A new yeast artificial chromosome vector designed for gene transfer into mammalian cells

Gene 210 (1998) 163–172

A new yeast artificial chromosome vector designed for gene transfer into mammalian cells Pierre-Jean Ripoll a, Alison Cowper a, Sandra Salmeron a, Paul Dickinson b, David Porteous b, Benoı¨t Arveiler a,* a Laboratoire de Pathologie Mole´culaire et The´rapie Ge´nique, Universite´ Victor Segalen Bordeaux 2, 146 Rue Le´o Saignat, 33076 Bordeaux, Ce´dex, France b MRC Human Genetics Unit, Western General Hospital, Edinburgh, UK Received 9 July 1997; received in revised form 24 November 1997; accepted 29 January 1998; Received by A. Bernardi

Abstract This report describes the construction of a new yeast artificial chromosome (YAC ) vector designed for gene transfer into mammalian cells. For ease of use, the two arms of the vector were cloned separately. The vector harbours the Neo and Hyg genes for dominant selection in mammalian cells, a putative human origin of replication, a synthetic matrix attachment region and two loxP sites (one on each arm). The cloning ability of the vector was demonstrated by successful propagation of the cDNA of the cystic fibrosis gene, CFTR, as a YAC in Saccharomyces cerevisiae. A YAC containing the entire CFTR gene was also constructed by retrofitting the two arms of a pre-existing clone (37AB12) with the two arms of the novel vector. Both the cDNA and entire gene containing YACs were circularized in yeast by inducible expression of the Cre recombinase. Recombination occurred very specifically at the loxP sequences present on the two arms of the YAC. Applications of the vector to gene transfer are discussed. © 1998 Elsevier Science B.V. Keywords: loxP; Cre recombinase; Cystic fibrosis transmembrane conductance regulator gene

1. Introduction The regulation of gene expression requires the presence of multiple regulatory elements which can be located at quite a distance from the promoter itself, upstream or downstream of the coding sequences, or even in introns. In addition, matrix attachment regions (MARs) (Mirkovitch et al., 1984; Gasser and Laemmli, 1987; Gross and Garrard, 1987) seem to be important elements that define the gene boundaries and act as insulators, avoiding interference on gene expression from adjacent chromosomal sequences (Stief et al., 1989; PhiVan et al., 1990). It is well known that transgene expression is highly dependent on the site of insertion in the host genome. This phenomenon can be abolished if locus control regions (LCRs) (Grosveld et al., 1987, Greaves et al., 1989) or MARs (Stief et al., 1989; Klehr et al., 1991; McKnight et al., 1992) are added on both sides of the transgene. * Corresponding author. Tel: 33 5 57 57 11 63; Fax: 33 5 56 98 33 48; e-mail: [email protected] 0378-1119/98/$19.00 © 1998 Elsevier Science B.V. All rights reserved. PII S 03 7 8 -1 1 1 9 ( 9 8 ) 0 0 0 62 - 6

It has recently been shown that the transfer of yeast artificial chromosomes ( YACs) carrying entire genes into mammalian cells results in transgene expression that is directly proportional to the YAC copy number and independent of the site of insertion. Moreover, transgenic animals thus engineered displayed correct spatiotemporal expression patterns (see, for instance, Schedl et al., 1993, 1996; Huxley et al., 1996). This paper describes the construction of a new YAC vector designed for gene transfer into mammalian cells. For ease of use, the two arms of the vector were cloned separately. The vector harbours the Neo and Hyg genes for dominant selection in mammalian cells, a putative human origin of replication (Iguchi-Ariga et al., 1988), and two loxP sites (one on each arm). Three other sequences were added: the 18 bp restriction site I-Sce1, the lacO operator (LacOp) and a synthetic MAR sequence (Bode et al., 1992). Both the left and right arms of the vector can be used to retrofit the arms of pre-existing YACs in order to confer novel features upon them. The cloning ability of the vector was demonstrated by successful propagation of the cDNA of the

164

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

cystic fibrosis transmembrane conductance regulator (CFTR) gene as a YAC in Saccharomyces cerevisiae. A YAC containing the entire CFTR gene was also constructed, by replacing the two arms of a pre-existing YAC by the arms of the new vector. The YACs were circularized in yeast by the action of the Cre recombinase on the loxP sequences (Abremski et al., 1983). Circular YACs may indeed have a lower propensity to integrate into the host genome than linear molecules.

2. Materials and methods 2.1. Plasmids and vectors These were obtained from the following researchers or companies: pYAC4 (Dr. M. Olson, Washington University, St Louis), pCGS990 (Dr. D. Smith, Collaborative Research, Waltham, MA), pBS49 (Dr. B. Sauer, DuPont Merck Pharmaceutical Company, Wilmington), pUC9lox2cm (Dr. C. Boyd, MRC Human Genetics Unit, Edinburgh), pMC1Neo (Stratagene), pHA58 (Dr. A. Berns, The Netherland Cancer Institute, Amsterdam) and pSH135 (Dr. Harashima, Osaka University). All plasmids were propagated in E. coli strain Xl1 blue, except for pSH135 which was in GM161.

2.5. Polymerase chain reaction DNA amplification was performed in 50 ml reactions containing 50 mM KCl, 10 mM Tris–HCl, pH 9, 0.1% Triton X-100, 1.5 mM MgCl , 200 mM dNTPs, 2 0.75 mM of each primer and 1 U of Taq DNA polymerase (Promega Corporation); 50 ng of target DNA was used. Cycling conditions for the amplification of ARS121 were: 94°C for 3 min, 45°C for 30 s, 72°C for 1 min (1×); 92°C for 45 s, 45°C for 30 s, 72°C for 1 min (35×); 92°C for 45 s, 45°C for 30 s, 72°C for 10 min (1×) in a Perkin-Elmer Cetus DNA Thermal Cycler. Cycling conditions for the Cre-induced circularizationevent PCR were: 95°C for 5 min (hot start); 92°C for 20 s, 55°C for 30 s, 72°C for 2 min (35×); 92°C for 20 s, 55°C for 30 s, 72°C for 10 min (1×) in a Hybaid Omnigene cycler. 2.6. Sequence analysis The Cre-induced circularization-event PCR product was sequenced using a Perkin-Elmer ABI PRISM@ Dye Terminator Sequencing Ready Reaction Kit, using oligonucleotides TGCGAGCGCAGAGGCCACTT and GACGCGCTGGGCTACGTCTT. 2.7. Southern blot analysis

2.2. Modification enzymes Restriction enzymes, Klenow polymerase, T4 DNA polymerase, calf intestinal phosphatase and T4 DNA ligase were from Boehringer Mannheim, Eurogentec, New England Biolabs or Promega Corporation. All enzymes were used according to the suppliers’ recommendations. 2.3. Yeast culture Media containing 2% glucose were used (SD), except for Gal1-induced Cre expression where a glucosefree, galactose (2%)-containing medium was used (SG,−Lys,−His). Media lacking one or more amino acid were used as appropriate for selection purposes (SD,−Lys,−Ura, SD,−His,−Lys). Solid media were made by adding 2% agar. Yeast DNA preparation was performed according to Petit et al. (1994). 2.4. E. coli and yeast transformation E. coli strain XL1 blue (Stratagene) was used in all plasmid cloning experiments. YAC cloning was performed in strain AB1380 (Burke et al., 1987). Transformations were performed by electroporation using an IBI GeneZapper 450/2500. Chambers 2 mm wide were used for both E. coli (2500 V, 21 mF, 200 V) and S. cerevisiae (450 V, 100 mF, 200 V).

After agarose gel electrophoresis, DNA was transferred on to Hybond N (Amersham). Probes were labelled by random priming using a Multiprime labelling kit (Amersham). Kodak X-AR films were used for autoradiography. 2.8. Right arm construction Full details of vector construction are not given here, but are available from the authors on request. A linker containing the I-Sce1 recognition site (Monteillet et al., 1990) was cloned into the unique SphI site of pYAC4, to obtain pYAC4–Sce1 ( linker sequences: CTAGGGATAACAGGGTAATCATG and ATTACCCTGTTATCCCTAGCATG). An origin of replication located in the 5∞ region of the c-myc gene has been shown to promote the autonomous replication of plasmids both in vitro (Iguchi-Ariga et al., 1988) and in vivo (Sudo et al., 1990). An 83 bp fragment (MORI ) was subcloned which encompasses the minimal sequences necessary to provide full replicative activity (nucleotides 102–184 as defined in IguchiAriga et al., 1988). The insert was sequenced to check its integrity (not shown). Plasmid pMC1NeopolyA ( Thomas and Capecchi, 1987) was used as a source of the Neo gene. Two complementary oligonucleotides (GATCGAATTGTGAGCGCTCACAATTCGGTACCGGCCGGACCGG-

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

CC and GATCGGCCGGTCCGGCCGGTACCGAATTGTGAGCGCTCACAATTC ) carrying LacOp ( Koob and Szybalski, 1990), followed by sites for restriction endonucleases KpnI, RsrII and SfiI, were annealed and cloned into the SalI site of pMC1Neo located 3∞ to the Neo gene (plasmid pMC1NeolacOp). The MORI fragment was then cloned into the XhoI site of pMC1Neo located 5∞ to the Neo expression cassette to produce plasmid pMNL. The MNL cassette was extracted from pMNL by double restriction with SalI and XhoI and inserted in the unique SalI site of pYAC4–Sce1 to produce pYAC4SceMNL ( Fig. 1). In order to increase the replication capability of the YACs in S. cerevisiae, a second ARS was inserted in the right arm of the vector. ARS121 ( Walker et al., 1991) was obtained from S. cerevisiae DNA (strain AB1380) by PCR using primers CGAATTCCGGATTCATAAATCCAC and CCTGCAGCTTAGAATTTTGGCTC, and cloned into the HincII site of pUC19 (plasmid pARS121). A 457 bp EcoRI–SspI fragment was then removed from pARS121 (pARS121D). A 2044 bp PstI fragment containing the chloramphenicol resistance gene framed by two loxP sites, obtained

165

from plasmid pUC9lox2cm (a kind gift from Dr. Chris Boyd, MRC Human Genetics Unit, Edinburgh), was inserted into the unique PstI site of pARS121D. The chloramphenicol resistance gene and one loxP site were then removed after treating with Cre recombinase to obtain plasmid pARS121DloxP. An adaptor containing restriction sites for endonucleases NruI, EcoRI, BamHI, SspI and BglII was inserted between restriction sites SphI and HindIII of pARS121DloxP. The sequences of the adaptor’s oligonucleotides were AGCTAGATCTAATATTGGATCCCGAATTCTCGCGATGATCATG and ATCATCGCGAGAATTCGGGATCCAATATTAGATCT. Plasmid pARS121DloxP@ ( Fig. 1) thus obtained constituted the backbone for constructing the right arm of the vector. The BamHI–NruI fragment containing the URA3 gene and a Tetrahymena telomere from pYAC4SceMNL was cloned into the BamHI and SspI sites of the adaptor (pARS121DloxP-BN ). The EcoRI–NruI fragment from pYAC4SceMNL that carries the MNL cassette was then inserted into the EcoRI and NruI sites, thus producing plasmid pBD. Finally, plasmid pBDn was obtained by adding a

Fig. 1. Structure of key constructs. Functionally important genetic elements are shown, as well as cloning sites and restriction sites used for insert excision.

166

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

NotI site between the EcoRI and BamHI sites of pBD by use of an adaptor (oligonucleotide sequences: AATTCGCGGCCGCG and GATCCGCGGCCGCG). Both EcoRI and NotI can hence be used for cloning. The restriction map of the right arm was deduced from the maps of the various vectors and inserts used to construct pBDn ( Fig. 2).

structed by coligation and cloned into the EcoRV site of pBluescript. A 214 bp HindIII–SmaI fragment containing the MAR sequence was then blunt-cloned into the SalI sites of pBDn and pBDnR, leading to plasmids pBDn-M and pBDnR-M ( Fig. 2).

2.9. Construction of a retrofitting right arm

The retrofitting vector pCGS990 (Smith et al., 1993) was used as a starting material for constructing the left arm of the vector. This vector contains a conditional centromere for copy-number control of the YACs. A 2044 bp PstI fragment containing the chloramphenicol resistance gene (cm) framed by two loxP sites was excised from pUC9lox2cm and cloned into the SphI site of pHA58 (Nishiwaki et al., 1987). The plasmid thus obtained was called pHA58lox2cm.1 (Fig. 1). A plasmid called pCGS990N ( Fig. 1) was constructed

A 1047 bp SstI–BglII fragment containing the TRP1 gene was excised from pYAC4 and ligated into the BglII site of pBDn. In order to allow for the SspI–BglII ligation to occur, one BglII end of pYAC4 was blunted using Klenow polymerase. The plasmid thus obtained was called pBDnR. A synthetic MAR sequence (Bode et al., 1992) constituted of the heptamer of a 25 bp sequence was then added. The heptamer was first con-

2.10. Left arm construction

Fig. 2. Structure of the right (pBDn and pBDnR-M ) and left (pBG) arms of the new YAC vector. A restriction map of the plasmids is shown.

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

by the insertion of a XhoI–NotI–XhoI linker ( TCGAGCGGCCGC ) into the unique SalI site of pCGS990. A 3.5 kb BglII fragment harbouring a loxP–cm–loxP–Hyg cassette excised from pHA58lox2cm.1 was inserted into the EcoRI site of pCGS990N (plasmid pCGS990N–Hyglox2cm). The cm gene was then removed by the action of purified Cre recombinase. The left arm of the YAC vector, pBG, was obtained after selection for sensitivity to chloramphenicol. A precise restriction map of pBG was established with 10 restriction enzymes by a combination of single, double, triple and partial digestions (Fig. 2). 2.11. Insertion of the CFTR cDNA in the new YAC vector

167

2.12. Construction of a yeast Cre expression vector The URA3 gene was partially deleted in plasmid pBS49 (Sauer, 1987) by double digestion with NcoI and NsiI, filling in of the ends and ligation (plasmid pYCi). In parallel, HIS5 was excised from plasmid pSH135 (Nishiwaki et al., 1987) by digestion with BclI and BglII and cloned into the SmaI site of pYCi. The Cre expression plasmid thus obtained was called pYCiH5.

3. Results 3.1. Construction of a new YAC vector

A 5 kb NotI–NdeI fragment containing the full-length CFTR cDNA under the control of the CMV promoter was obtained from plasmid pCMV–CFTR (Alton et al., 1993). The CMV–CFTR cassette was inserted into NotI–EcoRI double digested pBDn, after both the EcoRI and NdeI sites from the plasmid and the insert were filled in, respectively, with dATP and dTTP before ligation. The plasmid thus obtained was called pBDnCMV–CFTR. A ClaI–XhoI–NotI adaptor (GCGGCCATCGATTCTCGAGTGCGGCCGC ) was then inserted into the NotI site (plasmid pBDnCMV–CFTRnxc) (Fig. 1). Before adding the same ClaI–XhoI–NotI adaptor to the left arm plasmid pBG, two ClaI sites located in pBG next to CEN4 and to the LoxP site, respectively, were removed. pBG was digested with ClaI, the four ClaI ends were filled in with Klenow polymerase (thus producing two new NruI sites in place of ClaI ) and the two fragments were ligated back together (not shown). Clones containing the two ClaI fragments assembled in the correct orientation were identified by restriction mapping. The ClaI–XhoI–NotI adaptor was then inserted in the NotI site and the resulting left arm was called pBGnxc ( Fig. 1). pBDnCMV–CFTRnxc and pBGnxc were both digested with ClaI, dephosphorylated with calf intestinal phosphatase and subsequently digested with NotI. The two arms were then ligated (Fig. 3) and the ligation product was transformed into S. cerevisiae strain AB1380 (Burke et al., 1987) by electroporation.

A new YAC vector has been constructed that is designed for the transfer of high molecular weight genomic DNA to mammalian cells. The two arms of the vector (pBG and pBDn) were cloned separately ( Fig. 2). The construction of the vector is presented in the Materials and Methods section and full details are available from the authors on request. The left arm (pBG) was derived from the copy number control vector pCGS990 (Smith et al., 1993). The new features introduced were the hygromycin resistance gene and a loxP site. The right arm (pBDn) was derived from the right arm of the pYAC4 vector (Burke et al., 1987). New elements added were the dominant selection gene Neo, a S. cerevisiae autonomous replication sequence (ARS121) ( Walker et al., 1991), a putative human origin of replication (Iguchi-Ariga et al., 1988), the I-Sce1 restriction site (Monteillet et al., 1990), the lacOp sequence ( Koob and Szybalski, 1990) and a loxP site. The loxP sites on the left and right arms were placed in such a way that they were in the same orientation on the YACs. Both pBG and pBDn have a unique NotI site that can be used as a cloning site. pBG can also serve as a retrofitting vector to replace the left arm of YACs contructed in pYAC4. pBDn does not provide this possibility. Therefore a retrofitting version of the right arm plasmid, called pBDnR-M, was constructed. This vector contains a synthetic MAR (Bode et al., 1992) in addition to the other elements present in pBDn.

Fig. 3. Structure of the miniYAC CMV-CFTR.

168

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

3.2. Construction of a miniYAC containing the CFTR cDNA In order to assess the cloning ability of the vector, a miniYAC was constructed that contained the full-length cDNA of the CFTR gene under the control of the cytomegalovirus early promotor/enhancer (CMV ) (Fig. 3) (see Section 2.11 for details of construction). The miniYAC was transformed into S. cerevisiae. Clones were selected on SD,−Lys,−Ura agar. Out of 40 clones grown in liquid SD,−Lys,−Ura, two grew red, indicating that the SUP4 gene was not functionnal, presumably because it was interrupted by the insert as expected. A Southern blot analysis of restriction digests of DNA of these clones was performed with a CFTR cDNA probe as well as several probes derived from the vector’s arms. All of the expected restriction fragments were visualized, thus showing that the miniYACs had the correct structure (data not shown). 3.3. Construction of a YAC containing the entire CFTR gene The next step was to assess the ability of the vector to maintain high molecular weight DNA as a YAC in S. cerevisiae. It was also necessary to verify that plasmids pBG and pBDnR-M were efficient as retrofitting vectors. Therefore a 310 kb YAC (37AB12) that contains the entire CFTR gene (Anand et al., 1991) was retrofitted. Fig. 4 displays a scheme of the strategy used. NotI linearized vector pBG was electroporated into clone 37AB12, and Trp1−Lys2+Ura3+ transformants were selected. 1002 clones were then replica-plated on to Trp−Lys−Ura− agar plates. Three clones were found not to grow on this medium and therefore had the desired phenotype. The remaining 999 clones may be Lys2 revertants or may have integrated the transfected pBG vector in their genome. The three clones with the desired phenotype were analysed further. Homologous recombination between pBG and the left arm of YAC 37AB12 can occur either between the NotI site and the GAL1 promoter (this is the desired event) or between the Gal1 promoter and the Lys2 gene. Detailed restriction analysis showed that one of the clones (R2) had undergone the desired homologous recombination event. This clone was then transformed with NotI-linearized pBDnR-M plasmid in order to retrofit its right arm. Homologous recombination can only occur between the NotI and I-Sce1 sites. Transformants were selected on Trp−Lys−Ura− agar medium. A restriction analysis of 52 clones was performed in order to verify that they had the correct structure. DNA was digested with various restriction enzymes and hybridized with MAR, Neo, Trp1 and Ura3 probes. 11 clones were shown to have the expected restriction pattern (data not shown). One clone, called B6, was selected for further study.

3.4. Circularization of YAC B6 The presence of a loxP site on each arm of the YAC vector made it possible to circularize YAC B6 using the Cre recombinase. An inducible Cre expression vector (pYCiH5) was constructed in which Cre is placed under the control of the GAL1 promoter ( Fig. 5) (see Section 2.12). YAC B6 was transformed with pYCiH5. Transformants were selected on SD,−His,−Lys, −Ura,−Trp and analysed by restriction analysis in order to check for the presence of both pYCiH5 and the YAC (not shown). The expression of Cre was induced in one of the clones (A12) by culture in a galactose-containing medium (SG,−Lys,−His). 107 cells were spread on to five fluoroorotic-containing agar plates (SD,−His, −Lys,+5FOA agar) (Boeke et al., 1984) in order to select for circularized clones, which had lost the Ura3 gene during the loxP–Cre recombination process ( Fig. 4). About 1000 clones grew on this medium, indicating that they had no functional Ura3 gene. Of these, 120 clones were picked and grouped into seven pools. A PCR assay was designed to amplify a 814 bp loxPcontaining fragment specifically if the circularization event had taken place in the YAC. Left and right arm primers (G1, CGGAATCGGGAGCGCGGCCG; and D1, CGGCATGGCGGCCGACGCGC ) were derived from vector sequences. All seven pools displayed the expected 814 bp fragment ( Fig. 6A), although pool A4 provided a faint signal. Then, 30 clones corresponding to pools A2 and B1 were analysed individually by Southern blot analysis using an EcoRI–SalI pBGderived fragment that contains the PGK1 promoter and part of the Hyg gene. This probe identified an 821 bp EcoRI fragment in the linear YAC B6 and a 1126 bp fragment in circularized YACs. 18 clones were found to contain the 1126 bp fragment only, thus indicating that all of the YAC material had been circularized (clones A2.19, B1.2, B1.3, B1.4, B1.7, B1.10, B1.12, B1.14 and B1.15 in Fig. 6B). Some clones were found to contain either linear YAC only, or both linear and circular material, or no fragment at all. The 18 circularized clones were analysed by PCR using primers ( left-arm primer G2, TGCGAGCGCAGAGGCCACTT; rightarm primer D2, GACGCGCTGGGCTACGTCTT ) located internally to primers G1 and D1 used to test the pools of clones (see above), and allowing the amplification of a 153 bp fragment from circular YACs only, as shown in Fig. 6C for clones B1.3 and B1.7. Sequence analysis of the 153 bp product from clones B1.2, B1.3, B1.4, B1.7, B1.10, and B1.14 proved that the Creinduced recombination had occurred precisely at the loxP sites, joining the left and right arms at the correct place (Fig. 6D). The circular YACs had not undergone major

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

Fig. 4. Schematic of the construction the CFTR gene containing circular YAC.

169

170

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

4. Discussion

Fig. 5. Structure of pYCiH5. Gal1, Galactose-inducible promoter; Cre, Cre recombinase gene; MT-1, metallothionase polyadenylation signal.

rearrangements, as assessed by comparing fingerprints obtained by both Alu-PCR and Southern blot analysis using a Cot1 human DNA probe with those from the original 37AB12 and linear B6 YAC. All circular YACs were also demonstrated to contain the most 5∞ and 3∞ exons of the CFTR gene (data not shown). Similarly, the miniYAC containing the cDNA of the CFTR gene was successfully circularized with high efficiency and specificity (data not shown).

Fig. 6. (A) PCR analysis of pools of circular YACs. A PCR assay was devised specifically to amplify a 814 bp fragment from circular YACs (primers G1 and D1). B is a no DNA control (blank) and C is a control plasmid in which sequences flanking the loxP sites on both the left and right arms of the YAC vector were ligated, thus mimicking the circularization event (the PCR product obtained was 49 bp larger than the one obtained with circular YACs). (B) Southern blot analysis of EcoRI-digested DNA of 15 clones. The presence of the 1126 bp fragment was diagnostic of the circularization event. M, Size marker (1 kb ladder, Life Technologies). (C ) PCR analysis of two of the circular YACs. A 153 bp fragment was amplified using primers G2 and D2. B and C are as indicated above. (D) Sequence of the 153 bp circular YAC-specific PCR product.

A new YAC vector has been constructed that contains the Neo and Hyg genes for the selection of transfected cells. The presence of both selection genes makes it possible to transfer the YAC into cells already resistant either to G418 or to hygromycin. Four new elements were added to the vector: the 18 bp restriction site I-Sce1 (Monteillet et al., 1990), the lacO operator (LacOp) sequence, a synthetic MAR sequence and loxP sites. Both I-Sce1 and lacOp sequences can serve as unique restriction sites in the YACs. This can be useful in generating restriction maps of the YAC by partial digestion with various restriction enzymes and labelling of the unique site. The LacOp sequence can indeed be used for so-called Achille’s heel cleavage ( Koob and Szybalski, 1990). It can also be used to affinity purify the YAC using a lac repressor-coated solid substrate (Lundeberg et al., 1990; Gossen et al., 1993), an alternative to standard YAC purification protocols which involve lengthy preparative pulsed-field gel electrophoresis procedures (Maule et al., 1994). The vector was successfully used to construct YACs that contain the CFTR cDNA or the entire CFTR genomic region. Cre-mediated circularization was shown to be extremely efficient and precise in achieving the objective of circularization at the loxP sites present on both arms of the vector. The vector is designed for the transfer of DNA into mammalian cells, facilitating functional analyses of large genomic fragments, including gene identification by functional complementation. Expression studies with YACs also provide a strategy to characterize, by deletion mapping experiments, the regulatory elements located at large distances from the coding sequences, such as enhancers, LCRs and MARs. In this respect, S. cerevisiae is a particularly convenient cloning system because the high efficiency of homologous recombination in this organism renders the genetic engeneering of the insert fairly easy. For instance, terminal or interstitial deletions of the YAC insert can be produced in order to define minimal constructs, or minigenes, that exhibit fully regulated expression of the transgene. Another attractive possibility is the introduction of known pathogenic point mutations with a dominant effect in the transgene in order to create animal models of genetic diseases. Linear YACs generally integrate into the host genome, although Featherstone and Huxley (1993) showed that extrachromosomal elements could be observed. The presence of unique restriction sites such as I-SceI (Monteillet et al., 1990) and the Achille’s heel cleavage site contained in the lacOp sequence ( Koob and Szybalski, 1990) should facilitate cloning and affinity purification of the insertion site. The characterization of insertion sites is an issue of concern in the context of gene therapy applications, because of the possibility of

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

a deleterious effect of the transgene’s insertion on an endogenous gene located at the site of insertion, and of the chromatin environment on expression of the transgene. The identification of neutral sites of insertion is therefore of practical importance, because techniques can then be devised to target transgene integration to these sites. An alternative would be to maintain the YAC in an episomal form in the host cell. The circularization of YACs by loxP/Cre recombination, as well as the addition to the vector of the replication origin identified in the 5∞ region of the c-myc gene (Iguchi-Ariga et al., 1988; Sudo et al., 1990), may enhance the ability of the transgenes to remain episomal. The presence of the synthetic MAR (Bode et al., 1992) should stabilize the transgene in the nucleus and might, in addition, favour the autonomous replication of the transgene, since it has been suggested that MARs and origins of replication are overlapping (Boulikas, 1992). Furthermore, the loxP site may serve as a cloning site for the easy introduction of any type of genetic element in circular YACs, such as sequences that potentially enable the episomal maintenance of the transgene in mammalian cells (origins of replication, MARs and candidate centromeric segments). In this respect, circular YACs cloned in the vector described herein may serve as the backbone for testing new elements towards the assembly of mammalian artificial chromosomes.

Acknowledgement This work was supported by grants from the Association Franc¸aise de Lutte contre la Mucoviscidose, the Association Franc¸aise contre les Myopathies, the Fondation pour la Recherche Me´dicale, the Association de Recherche sur le Cancer, the Conseil Re´gional d’Aquitaine and the Institut National de la Sante´ et de la Recherche Me´dicale (CRI 9508). PJR benefited from a Student Fellowship from AFLM.

References Abremski, K., Hoess, R., Sternberg, N., 1983. Studies on the properties of P1 site-specific recombination: evidence for topologically unlinked products following recombination. Cell 32, 1301–1311. Alton, E.W.F.W., Middleton, P.G., Caplen, N.J., Smith, S.N., Steel, D.M., Munkonge, F.M., Jeffery, P.K., Geddes, D.M., Hart, S.L., Williamson, R., Fasold, K.I., Miller, A.D., Dickinson, P., Stevenson, B.J., McLachlan, G., Dorin, J.R., Porteous, D.J., 1993. Non-invasive liposome-mediated gene delivery can correct the ion transport defect in cystic fibrosis mutant mice. Nature Genet. 5, 135–142. Anand, R., Ogilvie, D.J., Butler, R., Riley, J.H., Finniear, R.S., Powell, S.J., Smith, J.C., Markham, 1991. A yeast artificial chromosome encompassing the cystic fibrosis locus. Genomics 9, 124–130. Bode, J., Kohwi, Y., Dickinson, L., Joh, T., Klehr, D., Mielke, C., Kohwi-Shigematsu, T., 1992. Biological significance of unwinding

171

capability of nuclear matrix-associating DNAs. Science 255, 195–197. Boeke, J.D., LaCroute, F., Fink, G.R., 1984. A positive selection for mutants lacking orotidine-5∞-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197, 345–346. Boulikas, T., 1992. Homeotic protein binding sites, origins of replication and nuclear matrix anchorage sites share the ATTA and ATTTA motifs. J. Cell. Biochem. 50, 111–123. Burke, D.F., Carle, G.F., Olson, M.V., 1987. Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236, 806–812. Featherstone, T., Huxley, C., 1993. Extrachromosomal maintenance and amplification of yeast artificial chromosome DNA in mouse cells. Genomics 17, 267–278. Gasser, S.M., Laemmli, U.K., 1987. A glimpse at chromosomal order. Trends Genet. 3, 16–22. Greaves, D.R., Wilson, F.D., Lang, G., Kioussis, D., 1989. Human CD2 3∞-flanking sequences confer high-level, T cell-specific, positionindependent gene expression in transgenic mice. Cell 56, 979–986. Gossen, J.A., de Leeuw, W.J.F., Molijn, A.C., Vijg, J., 1993. Plasmid rescue from transgenic mouse DNA using lacI repressor protein conjugated to magnetic beads. BioTechniques 14, 624–629. Gross, D.S., Garrard, W.T., 1987. Poising chromatin for transcription. Trends Biochem. Sci. 12, 293–297. Grosveld, F., Blom van Assendelft, G., Greaves, D.R., Kollias, G., 1987. Position-independent, high-level expression of the human bglobin gene in transgenic mice. Cell 51, 975–985. Huxley, C., Passage, E., Manson, A., Putzu, G., Figarella-Branger, C., Pellissier, J.F., Fontes, M., 1996. Construction of a mouse model of Charcot-Marie-Tooth disease type 1A by pronuclear injection of human YAC DNA. Hum. Mol. Genet. 5, 563–569. Iguchi-Ariga, S.M.M., Okazaki, T., Itani, T., Ogata, M., Sato, Y., Ariga, H., 1988. An initiation site of DNA replication with transcriptional enhancer activity present upstream of the c-myc gene. EMBO J. 7, 3135–3142. Klehr, D., Maass, K., Bode, J., 1991. Scaffold-attached regions from the human interferon b domain can be used to enhance the stable expression of genes under the control of various promoters. Biochemistry 30, 1264–1270. Koob, M., Szybalski, W., 1990. Cleaving yeast and Escherichia coli genomes at a single site. Science 250, 271–273. Lundeberg, J., Wahlberg, J., Uhlen, M., 1990. Affinity purification of specific DNA fragments using a lac repressor fusion protein. Genet. Anal. Techn. Appl. 7, 47–52. Maule, J.C., Porteous, D.J., Brookes, A.J., 1994. An improved method for recovering intact pulsed field gel purified DNA, of at least 1.6 Mb. Nucl. Acids Res. 22, 3245–3246. McKnight, R.A., Shamay, A., Sankaran, L., Wall, R.J., Hennighausen, L., 1992. Matrix-attachment regions can impart position-independent regulation of a tissue-specific gene in transgenic mice. Proc. Natl. Acad. Sci. USA 89, 6943–6947. Mirkovitch, J., Mirault, M.E., Laemmli, U.K., 1984. Organization of the higher-order chromatin loop: specific DNA attachment sites on nuclear scaffold. Cell 39, 223–232. Monteillet, C., Perrin, A., Thierry, A., Colleaux, L., Dujon, B., 1990. Purification and characterization of the in vitro activity of I-Sce I, a novel and highly specific endonuclease encoded by a group I intron. Nucl. Acids Res. 18, 1407–1413. Nishiwaki, K., Hayashi, N., Irie, S., Chung, D.H., Harashima, S., Oshima, Y., 1987. Structure of the yeast HIS5 gene responsive to general control of amino acid biosynthesis. Mol. Gen. Genet. 208, 159–167. Petit, J., Boisseau, P., Arveiler, B., 1994. Glucanex: a cost effective yeast lytic enzyme. Trends Genet. 10, 4–5. Phi-Van, L., Von Kries, J.P., Ostertag, W., Stratling, W.H., 1990. The chicken lysozyme 5∞ Matrix Attachment Region increases transcrip-

172

P.-J. Ripoll et al. / Gene 210 (1998) 163–172

tion from a heterologous promoter in heterologous cells and dampens position effects on the expression of transfected genes. Mol. Cel. Biol. 10, 2302–2307. Sauer, B., 1987. Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 2087–2096. Schedl, A., Montoliu, L., Kelsey, G., Schftz, G., 1993. A yeast artificial chromosome covering the tyrosinase gene confers copy numberdependent expression in transgenic mice. Nature 362, 258–261. Schedl, A., Ross, A., Lee, M., Engelkamp, D., Rashbass, P., van Heyningen, V., Hastie, N.D., 1996. Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell 86, 71–82. Smith, D.R., Smith, A.P., Strauss, W.M., Moir, D.T., 1993. Incorpora-

tion of copy-number control elements into yeast artificial chromosomes by targeted homologous recombination. Mammalian Genome 4, 141–147. Stief, A., Winter, D.M., Stratling, W.H., Sippel, A.E., 1989. A nuclear DNA attachment element mediates elevated and position independent gene activity. Nature 341, 343–345. Sudo, K., Ogata, M., Sato, Y., Iguchi-Ariga, S.M.M., Ariga, H., 1990. Cloned origin of DNA replication in c-myc gene can function and be transmitted in transgenic mice in an episomal state. Nucl. Acid Res. 18, 5425–5432. Thomas, K.R., Capecchi, M.R., 1987. Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51, 503–512. Walker, S.S., Malik, A.K., Eisenberg, S., 1991. Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucl. Acid Res. 19, 6255–6262.