A new zinc chelator, IPZ-010 ameliorates postoperative ileus

Biomedicine & Pharmacotherapy 123 (2020) 109773

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

A new zinc chelator, IPZ-010 ameliorates postoperative ileus a,1

a,1

a

a

T b

Hitomi Kimura , Yutaka Yoneya , Shoma Mikawa , Noriyuki Kaji , Hiroki Ito , Yasuaki Tsuchidac, Hirotsugu Komatsub, Takahisa Muratad, Hiroshi Ozakia, Ryota Uchidaf, Keigo Nishidae,f, Masatoshi Horia,* a

Department of Veterinary Pharmacology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan Interprotein Corporation, 3-10-2 Toyosaki, Kita-ku, Osaka-city, Osaka 531-0072, Japan c Department of Surgical Pathology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya-city, Hyogo 663-8501, Japan d Department of Animal Radiology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan e Laboratory for Homeostatic Network, RCAI, RIKEN Research Center for Integrative Medical Sciences (IMS-RCAI), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama-city, Kanagawa 230-0045, Japan f Laboratory of Immune Regulation, Graduate School of Pharmaceutical Sciences, Suzuka University of Medical Science, 3500-3 Minamitamagaki-cho, Suzuka-city, Mie 513-8607, Japan b

A R T I C LE I N FO

A B S T R A C T

Keywords: Zinc Mast cells Macrophages Postoperative ileus Inflammation

Zinc was discovered to be a novel second messenger in immunoreactive cells. We synthesized a novel free zinc chelator, IPZ-010. Here, we investigated the effects of IPZ-010 in a mouse postoperative ileus model and determined the effects of zinc signal inhibition as a new therapeutic strategy against postoperative ileus. Zinc waves were measured in bone marrow-derived mast cells (BMMCs) loaded with a zinc indicator, Newport green. Degranulation and cytokine expression were measured in BMMCs and bone marrow-derived macrophages (BMDMs). Postoperative ileus model mice were established with intestinal manipulation. Mice were treated with IPZ-010 (30 mg/kg, s.c. or p.o.) 1 h before and 2 h and 4 h after intestinal manipulation. Gastrointestinal transit, inflammatory cell infiltration, and expression of inflammatory mediators were measured. Free zinc waves occurred following antigen stimulation in BMMCs and were blocked by IPZ-010. IPZ-010 inhibited interleukin-6 secretion and degranulation in BMMCs. IPZ-010 inhibited tumor necrosis factor-α mRNA expression in BMMCs stimulated with lipopolysaccharide or adenosine triphosphate, whereas IPZ-010 had no effects on tumor necrosis factor-α mRNA expression in BMDMs stimulated with lipopolysaccharide or adenosine triphosphate. In postoperative ileus model mice, IPZ-010 inhibited leukocyte infiltration and cytokine expression, which ameliorated gastrointestinal transit. Furthermore, ketotifen (1 mg/kg) induced similar effects as IPZ-010. These effects were not amplified by co-administration of IPZ-010 and ketotifen. IPZ-010 inhibited zinc waves, resulting in inhibition of inflammatory responses in activated BMMCs in vitro. Targeting zinc waves in inflammatory cells may be a novel therapeutic strategy for treating postoperative ileus.

1. Introduction Postoperative ileus, which is transient hypomotility of the gastrointestinal tract, is a common problem after surgical trauma to the abdominal cavity and other types of surgery [1,2]. Postoperative ileus results in discomfort after surgery, increased medical costs due to prolonged hospitalization, and an increased risk of secondary complications. Medical care costs in the United States due to postoperative ileus are estimated at US$1.47 billion per year [3].

Recent advances in our understanding of the underlying pathophysiology of postoperative ileus have identified the main mechanism as local intestinal inflammation triggered by manipulation of the intestine. Surgical tissue damage leads to the release of damage-associated molecular patterns, such as adenosine triphosphate (ATP), which in turn may activate resident muscularis macrophages [2,4]. These activated macrophages are important in the development of intestinal muscularis inflammation following intestinal manipulation [5,6]. Production of inflammatory cytokines and chemokines enhances vascular

Abbreviations: BMMCs, bone marrow-derived mast cells; BMDMs, bone marrow-derived macrophages; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; LPS, lipopolysaccharide; ATP, adenosine triphosphate ⁎ Corresponding author at: Department of Veterinary Pharmacology, Graduate School of Agriculture and Life Sciences, The University of Tokyo, 1−1−1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan. 1 These authors have equal contribution. https://doi.org/10.1016/j.biopha.2019.109773 Received 1 October 2019; Received in revised form 29 November 2019; Accepted 4 December 2019 0753-3322/ © 2019 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

were initially thought to be effective for treating postoperative ileus, this has not been the case [1,24]. The μ-opioid receptor antagonist alvimopan has been reported to provide clinical improvement in bowel function in patients who have undergone abdominal surgery [25–27]. The prokinetic agent mosapride citrate, which is a serotonin 4 receptor agonist, ameliorates postoperative ileus in Japanese patients [28]. Recent evidence using an experimental model animal for postoperative ileus and gastric ulcers induced by non-steroidal anti-inflammatory drugs revealed that stimulation of the serotonin 4 receptor has antiinflammatory action via activation of α7 nicotinic acetylcholine receptors on macrophages [10,11,29]. However, pharmacological management of postoperative ileus in patients remains unsatisfactory, and new treatments are needed. In the present study, we examined whether a new zinc chelator, IPZ010, may ameliorate the pathogenesis of postoperative ileus possibly by preventing zinc waves. IPZ-010 significantly suppressed zinc waves in activated mast cells in vitro, which in turn inhibited degranulation and cytokine mRNA expression. Oral and subcutaneous administration of IPZ-010 also ameliorated inflammation due to intestinal manipulation, possibly by targeting inflammatory cells. Thus, targeting zinc signaling could be a new therapeutic and/or prophylactic strategy for postoperative ileus.

permeability, which in turn induces infiltration of monocytes and neutrophils into the inflamed region [2,7]. Tumor necrosis factor-α (TNF-α), Interleukin-1β (IL-1β), IL-6, Monocyte chemoattractant protein-1 (MCP-1), Macrophage inflammatory protein-1α (MIP-1α) and Intercellular adhesion molecule-1 (ICAM-1) play important role to initiate inflammation in postoperative ileus. Other inflammatory mediators such as cyclooxygenase-2 (COX-2)-induced prostaglandin E2 and inducible nitric oxide synthase (iNOS)-produced nitric oxide (NO) are also involved for pathogeny of postoperative ileus [8,9]. In addition, recent work revealed that intestinal muscularis resident macrophages may act as a key player of anti-inflammatory neural pathway via α7 nicotinic ACh receptor (α7nAChR) expressed on the macrophages in mice [4]. On the other hand, infiltrated monocyte derived macrophages rather than un-stimulated intestinal resident muscularis macrophages expressed α7nAChR in postoperative ileus model [10] and gastric mucosal ulcers [11] in rat. Committed mast cell progenitors in peripheral blood develop to mature mast cells after moving out into the peripheral tissues [12]. The peripheral and peritoneal mast cells are considered important immunoreactive cells for the induction of postoperative ileus. The importance of mast cells in the process of postoperative ileus induction was demonstrated in experiments using mast cell stabilizers and W/Wv mutant mice, which lack mast cells [2,13]. Ketotifen or doxantrazole, mast cell stabilizers, ameliorate the inflammatory responses and impaired gastrointestinal transit in postoperative ileus model mice. Intestinal manipulation triggers intestinal mast cell activation that induces the inflammation associated with prolonged postoperative ileus in patients [14] as well as the animal model. Taken together, macrophages residing in the muscularis externa and mast cells may be the key players in this inflammatory cascade [2]. However, most recent work argues against mast cells as a key player to induce postoperative ileus by using CPa3cre/+ mast cell deficient mice [15]. Zinc is an essential nutrient and a structural constituent of many proteins including enzymes and transcription factors [16]. Recent studies have shown that cytosolic free zinc ions (Zn2+) act as an intracellular second messenger in many types of immunoreactive cells [17–19,48]. Yamasaki and co-workers provided the first evidence that cross-linking of the high-affinity immunoglobulin E receptor (FcεRI) increases the release of intracellular cytoplasmic Zn2+, a phenomenon called a “zinc wave”, from the endoplasmic reticulum in mast cells [17]. Treatment with the zinc chelator N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN) inhibits FcεRI-induced interleukin (IL)-6 and tumor necrosis factor (TNF)-α mRNA expression in accordance with a decrease in zinc waves. Zinc waves can also be induced by lipopolysaccharide (LPS) stimulation of human monocytes and RAW264.7 macrophages [18]. TPEN completely blocks activation of LPS-mediated intracellular signal transduction involving mitogen-activated kinases and nuclear factor-κB to inhibit cytokine production. These findings provide new insight that regulation of zinc waves may be a new strategy for treating inflammatory and autoimmune diseases. TPEN is a membrane-permeable zinc chelator. In vitro analysis has shown that TPEN is a useful chelator for determining the importance of Zn2+ in cell signaling [17,20]. In some reports, TPEN also induces therapeutic actions against allergic diseases. Intraperitoneal administration of TPEN significantly inhibits antigen-stimulated passive cutaneous anaphylaxis and passive systemic anaphylaxis [20]. TPEN also attenuates airway hyper-responsiveness and eosinophilic inflammation in a mast cell-dependent mouse model of allergic asthma [21]. On the other hand, TPEN has severe adverse effects. Administration of high concentrations of TPEN (over 30 mg/kg) produces acute toxicity leading to convulsion and death within several minutes [22]. Heavy metal chelators such as TPEN also have neuronal cytotoxicity in the hippocampus [23]. Thus, development of safer zinc chelators is needed for clinical applications. Pharmacological management of postoperative ileus has gradually advanced. Although classical prokinetic agents such as metoclopramide

2. Materials and methods 2.1. Cell culture Bone marrow-derived mast cells (BMMCs) were obtained as described [30,31]. Briefly, bone marrow cells isolated from C57BL/6 J mice (Charles River, Kanagawa, Japan) were cultured in RPMI 1640 medium (Sigma-Aldrich Japan, Tokyo, Japan) supplemented with 100 μM 2-mercaptoethanol, 10 % fetal bovine serum (FBS; Nichirei Bioscience, Tokyo, Japan), 100 U/mL penicillin, 100 μg/mL streptomycin (Life Technologies, Grand Island, NY, USA), and 10 μg/mL recombinant mouse IL-3 (Sigma). More than 90 % of the cells were identified as immature mast cells 4 weeks after initiation of the culture. BMMC cultures in which > 80 % of cells expressed the c-kit antigen were used. In some experiments, the BMMCs were sensitized with 100 ng/mL anti-dinitrophenol (DNP) IgE mice antibody (SPE-7; Sigma) before use for activation. Bone marrow-derived macrophages (BMDMs) were obtained as previously described [32]. Cultured bone marrow cell aggregates were dispersed by passing through a 25-gauge needle. The suspended cells were cultured in RPMI 1640 medium containing 10 % FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, and 10 % L929 cell-containing medium as a source of macrophage colony-stimulating factor. BMDMs were obtained as an adherent cell population following 7 days of culture, and BMDM cultures in which > 80 % of cells expressed the F4/80 antigen were used. 2.2. Mast cell degranulation Mast cell degranulation was monitored by release of β-hexosaminidase [20,33]. In brief, sensitized BMMCs (2 × 105 cells per tube) were washed with PIPES-buffered solution (40 mM NaCl, 5 mM KCl, 5.5 mM glucose, 0.6 mM MgCl2, 1.5 mM CaCl2, 10 mM PIPES, and 0.1 % bovine serum albumin (BSA; Prospec-Tany Technogene LTD, Rehovot, Israel), pH 7.4). BMMCs were stimulated by adding dinitrophenylated human serum albumin (DNP-HSA; 5 ng/mL) at 37 °C with gentle rotation. The supernatant was transferred to a 96-well plate, and the remaining cell pellet after removal of the supernatant was suspended in 0.5 % Triton X-100 solution. The cell suspension was centrifuged by 10,000 xg, for 10 min at 4 °C, and the cell extract was transferred to a 96-well plate. p-nitrophenyl-N-acetyl-p-D-glucosamide (1.3 mg/mL; Sigma) in 0.04 M sodium citrate (pH 4.5) was added to each well and incubated at 37 °C for 1 h. Then, glycine (0.2 M, pH 10.0) 2

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

Fig. 1. Chemical structure of the newly synthesized zinc chelator IPZ-010 and effects of IPZ-010 on zinc waves, IL-6 secretion, and degranulation in BMMCs. A: Chemical structure of IPZ-010 (IPZ). B: Effect of IPZ-010 (10 μM) on antigen-induced zinc waves in sensitized BMMCs. Calculated values from 4 independent experiments are shown. Each closed circle and bar showed mean ± SEM. BMMCs were sensitized with anti-DNP IgE and stimulated with 5 ng/mL DNP-HSA as the antigen. Cytosolic Zn2+ movement, called zinc waves, were measured using Newport green. C: The effect of IPZ-010 on secretion of IL-6 for 30 min in sensitized BMMCs stimulated with DNP-HSA (5 ng/mL). Typical results of 4 independent experiments are shown. D: The effect of IPZ-010 and TPEN on degranulation of sensitized BMMCs stimulated with DNP-HSA. Each plot shows the mean ± SEM (n = 4 each).

MicroImaging, Inc. Tokyo, Japan) with an oil plan Neofluar 100 × NA 1.3 objective (Carl Zeiss MicroImaging, Inc.), CCD camera (CoolSnap HQ; Roper Scientific, Tokyo, Japan), and the system control application SlideBook (Intelligent Imaging Innovation) at 25 °C.

was added to each well, and the absorbance at 405 nm (optical density (OD)) was measured with a multilabel counter (Perkin Elmer Japan, Kanagawa, Japan). The percentage of degranulation was calculated using the following formula: % degranulation = ODsupernatant / (ODsupernatant + ODTriton X-100) ×100

2.6. Animals and the postoperative ileus model The Institutional Review Board of the University of Tokyo approved the animal care. All experimental protocols (approval code P13-815) were performed in strict compliance with the Guide for Animal Use and Care published by the University of Tokyo and in accordance with the ARRIVE guidelines for reporting experiments involving animals. Balb/c mice or C57BL/6 J mice (Charles River, Kanagawa, Japan) were housed under controlled conditions (8–12 weeks of age, 12 h light/dark cycle). A total of 135 animals were used in the experiments described here. Balb/c mice and C57/BL/6 J mice were used in vitro and in vivo experiments, respectively. Balb/c mice were anesthetized with pentobarbital sodium (Kyoritsu Seiyaku, Tokyo, Japan) to create a mouse model of postoperative ileus using intestinal manipulation as described [6,9]. Briefly, the abdominal wall was opened with a midline laparotomy. The distal ileum (about 10 cm) was carefully exteriorized and manipulated three times with a sterile cotton stick moisturized with sterile physiological saline. After intestinal manipulation, the ileum was placed back into the abdominal cavity, and the abdominal wall was closed with two layers of interrupted sutures. After the surgical procedure, mice were positioned on a heating pad at around 36 °C until they recovered from the anesthesia. Pharmacological treatment such as analgesic agents could not be used to avoid influencing the outcome of the study. We confirmed that pathological profiles by surgical manipulation were same with other postoperative ileus model previously reported [7,13]

2.3. IL-6 secretion by mast cells BMMCs were activated as described above, and IL-6 in the cell culture supernatant was measured with an ELISA kit (Cayman, Ann Arbor, MI, USA). 2.4. Expression of TNF-α mRNA in BMMCs and BMDMs BMMCs and BMDMs (2 × 106 cells per dish) were starved in phosphate-buffered saline at 37 °C for 10 h before the experiment. LPS (300 ng/mL or 1 μg/mL in BMDMs or BMMCs, respectively) or ATP (300 μM) was added, and the stimulated cells were incubated for 2 h at 37 °C. IPZ-010 (10 μM) was added 30 min before adding ATP or LPS. Total RNA was extract 2 h after stimulation with LPS or ATP, and reverse-transcription polymerase chain reaction (RT-PCR) was performed as described below. 2.5. Zinc wave measurement in BMMCs Zinc wave measurement was performed as described [17]. Briefly, IgE-sensitized BMMCs were suspended in HEPES buffer (10 mM HEPES (pH 7.4), 130 mM NaCl, 5 mM KCl, 1.4 mM CaCl2, 1 mM MgCl2, and 5.6 mM glucose). BMMCs were allowed to adhere to a poly-L-lysinecoated glass-bottom dish and incubated with 10 μM Newport green (Invitrogen) for 30 min at 37 °C. Cells were stimulated with 100 ng/mL DNP-HSA at 37 °C. The images of fluorescent signals were captured every 30 s with an inverted microscope (Axiovert 200 MO; Carl Zeiss

2.7. Experimental design and preparation of drugs The mice were randomly assigned to the following groups: Control: 3

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

two researchers independently.

Table 1 Primer sets and predicted sizes of RT-PCR products. Gene name

Forward / Revers

Sequences (5′ to 3′)

Expected size (bp)

Mcp1

Forward Revers Forward Revers Forward Revers Forward Revers Forward Revers

TTTTGTCACCAAGCTCAAGA GGTTGTGGAAAAGGTAGTGG TGACGTTCCCATTAGACAGC TGGGGAAGGCATTAGAAACA TCTCTGGGAAATCGTGGAAA GATGGTCTTGGTCCTTAGCC AAATGGGCTCCCTCTCATCA AGCCTTGTCCCTTGAAGAGA CAGGGCTGCTTTTAATTCTG AGCACCAGCATCACCCCACT

381

Il1b Il6 Tnf Gapdh

2.9. Determination of intestinal transit After fasting for 24 h, the mice were randomly assigned to one of four groups (Control, IPZ-010, intestinal manipulation, and intestinal manipulation + IPZ-010). IPZ-010 was subcutaneously administered as described above. Twenty-three hours after intestinal manipulation in mice, 100 μl of the non-absorbable marker 0.25 % (w/v) phenol red in 5 % (w/v) glucose was orally placed in their stomach with a gastric tube. One hour after the treatment, the gastrointestinal region was isolated from the abdominal cavity. The intestinal and colonic parts were divided into 10 (SI1-SI10) and three (Co1-Co3) segments at equal intervals. The stomach and cecum were each separated as a single segment (Sto, Cec). Measurement of phenol red in each segment was performed as previously described [35]. The solutions containing phenol red were read using a spectrophotometer (560 nm wavelength) [35]. The volume of phenol red in each segment and the geometric center of distribution were calculated as described [9,36].

497 397 324 269

untreated and with fasting; intestinal manipulation: subcutaneously injected with same volume of sterile solvent; intestinal manipulation + IPZ-010 (30 mg/kg): IPZ-010 was subcutaneously (s.c.) or orally (p.o.) administered to postoperative ileus mice 1 h before and 2 and 4 h after IM. Previously we used TPEN at concentration of 30 mg/ kg i.p. in in vivo experiments [20]. As shown in Fig. 1A, IPZ-010 contains chemical structure of TPEN. In addition, half-life (t1/2) of IPZ-010 is so fast as shown in Supplementary Fig. 1. Based on the information, we decided administration method of IPZ-010 as mentioned above. In some experiments, ketotifen (1 mg/kg) was subcutaneously injected 1 h before and 2 and 4 h after intestinal manipulation, as a tool for stabilizer against mast cells. TPEN (1 mg/kg) was also subcutaneously injected 1 h before intestinal manipulation. In this study, laparotomy and intestinal manipulation were considered the postoperative ileus model, because laparotomy alone transiently increases proinflammatory cytokine expression [34]. The solvent for subcutaneous administration of IPZ-010 was sterilized physiological salt solution containing 2 % ethanol and 0.01 % Tween 20. The solvent for oral administration of IPZ-010 was the same solvent plus 0.5 % carboxymethylcellulose. The solvent for TPEN was a cocktail of ethanol, glyceline, and distilled water (1:3:6). The solvent for ketotifen was physiological salt solution.

2.10. Semi-quantitative RT-PCR Total RNA was extracted from muscularis preparations without the mucosal layer using the acid guanidinium isothiocyanate-phenol chloroform method with the TRIzol Reagent (Invitrogen Japan, Tokyo, Japan), and concentrations of RNA were adjusted to 1 μg/μL with RNase-free distilled water. Semi-quantitative RT-PCR was performed as previously reported [10]. Gene-specific primers for IL-1β, IL-6, TNF-α, macrophage chemoattractant protein-1 (MCP-1), and glyceraldehyde 3phosphate dehydrogenase (GAPDH) are listed in Table 1. The PCR products from each cycle were electrophoresed on 2 % agarose gels containing 0.1 % ethidium bromide, and the suitable PCR cycle was chosen for quantitation. Possible DNA contamination was excluded by performing PCR using total RNA without reverse transcription. Fluorescent bands were visualized using an ultraviolet trans-illuminator using FAS-III (Toyobo Life Science, Osaka, Japan), and the density of the bands was measured using NIH Image software (Image J, Ver. 1.38x).

2.8. Whole-mount histochemistry and immunohistochemistry 2.11. Statistical analyses The distal ileal part of the intestine was isolated from mice 24 h after intestinal manipulation, cut open along the mesenteric attachment, and then the mucosal and submucosal layers were gently removed with microforceps under stereoscopic microscope. The muscularis preparation was opened up on a silicon sheet, pinned, fixed in 10 % paraformaldehyde for 24 h at 4 °C, cut into 1 cm squares, and washed with Tris-buffered saline (TBS) twice for 30 min at room temperature. Myeloperoxidase (MPO) histochemical staining was performed as described [6,15]. The preparations were stained with physiological salt solution containing 0.1 % (w/v) Hanker-Yates reagent (Polyscience, Warrington, PA, USA) and 0.03 % (v/v) hydrogen peroxide (Mitsubishi Gas Chemical Company, Tokyo, Japan) for 5 min, washed for 10 min in phosphate-buffered saline, and mounted on glass slides. For immunohistochemistry, the fixed whole-mount preparations were washed with TBS, permeabilized with 0.2 % Triton-X-100 and 2 % BSA in TBS for 2 h, and rinsed with 2 % BSA in TBS for 30 min. The permeabilized preparations were incubated with rat anti-mouse CD68 antibody (1:500; Serotec Ltd., Oxford, UK) in TBS with 2 % BSA at 4 °C overnight and then washed for 2 h in TBS. The preparations were labeled with goat anti-rat IgG Alexa Flour 488 secondary antibody (1:250; Life Technologies, Carlsbad, CA, USA) for 90 min at room temperature. The number of MPO-positive neutrophils and CD68-positive macrophages were counted in four randomly selected areas of each preparation under an ACT-1C for DXM1200C microscope (Nikon, Tokyo, Japan), and the average number of infiltrating cells was calculated by

Statistical data are expressed as the means ± SEM. Data were analyzed using unpaired Student’s t tests for comparisons between two groups and one-way analysis of variance (ANOVA) followed by Dunnett’s test for comparisons among multiple groups. P values < 0.05 were considered statistically significant. 3. Results 3.1. Characteristics of new zinc chelator, IPZ-010, and effects of IPZ-010 on zinc waves and immunoreactivity in BMMCs As shown in Fig. 1A, we synthesized a new membrane permeable Zn2+ chelator, IPZ-010 [IPZ; 2-(3-trifluoromethyl phenylamino) benzoic acid 2-[N, N-bis(2-pyridinemethyl) amino] ethyl ester, MW; 506.52]. In vitro analysis revealed a Ki value of 1 μM against Zn2+ and no interaction with Ca2+ in cells. IPZ-010 contains chemical structure of TPEN. In vivo pharmacokinetic analysis showed that administrated IPZ-010 (10 mg/kg) by i.v. was quickly metabolized within 3−4 h (Tmax; 5 min, t1/2; 0.35 h; Supplementary Fig. 1). IPZ-010 did not show any toxicity until 100 mg/kg during 24 h after administration by i.v.. In addition, IPZ-010 did not show any skin toxicity of mice ear when 1 % IPZ-010 was administered once a day for 4 weeks to right ear of mice (Supplementary Fig. 1D). In contrast, same concentration of TPEN lead to thickening of ear of mice. We next measured cytoplasmic zinc waves in BMMCs that were pre4

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

activated with SPE-7 (1 μg/mL) for 12 h. DNP-HSA (5 ng/mL) increased the fluorescent signal of Newport green, indicating increments of cytoplasmic Zn2+ levels following antigen stimulation (7.5 min after addition of antigen; 1.501 ± 0.068, n = 4). IPZ-010 (10 μM) significantly suppressed the zinc waves (Fig. 1B; 5 min after addition of IPZ-010; 1.150 ± 0.053, P < 0.001 vs value before addition of IPZ-010, n = 4). DNP-HSA also induced IL-6 protein and degranulation, which were both inhibited by IPZ-010 (10 μM) in a concentration-dependent manner (Fig. 1C and D). Taken together, IPZ-010 inhibited zinc waves stimulated by antigen, which in turn inhibited degranulation and IL-6 secretion in mouse BMMCs. We further tested effect of IPZ-010 on cytosolic Ca2+ movement in living cells by using BMDMs loaded with Ca2+ indicator, fluo-3 (Supplementary Fig. 2). Application of α,β-methylene ATP, a selective P2X receptor agonist (1 mM) induced transient Ca2+ increase followed by small sustained one. IPZ-010 (10 μM) had no effect on the peak Ca2+ transient (Control; 1.35 ± 0.11, +IPZ-010; 1.46 ± 0.11, n = 4). Results indicated that IPZ-010 does not affect cytosolic Ca2+ movement in living cells.

3.4. Effect of IPZ-010 on intestinal transit in postoperative ileus Muscularis inflammation due to intestinal manipulation delays intestinal transit in postoperative ileus. Therefore, we examined the effect of IPZ-010 on gastrointestinal dysmotility induced by intestinal manipulation (Fig. 4). In the intestine of control mice, less than 10 % of orally administered phenol red remained in the stomach, whereas 10–25% of phenol red was transported down the intestine to the mid and distal ileum (SI4 to SI9). The geometric center value was 8.30 ± 2.15. Intestinal transit tended to increase slightly following administration of IPZ-010 in control mice, but the average calculated geometric center value was not significantly different from the control value (9.58 ± 2.12). In the intestine of postoperative ileus model mice, about 40 % of phenol red remained in the stomach, and 10–15% of phenol red was transported down the intestine to the upper small intestine (SI0 to SI4), indicating delayed gastrointestinal transit. The calculated geometric center value was significantly lower than control mice given IPZ-010 alone (intestinal manipulation; 2.91 ± 2.22). IPZ010 significantly improved the delayed intestinal transit caused by intestinal manipulation, in which 20 % of phenol red remained in the stomach, and 60 % of the transported phenol red content was transported to between SI4 and SI8. The geometric center was also restored to close to the control value (6.25 ± 3.48).

3.2. Effects of IPZ-010 on infiltration of macrophages and neutrophils in postoperative ileus Pharmacokinetic character of IPZ-010 indicates that administrated IPZ-010 may be quickly metabolized. On the other hand, postoperative ileus model by surgical manipulation induced transient inflammatory action, which is almost ameliorated within 48 h. Especially, inflammatory cytokines mRNA is increased within 3−6 h after intestinal manipulation, then decreased control level within 24 h after intestinal manipulation. So we performed repeated-high dose administration of IPZ-010 before and after intestinal manipulation. In the myenteric plexus region of control ileum, dendritic-formed resident macrophages stained with the CD68 antibody were seen (421.12 ± 40.44 cells/mm2), whereas in the intestinal manipulationinduced inflamed ileum, many round monocyte-derived macrophages had infiltrated (1072.54 ± 76.58 cells/mm2). Administration of IPZ010 significantly inhibited the macrophage infiltration. Oral administration of IPZ-010 induced the same inhibition of macrophage infiltration as subcutaneous administration (787.41 ± 80.57 cells/mm2 with p.o. and 722.70 ± 146.93 cells/mm2 with s.c.). IPZ-010 alone had no effect on the macrophage population in control mice (440.04 ± 90.23 cells/mm2) (Fig. 2A and B). Fig. 2C and D show MPO staining and quantification of neutrophil infiltration in the myenteric plexus region of the ileum. In control mouse intestine, neutrophils were not detected (0.52 ± 0.42 cells/ mm2). Twenty-four hours after intestinal manipulation, MPO-stained neutrophils had infiltrated into the myenteric plexus region (176.83 ± 32.69 cells/mm2). Both oral and subcutaneous administration of IPZ-010 significantly inhibited neutrophil infiltration (91.33 ± 19.22 cells/mm2 with p.o. and 64.68 ± 17.29 cells/mm2 with s.c.). Taken together, both oral and subcutaneous administration of IPZ-010 inhibited intestinal manipulation-induced leukocyte infiltration into the inflamed ileum. As shown in Supplementary Fig. 1, metabolism of IPZ-010 is so fast, IPZ-010 was subcutaneously administered in other experiments to eliminate effect of the first pass effect at intestine and liver as much as possible.

3.5. Effects of IPZ-010 on inflammatory action in BMMCs and BMDMs As shown in Fig. 1, activated BMMCs induced zinc waves that were inhibited by IPZ-010. A recent report showed that inflammatory signals in macrophages and mast cells are also regulated by zinc waves [18,49]. Therefore, we examined the effect of IPZ-010 on TNF-α mRNA expression in BMDMs (Fig. 5A and B) and BMMCs (Fig. 5C and D) that were stimulated with LPS or ATP. It was well recognized that LPS can stimulate both cells to produce TNF-α [37,38]. In contrast, it has been reported that ATP inhibited TNF-α production in peritoneal macrophages stimulated with LPS, indicating that further investigation will be necessary to clarify the effects of ATP on cytokines secretion in BMDMs. Based on these backgrounds, for both cell types, LPS (300 ng/mL or 1 μg/mL in BMDMs or BMMCs, respectively) or ATP (300 μM) significantly upregulated expression of TNF-α mRNA. IPZ-010 selectively inhibited TNF-α mRNA expression stimulated with LPS or ATP in BMMCs but not in BMDMs. 3.6. Comparison of the anti-inflammatory effects of TPEN, IPZ-010, ketotifen, and IPZ-010 plus ketotifen in postoperative ileus We compared the anti-inflammatory effects of TPEN, IPZ-010, ketotifen, and combined treatment with both IPZ-010 and ketotifen in postoperative ileus as assessed by infiltration of MPO-stained neutrophils into the ileal muscle layer. The number of MPO-stained neutrophils was increased 24 h after intestinal manipulation (216.29 ± 21.39 cells/mm2). Administration of TPEN (10 mg/kg) or ketotifen (1 mg/kg) significantly inhibited the neutrophil infiltration, similar to IPZ-010 treatment (intestinal manipulation + TPEN; 95.47 ± 19.01 cells/mm2, intestinal manipulation + ketotifen; 77.89 ± 9.17 cells/mm2, intestinal manipulation + IPZ-010; 95.63 ± 10.45 cells/mm2). In addition, combined administration of ketotifen plus IPZ-010 also induced a similar inhibitory action compared with single administration of ketotifen or IPZ-010 (intestinal manipulation + IPZ-010 + ketotifen; 79.09 ± 10.47 cells/mm2) (Fig. 6). These results showed that combined administration of the mast cell stabilizer, ketotifen, with IPZ-010 produced no synergistic anti-inflammatory effects.

3.3. Effect of IPZ-010 on mRNA expression of inflammatory mediators in postoperative ileus In the ileal muscle layer of control mice, MCP-1, IL-1β, IL-6, and TNF-α mRNAs were not detected. Messenger RNAs of all mediators were significantly increased 3 h after intestinal manipulation. IPZ-010 treatment significantly inhibited mRNA expression of all inflammatory mediators (Fig. 3).

4. Discussion Recent studies from our group have shown that cytoplasmic free 5

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

Fig. 2. Effect of IPZ-010 on CD68-positive macrophages and MPO-stained neutrophils that have infiltrated into the myenteric plexus region of the small intestine in postoperative ileus. IPZ-010 (30 mg/kg) was administered 1 h before and 2 and 4 h after intestinal manipulation (IM) via subcutaneous (s.c.) or peroral (p.o.) administration. Typical immunohistochemical images of infiltration of CD68-positive macrophages (A) and infiltration of MPO-stained neutrophils (C). Scale bars =50 μm. Quantification of infiltration of CD68-positive macrophages (B) and MPOstained neutrophils (D) into the myenteric plexus region. **P < 0.01 vs. control. ##P < 0.01 vs. IM (n = 4–6 each).

Zn2+ works as a second messenger in activated mast cells [17,20]. In the present study, we used Newport green to monitor the cytosolic Zn2+ movement, called “zinc waves”. IPZ-010 significantly inhibited zinc waves elicited by antigen stimulation. In accordance with the inhibitory action of IPZ-010 on zinc waves, elevated IL-6 secretion and degranulation were also inhibited by IPZ-010. In addition, IPZ-010 did not alter cytosolic Ca2+ movement in BMDMs. Taken together it is suggested that IPZ-010 is a strong pharmacological tool for stabilizing mast cells by chelating cytosolic Zn2+. IPZ-010 is synthesized based on the chemical structure of TPEN. However, toxicity of IPZ-010 is weaker than that of TPEN. Kd of TPEN for zinc ion is 10−16M [39]. Since the affinity of zinc finger motif for zinc ion is well known to be strong with Kd value at 10−8–10−10M. In addition, TPEN also can bind with other heavy metal such as Cu2+, Fe2+ and Mn2+ [39]. In contrast, IPZ-010 is high selectivity for zinc with a weak affinity (Kd value of 10−6M). Taken together, heavy metal ion-required proteins such as Zn finger proteins may lose heavy metal ion by TPEN but not IPZ-010, which in turn induces severe toxicity by TPEN rather than IPZ-010. Further investigation will need to clarify the point. Here we demonstrated that IPZ-010 ameliorated inflammation in postoperative ileus model mice. Subcutaneous or oral administration of IPZ-010 significantly decreased infiltration of macrophages and neutrophils into the inflamed muscle layer induced by intestinal manipulation. This result is clinically important because oral administration of IPZ-010 is still effective against postoperative ileus after the first pass effect. In this animal model for postoperative ileus, mRNA expression of

inflammatory mediators is transiently increased at 3 h after intestinal manipulation [7,40,41]. In our current study, IPZ-010 partially but significantly inhibited mRNA expression of MCP-1, IL-1β, IL-6, and TNF-α 3 h after intestinal manipulation. MCP-1 induces macrophage recruitment into the inflamed muscle layer in endotoxemic ileus and colitis [42,43], indicating that an IPZ-010-induced decrease in mRNA expression of MCP-1 may inhibit leukocyte infiltration and decrease inflammatory cytokine mRNA expression that is induced by intestinal manipulation. Taken together, IPZ-010 has anti-inflammatory effects against postoperative ileus. Motility disorder is a main symptom of postoperative ileus, and prolonged dysfunction may lead to adhesive intestinal obstruction and paralytic ileus, suggesting that treatment to prevent gastrointestinal motility disorder will be important for the prognosis of postoperative ileus [2,44,45]. In this animal model for postoperative ileus, intestinal manipulation induced delayed gastrointestinal transit, and the geometric center value was decreased. Administration of IPZ-010 clearly improved gastrointestinal transit and increased the geometric center value, whereas administration of IPZ-010 alone to healthy mice had no effect on intestinal transit. Thus, the ameliorative effects of IPZ-010 against inflammation also improved gastrointestinal transit. This may occur by blocking the effects of activated resident macrophages and recruited monocyte-derived macrophages and neutrophils. These cells induce COX-2 to produce prostaglandin E2 [36,46], which turns on iNOS expression via EP2 and EP4 receptors in an autocrine manner to produce NO, which in turn induces the motility disorder of the gastrointestinal tract [7,9,46,47]. To establish the importance of zinc movement on the pathogenesis

6

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

Fig. 3. Effect of IPZ-010 on mRNA expression of MCP-1, IL-1β, IL-6, and TNF-α in the intestinal muscle layer 3 h after intestinal manipulation. IPZ-010 (30 mg/kg) was administered subcutaneously 1 h before and 2 h after intestinal manipulation (IM). *P < 0.05, **P < 0.01 vs. IM (n = 4–6 each).

Fig. 4. Effect of IPZ-010 on intestinal transit in control and postoperative ileus model mice. IPZ-010 (30 mg/kg) was administered subcutaneously 1 h before and 2 and 4 h after intestinal manipulation (IM). Intestinal transit was examined 1 h after intake of phenol red solution and 23 h after the intestinal manipulation. A: Distribution of phenol red in the gastrointestinal tract. Quantified results from 4 to 6 independent experiments are shown. B: Effect of IPZ-010 on geometric center values. **P < 0.01 vs. control. ##P < 0.01 vs. IM (n = 4–6 each).

7

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

Fig. 5. Effects of IPZ-010 on LPS- or ATP-induced upregulation of TNF-α mRNA in BMMCs and BMDMs. BMDMs were treated with LPS (300 ng/mL) or ATP (300 μM) for 2 h. BMMCs were treated with LPS (1 μg/mL) or ATP (300 μM) for 2 h. IPZ-010 (10 μM) was added 30 min before LPS or ATP treatment. Each column shows the mean ± SEM (n = 4–6 each). **P < 0.01, *** < 0.001 vs control. ###P < 0.001 vs LPS.

similar to the effect of IPZ-010. Taken together, the new zinc chelator IPZ-010 appears to ameliorate the pathogenesis of postoperative ileus, resulting in recovery of the motility disorder. Hence, this new zinc chelator could be a new therapeutic strategy against postoperative ileus. Macrophages and neutrophils are candidate cells for mediating the pathogenesis of postoperative ileus [5–7]. Mature mast cells located in the intestine are also considered important immunoreactive cells that induce postoperative ileus in humans [2,13,14]. In contrast, using the mast cell-deficient Cpa3Cre/+ mouse strain, a recent study revealed that mast cells play no role in the pathogenesis of postoperative ileus. They argued against the use of mast cell inhibitors as a therapeutic approach to ameliorate postoperative ileus [15]. Taken together, in the current cognition, macrophages and neutrophils but not mast cells play a crucial role to induce inflammation in postoperative ileus in mice. In the present study, we propose that inhibition of zinc movement may be a useful therapy for postoperative ileus. With our in vitro examination, we confirmed that the new zinc chelator IPZ-010 inhibits zinc waves in activated mast cells in vitro, indicating that IPZ-010 may be considered a new type of mast cell stabilizer. In contrast, zinc waves are detected in human monocytes and RAW264.7 macrophages stimulated with pathogen [18]. Thus, whether IPZ-010 inhibits zinc movement in mast cells, macrophages, or both cell types is unclear. Demonstrating which cells induce zinc waves that lead to the pathogenesis of postoperative ileus will be difficult in vivo. We tried several approaches to clarify this postoperative ileus. Ketotifen is a traditional mast cell stabilizer, although this compound has multiple noteworthy effects. Treatment with ketotifen inhibited neutrophil infiltration due to intestinal manipulation, similar to IPZ-010. In addition, combined administration of ketotifen with IPZ-010 did not induce an additive antiinflammatory action against intestinal manipulation. In addition, IPZ-

Fig. 6. Effect of TPEN and ketotifen on infiltration of MPO-stained neutrophils into the myenteric plexus region of the intestine of postoperative ileus model mice. IPZ-010 (IPZ: 30 mg/kg) was subcutaneously administered 1 h before and 2 and 4 h after intestinal manipulation (IM). TPEN (10 mg/kg, s.c.) and/or ketotifen (1 mg/kg s.c.) was administered 1 h before intestinal manipulation. Quantification of infiltration of MPO-positive neutrophils into the myenteric plexus region. ##P < 0.01 vs intestinal manipulation (n = 4–6 each). Combined application of IPZ and ketotifen was not significantly different from TPEN, IPZ, ketotifen alone, respectively in mice with intestinal manipulation.

of postoperative ileus, we further investigated the effect of the commonly used zinc chelator TPEN on the inflammatory events following intestinal manipulation as assessed with MPO-stained neutrophils. Administration of TPEN significantly inhibited neutrophil infiltration 8

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

010 selectively inhibited TNF-α mRNA expression stimulated with LPS or ATP in BMMCs but not in BMDMs. Taken together, we speculate that IPZ-010 may act on mast cells to inhibit zinc movement and ameliorate postoperative ileus, although we cannot rule out the possibility that IPZ-010 will target macrophages and/or neutrophils. Further study will need to clarify target cells of IPZ-010 on postoperative ileus. Regarding to translation, many relations between human diseases and zinc are reported [50]. For example, zinc can attenuate β-amyloid protein-induced neurotoxicity. It is reported that Ca2+ channel activity is recovered by o-phenanthroline, a zinc chelator [51]. As for POI, it is reported that leucocytes such as neutrophils and monocytes are recruited in both mice and human [52]. In addition, IPZ-010 can be metabolized quickly (supplement Fig. 1), therefore it can be used safely. These reports and data suggest that zinc chelator such as IPZ-010 may be integrated into practice. In conclusion, a new zinc chelator, IPZ-010, inhibited zinc waves in activated mast cells in vitro. Administration of IPZ-010 significantly ameliorated inflammation due to intestinal manipulation, improving gastrointestinal transit, possibly by targeting immunoreactive cells. Zinc movement is important for the pathogenesis of postoperative ileus, and targeting zinc signaling could be a new therapeutic and/or prophylactic strategy for postoperative ileus.

[8]

[9]

[10]

[11]

[12] [13]

[14]

[15]

[16]

Author contributions

[17]

M.H. and K.N. designed the experiments. Y.Y., Y.T., S.M. performed in vivo experiments, H. Kimura, K.N. and N.K. performed in vitro experiments using BMMCs and BMDMs. H.I. and H. Komatsu performed organic chemistry experiments of IPZ-010. T.M., H.O. and M.H. confirmed this study, and H. Kimura and M.H. wrote the manuscript.

[18]

[19]

[20]

Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

[21]

[22]

Acknowledgements [23]

We thank Interprotein Co. Ltd. for supplying IPZ-010. This work was supported by a Grants-in-Aid for Scientific Research from The Ministry of Education, Culture, Sports, Science and Technology (No. 22658089 and No. 24248050 to M.H., No.25221205 to H.O.).

[24] [25]

[26]

Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2019.109773.

[27]

References

[28]

[1] A.J. Bauer, G.E. Boeckxstaens, Mechanisms of postoperative ileus, Neurogastroenterol. Motil. 16 (Suppl. 2) (2004) 54–60. [2] G.E. Boeckxstaens, W.J. de Jonge, Neuroimmune mechanisms in postoperative ileus, Gut 58 (9) (2009) 1300–1311. [3] S. Iyer, W.B. Saunders, S. Stemkowski, Economic burden of postoperative ileus associated with colectomy in the United States, J. Manag. Care Pharm. 15 (6) (2009) 485–494. [4] G. Matteoli, P.J. Gomez-Pinilla, A. Nemethova, M. Di Giovangiulio, C. Cailotto, S.H. van Bree, K. Michel, K.J. Tracey, M. Schemann, W. Boesmans, P. Vanden Berghe, G.E. Boeckxstaens, A distinct vagal anti-inflammatory pathway modulates intestinal muscularis resident macrophages independent of the spleen, Gut 63 (6) (2014) 938–948. [5] J.C. Kalff, W.H. Schraut, R.L. Simmons, A.J. Bauer, Surgical manipulation of the gut elicits an intestinal muscularis inflammatory response resulting in postsurgical ileus, Ann. Surg. 228 (5) (1998) 652–663. [6] J.C. Kalff, T.M. Carlos, W.H. Schraut, T.R. Billiar, R.L. Simmons, A.J. Bauer, Surgically induced leukocytic infiltrates within the rat intestinal muscularis mediate postoperative ileus, Gastroenterology 117 (2) (1999) 378–387. [7] S. Wehner, F.F. Behrendt, B.N. Lyutenski, M. Lysson, A.J. Bauer, A. Hirner,

[29]

[30]

[31]

[32]

[33]

[34]

9

J.C. Kalff, Inhibition of macrophage function prevents intestinal inflammation and postoperative ileus in rodents, Gut 56 (2) (2007) 176–185. C. Kreiss, L.A. Birder, S. Kiss, M.M. VanBibber, A.J. Bauer, COX-2 dependent inflammation increases spinal Fos expression during rodent postoperative ileus, Gut 52 (4) (2003) 527–534. J.C. Kalff, W.H. Schraut, T.R. Billiar, R.L. Simmons, A.J. Bauer, Role of inducible nitric oxide synthase in postoperative intestinal smooth muscle dysfunction in rodents, Gastroenterology 118 (2) (2000) 316–327. Y. Tsuchida, F. Hatao, M. Fujisawa, T. Murata, M. Kaminishi, Y. Seto, M. Hori, H. Ozaki, Neuronal stimulation with 5-hydroxytryptamine 4 receptor induces antiinflammatory actions via alpha7nACh receptors on muscularis macrophages associated with postoperative ileus, Gut 60 (5) (2011) 638–647. M. Fujisawa, T. Murata, M. Hori, H. Ozaki, The 5-HT4 receptor agonist mosapride attenuates NSAID-induced gastric mucosal damage, J. Gastroenterol. 45 (2) (2010) 179–186. J. Hallgren, M.F. Gurish, Mast cell progenitor trafficking and maturation, Adv. Exp. Med. Biol. 716 (2011) 14–28. W.J. de Jonge, F.O. The, D. van der Coelen, R.J. Bennink, P.H. Reitsma, S.J. van Deventer, R.M. van den Wijngaard, G.E. Boeckxstaens, Mast cell degranulation during abdominal surgery initiates postoperative ileus in mice, Gastroenterology 127 (2) (2004) 535–545. F.O. The, R.J. Bennink, W.M. Ankum, M.R. Buist, O.R. Busch, D.J. Gouma, S. van der Heide, R.M. van den Wijngaard, W.J. de Jonge, G.E. Boeckxstaens, Intestinal handling-induced mast cell activation and inflammation in human postoperative ileus, Gut 57 (1) (2008) 33–40. P.J. Gomez-Pinilla, G. Farro, M. Di Giovangiulio, N. Stakenborg, A. Nemethova, A. de Vries, A. Liston, T.B. Feyerabend, H.R. Rodewald, G.E. Boeckxstaens, G. Matteoli, Mast cells play no role in the pathogenesis of postoperative ileus induced by intestinal manipulation, PLoS One 9 (1) (2014) e85304. A.S. Prasad, Discovery of human zinc deficiency: its impact on human health and disease, Adv. Nutr. 4 (2) (2013) 176–190. S. Yamasaki, K. Sakata-Sogawa, A. Hasegawa, T. Suzuki, K. Kabu, E. Sato, T. Kurosaki, S. Yamashita, M. Tokunaga, K. Nishida, T. Hirano, Zinc is a novel intracellular second messenger, J. Cell Biol. 177 (4) (2007) 637–645. H. Haase, J.L. Ober-Blobaum, G. Engelhardt, S. Hebel, A. Heit, H. Heine, L. Rink, Zinc signals are essential for lipopolysaccharide-induced signal transduction in monocytes, J. Immunol. 181 (9) (2008) 6491–6502. M. Yu, W.W. Lee, D. Tomar, S. Pryshchep, M. Czesnikiewicz-Guzik, D.L. Lamar, G. Li, K. Singh, L. Tian, C.M. Weyand, J.J. Goronzy, Regulation of T cell receptor signaling by activation-induced zinc influx, J. Exp. Med. 208 (4) (2011) 775–785. K. Kabu, S. Yamasaki, D. Kamimura, Y. Ito, A. Hasegawa, E. Sato, H. Kitamura, K. Nishida, T. Hirano, Zinc is required for Fc epsilon RI-mediated mast cell activation, J. Immunol. 177 (2) (2006) 1296–1305. S. Fukuyama, Y. Matsunaga, W. Zhanghui, N. Noda, Y. Asai, A. Moriwaki, T. Matsumoto, T. Nakano, K. Matsumoto, Y. Nakanishi, H. Inoue, A zinc chelator TPEN attenuates airway hyperresponsiveness and airway inflammation in mice in vivo, Allergol. Int. 60 (3) (2011) 259–266. M. Adler, R.E. Dinterman, R.W. Wannemacher, Protection by the heavy metal chelator N,N,N’,N’-tetrakis (2-pyridylmethyl)ethylenediamine (TPEN) against the lethal action of botulinum neurotoxin A and B, Toxicon 35 (7) (1997) 1089–1100. M.P. Cuajungco, G.J. Lees, Diverse effects of metal chelating agents on the neuronal cytotoxicity of zinc in the hippocampus, Brain Res. 799 (1) (1998) 97–107. M.L. Seta, P.B. Kale-Pradhan, Efficacy of metoclopramide in postoperative ileus after exploratory laparotomy, Pharmacotherapy 21 (10) (2001) 1181–1186. A. Taguchi, N. Sharma, R.M. Saleem, D.I. Sessler, R.L. Carpenter, M. Seyedsadr, A. Kurz, Selective postoperative inhibition of gastrointestinal opioid receptors, N. Engl. J. Med. 345 (13) (2001) 935–940. B.G. Wolff, F. Michelassi, T.M. Gerkin, L. Techner, K. Gabriel, W. Du, B.A. Wallin, Alvimopan, a novel, peripherally acting mu opioid antagonist: results of a multicenter, randomized, double-blind, placebo-controlled, phase III trial of major abdominal surgery and postoperative ileus, Ann Surg. 240 (4) (2004) 728–734 discussion 734–725. Camilleri M. Alvimopan, A selective peripherally acting mu-opioid antagonist, Neurogastroenterol. Motil. 17 (2) (2005) 157–165. K. Narita, A. Tsunoda, K. Takenaka, M. Watanabe, K. Nakao, M. Kusano, Effect of mosapride on recovery of intestinal motility after hand-assisted laparoscopic colectomy for carcinoma, Dis. Colon Rectum 51 (11) (2008) 1692–1695. A. Tsukamoto, K. Ohno, S. Maeda, K. Nakashima, K. Fukushima, Y. Fujino, M. Hori, H. Tsujimoto, Effect of mosapride on prednisolone-induced gastric mucosal injury and gastric-emptying disorder in dog, J. Vet. Med. Sci. 74 (9) (2012) 1103–1108. K. Nishida, S. Yamasaki, Y. Ito, K. Kabu, K. Hattori, T. Tezuka, H. Nishizumi, D. Kitamura, R. Goitsuka, R.S. Geha, T. Yamamoto, T. Yagi, T. Hirano, Fc{epsilon} RI-mediated mast cell degranulation requires calcium-independent microtubuledependent translocation of granules to the plasma membrane, J. Cell Biol. 170 (1) (2005) 115–126. T. Oka, M. Hori, H. Ozaki, Microtubule disruption suppresses allergic response through the inhibition of calcium influx in the mast cell degranulation pathway, J. Immunol. 174 (8) (2005) 4584–4589. G.M. Gersuk, L.W. Razai, K.A. Marr, Methods of in vitro macrophage maturation confer variable inflammatory responses in association with altered expression of cell surface dectin-1, J. Immunol. Methods 329 (1–2) (2008) 157–166. T. Oka, M. Hori, A. Tanaka, H. Matsuda, H. Karaki, H. Ozaki, IgE alone-induced actin assembly modifies calcium signaling and degranulation in RBL-2H3 mast cells, Am. J. Physiol., Cell Physiol. 286 (2) (2004) C256–263. M. Kiyosue, M. Fujisawa, K. Kinoshita, M. Hori, H. Ozaki, Different susceptibilities of spontaneous rhythmicity and myogenic contractility to intestinal muscularis

Biomedicine & Pharmacotherapy 123 (2020) 109773

H. Kimura, et al.

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

inflammation, Am. J. Physiol., Cell Physiol. 294 (2) (2008) C391–401. [44] E.H. Livingston, E.P. Passaro Jr., Postoperative ileus, Dig. Dis. Sci. 35 (1) (1990) 121–132. [45] D. Menzies, Postoperative adhesions: their treatment and relevance in clinical practice, Ann. R. Coll. Surg. Engl. 75 (3) (1993) 147–153. [46] M. Hori, M. Kita, S. Torihashi, S. Miyamoto, K.J. Won, K. Sato, H. Ozaki, H. Karaki, Upregulation of iNOS by COX-2 in muscularis resident macrophage of rat intestine stimulated with LPS, Am. J. Physiol. Gastrointest. Liver Physiol. 280 (5) (2001) G930–938. [47] T. Tajima, T. Murata, K. Aritake, Y. Urade, M. Michishita, T. Matsuoka, S. Narumiya, H. Ozaki, M. Hori, EP2 and EP4 receptors on muscularis resident macrophages mediate LPS-induced intestinal dysmotility via iNOS upregulation through cAMP/ERK signals, Am. J. Physiol. Gastrointest. Liver Physiol. 302 (5) (2012) G524–534. [48] K. Nishida, R. Uchida, Role of zinc signaling in the regulation of mast cell-, Basophil-, and t cell-mediated allergic responses, J. Immunol. Res. (2018) 5749120. [49] R. Uchida, H. Xiang, H. Arai, H. Kitamura, K. Nishida, L-type calcium channelmediated zinc wave is involved in the regulation of IL-6 by stimulating Non-IgE with LPS and IL-33 in mast cells and dendritic cells, Biol. Pharm. Bull. 42 (1) (2019) 87–93. [50] M. Kawahara, D. Mizuno, H. Koyama, K. Konoha, S. Ohkawara, Y. Sadakane, Disruption of zinc homeostasis and the pathogenesis of senile dementia, Metallomics 6 (2) (2014) 209–219. [51] M. Kawahara, K.I. Tanaka, Kato-Negishi M. Zinc, Carnosine, and neurodegenerative diseases, Nutrients 29 (2) (2018) 10. [52] S. De Schepper, N. Stakenborg, G. Matteoli, S. Verheijden, G.E. Boeckxstaens, Muscularis macrophages: key players in intestinal homeostasis and disease, Cell. Immunol. 330 (2018) 142–150.

inflammation in the hapten-induced colitis, Neurogastroenterol. Motil. 18 (11) (2006) 1019–1030. H.S. Sallam, H.M. Oliveira, H.T. Gan, D.N. Herndon, J.D. Chen, Ghrelin improves burn-induced delayed gastrointestinal transit in rats, Am. J. Physiol. Regul. Integr. Comp. Physiol. 292 (1) (2007) R253–257. N.T. Schwarz, J.C. Kalff, A. Turler, B.M. Engel, S.C. Watkins, T.R. Billiar, A.J. Bauer, Prostanoid production via COX-2 as a causative mechanism of rodent postoperative ileus, Gastroenterology 121 (6) (2001) 1354–1371. T. Hochdorfer, C. Tiedje, D.J. Stumpo, P.J. Blackshear, M. Gaestel, M. Huber, LPSinduced production of TNF-alpha and IL-6 in mast cells is dependent on p38 but independent of TTP, Cell. Signal. 25 (6) (2013) 1339–1347. S.H. Zuckerman, G.F. Evans, L. Guthrie, Transcriptional and post-transcriptional mechanisms involved in the differential expression of LPS-induced IL-1 and TNF mRNA, Immunology 73 (4) (1991) 460–465. K. Golovine, R.G. Uzzo, P. Makhov, P.L. Crispen, D. Kunkle, V.M. Kolenko, Depletion of intracellular zinc increases expression of tumorigenic cytokines VEGF, IL-6 and IL-8 in prostate cancer cells via NF-kappaB-dependent pathway, Prostate 68 (13) (2008) 1443–1449. B.A. Moore, L.E. Otterbein, A. Turler, A.M. Choi, A.J. Bauer, Inhaled carbon monoxide suppresses the development of postoperative ileus in the murine small intestine, Gastroenterology 124 (2) (2003) 377–391. J. Schmidt, B. Stoffels, R.S. Chanthaphavong, B.M. Buchholz, A. Nakao, A.J. Bauer, Differential molecular and cellular immune mechanisms of postoperative and LPSinduced ileus in mice and rats, Cytokine 59 (1) (2012) 49–58. A. Turler, N.T. Schwarz, E. Turler, J.C. Kalff, A.J. Bauer, MCP-1 causes leukocyte recruitment and subsequently endotoxemic ileus in rat, Am. J. Physiol. Gastrointest. Liver Physiol. 282 (1) (2002) G145–155. M. Hori, H. Nobe, K. Horiguchi, H. Ozaki, MCP-1 targeting inhibits muscularis macrophage recruitment and intestinal smooth muscle dysfunction in colonic

10