives. Plasmid 50, 28–35. [23] Wang, A. and Macrina, F.L. (1995) Streptococcal plasmid pIP501 has a functional oriT site. J. Bacteriol. 177, 4199–4206. [24] Law, J., Buist, G., Haandrikman, A., Kok, J., Venema, G. and Leenhouts, K. (1995) A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes. J. Bacteriol. 177, 7011–7018. [25] Gravesen, A., von Wright, A., Josephsen, J. and Vogensen, F.K. (1997) Replication regions of two pairs of incompatible lactococcal theta-replicating plasmids. Plasmid 38, 115–127. [26] Evans Jr., R.P. and Macrina, F.L. (1983) Streptococcal R plasmid pIP501: endonuclease site map, resistance determinant location, and construction of novel derivatives. J. Bacteriol. 154, 1347–1355. [27] Fremaux, C., Aigle, M. and Lonvaud-Funel, A. (1993) Sequence analysis of Leuconostoc oenos DNA: organization of pLo13, a cryptic plasmid. Plasmid 30, 212–223. [28] Cavin, J.F., Schmitt, P., Arias, A., Lin, J. and Divies, C. (1988) Plasmid profiles in Leuconostoc species. Microbiol. Alim. Nut. 5, 55–62.
60
C. Beltramo et al. / FEMS Microbiology Letters 236 (2004) 53–60
[29] Jeong, J.Y., Yoon, G.M., Seo, H.S., Cho, M.J., Sakai, H., Komano, T. and Bahk, J.D. (1997) Functional features of an ssi signal of plasmid pGKV21 in Escherichia coli. J. Bacteriol. 179, 5795–5801. [30] Poyart, C. and Trieu-Cuot, P. (1997) A broad-host-range mobilizable shuttle vector for the construction of transcriptional fusions to beta-galactosidase in gram-positive bacteria. FEMS Microbiol. Lett. 156, 193–198. [31] Purdy, D., O’Keeffe, T.A., Elmore, M., Herbert, M., McLeod, A., Bokori-Brown, M., Ostrowski, A. and Minton, N.P. (2002) Conjugative transfer of clostridial shuttle vectors from Escherichia coli to Clostridium difficile through circumvention of the restriction barrier. Mol. Microbiol. 46, 439–452.
[32] Prevost, H., Cavin, J.F., Lamoureux, M. and Divies, C. (1995) Plasmid and chromosome characterization of Leuconostoc oenos strains. Am. J. Enol. Vitic. 46, 43–47. [33] Gasson, M.J. (1983) Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154, 1–9. [34] Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. [35] Beltramo, C., Grandvalet, C., Pierre, F. and Guzzo, J. (2004) Evidence for multiple levels of regulation of Oenococcus oeni clpPclpL locus expression in response to stress. J. Bacteriol. 186, 2200–2205.