A Novel 7-Transmembrane Receptor Expressed in Nerve Growth Factor-Dependent Sensory Neurons

Molecular and Cellular Neuroscience 17, 31– 40 (2001) doi:10.1006/mcne.2000.0912, available online at http://www.idealibrary.com on

MCN

A Novel 7-Transmembrane Receptor Expressed in Nerve Growth Factor-Dependent Sensory Neurons 1 Roland H. Friedel, Jutta Stubbusch, Yves-Alain Barde, and Harald Schnu¨rch 2 Abteilung Neurobiochemie, Max-Planck-Institut fu¨r Neurobiologie, Am Klopferspitz 18a, D-82152 Martinsried, Germany

This study reports on the full-length cDNA cloning of a gene identified on the basis of its preferential expression in nerve growth factor, compared with neurotrophin-3dependent neurons. It encodes a putative 7-transmembrane polypeptide that is distantly related to other members of the G protein-coupled receptor superfamily. Unique features of this receptor include a very long carboxy-terminal tail of 360 amino acids and a specific expression pattern in the chick peripheral nervous system, including nerve growth factor-dependent sensory and sympathetic neurons, as well as enteric neurons. In the central nervous system, the receptor is strongly developmentally regulated and is expressed at high levels in the external granule cell layer of the cerebellum, as well as in motoneurons of the spinal cord, and in retinal ganglion cells.

INTRODUCTION The dorsal root ganglia (DRG) of higher vertebrates contain peripheral sensory neurons, which detect and transmit information about mechanical, thermal, chemical, or noxious stimuli to the central nervous system. Due to their accessibility and moderate complexity, DRGs represent a useful model system for studying molecular aspects of sensory transduction. Indeed, these ganglia have been the subject of extensive mor-

1

The nucleotide sequences reported in this publication have been deposited in GenBank under Accession Nos. AJ293971 (G. gallus), AJ293972 and AJ293973 (M. gallopavo), AJ293974 and AJ293975 (A. anser), AJ293976 and AJ293977 (S. camelus), AJ293978 and AJ293979 (S. europea), AJ293980 and AJ293981 (C. denticulata), and AJ293982 and AJ293983 (E. guttata). 2 To whom correspondence and reprint requests should be addressed. Fax: ⫹49-89-8578-3749. E-mail: [email protected]. 1044-7431/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

phological and physiological investigation (for review, see Perl, 1992). Yet, still little is known about the specific molecular mechanisms involved in, for example, nociception and proprioception. To address this question, we previously devised a method allowing the identification of genes that are differentially expressed in subpopulations of DRG neurons (Friedel et al., 1997). Embryonic chick DRGs were cultured as explants supported either by nerve growth factor (NGF) or neurotrophin-3 (NT3). The different survival properties of these two neurotrophins were utilized to select for physiologically distinct subpopulations, NGF supporting the survival of nociceptive and NT3 that of proprioceptive neurons. Using an optimized RNA fingerprinting technique, we could identify a series of genes that are differentially expressed between the subpopulations of DRG neurons (Friedel et al., 1997). The present study reports on a gene which is differentially expressed in the NGF-selected neuronal population. It encodes for a novel 7-transmembrane receptor with a distinct pattern of expression in the chick nervous system.

RESULTS Differential Expression of R35 in DRG Explants The RNA fingerprint fragment 35 (R35) was identified as a short (284 bp) cDNA fragment expressed in NGF-treated DRG explants at eightfold higher levels than in explants treated with NT3 (Friedel et al., 1997). We first examined whether the expression of R35 is inducible by NGF in a dose-dependent manner. Embry-

31

32

Friedel et al.

FIG. 1. (A) RT-PCR analysis of R35 expression in chick DRG explants. R35 expression was about 8-fold stronger in explants treated with NGF compared with NT3. The differential gene expression did not change when the concentration of NGF was raised from 2 to 100 ng/ml. The glycolysis enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as control. PCR cycles: 30 for R35 and 17 for GAPDH. (B) Northern blot analysis of R35 expression in chick E8 and E16 tissues. A transcript of about 5 kb was detectable in neuronal tissues. A weak band of 4 kb was present in E16 kidney (metanephros). The same blot was reprobed for GAPDH. X-ray film exposure: 10 days (R35) and 2 h (GAPDH).

onic day 10 (E10) DRG explants were incubated with increasing amounts of NGF (2, 10, and 100 ng/ml), and expression levels were assayed after 4 days in vitro. No differences were observed (Fig. 1A). Since DRG neurons express both trkA and p75 NTR receptors, we tested the possibility that NGF may exert an effect via its p75 NTR receptor. NGF was tested at different concentrations in the presence of an excess amount of human NT4/5 (50 ␮g/ml), known to block the action of NGF through p75 NTR (Davies et al., 1993; Yamashita et al., 1999). No difference in R35 mRNA levels could be observed (data not shown). These results suggest that R35 expression is enriched in DRG neurons needing NGF for survival, but that it is not directly regulated by NGF. Full-Length Sequence of R35 and Northern Blot Analysis In order to obtain a complete cDNA sequence of R35, we used the original fingerprint fragment to screen a

lambda gt10 cDNA library from chick E8 DRGs. A sequence of 4.6 kb could be compiled from four overlapping phage clones. The R35 cDNA contains a 2.1 kb open reading frame that is flanked by an 0.5 kb 5⬘untranslated region and a 2 kb 3⬘-untranslated region. A stretch of 30 adenylate residues at the 3⬘-end of the sequence likely represents part of the poly(A) tail. The original fingerprint fragment turned out to be part of the 3⬘-untranslated region, located about 1 kb upstream from the 3⬘-end. We used the open reading frame of R35 as a probe to perform Northern blot analysis with various tissues from E8 and E16 embryos (Fig. 1B). A single transcript of about 5 kb could be detected in poly(A) ⫹ RNA of neuronal tissues (brain, spinal cord, DRG, and retina), in agreement with the length of the R35 cDNA sequence. No signal could be detected in heart, liver, and skeletal muscle tissues. A weak hybridization signal of about 4 kb was seen in kidney and may represent a shorter splice variant of R35 or a closely related transcript.

33

A Novel 7-Transmembrane Receptor

TABLE 1 Best Database Matches to the R35 Polypeptide Sequence Amino acid identity in overlap Orphan receptor EG:22E5.11 (Drosophila) Prostaglandin E2 receptor, type EP 4 (Rat) Invertebrate rhodopsin (Crayfish) Putative octopamine receptor (Barnacle) Orphan GPCR RE2 (Human) Prostglandin D 2 receptor (Human) Melatonin-related receptor (Mouse) Prostaglandin E 2 receptor, type EP 2 (Dog) Histamine H1 receptor (Mouse) Serotonin-like receptor (Planaria) Blue cone opsin (Salamander) Adrenergic alpha-1A receptor (Rabbit) Vertebrate rhodopsin (Bullfrog) Serotonin 1D receptor (Mouse) Adenosine A3 receptor (Chicken) Serotonin receptor (Aplysia)

21.1% 24.5% 22.6% 22.9% 24.8% 25.7% 22.8% 25.9% 23.6% 22.2% 24.1% 20.7% 23.4% 23.9% 20.2% 23.5%

in in in in in in in in in in in in in in in in

512 347 190 332 213 201 206 158 178 310 216 483 196 376 212 183

aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa

Note. The R35 polypeptide sequence was used for a FASTA3 search of the SWISS-PROT database. The matches are ranked by descending expectation values. Only the best match of a single receptor type is shown, i.e., species orthologs, like for example mouse and human EP 4, have been omitted.

Structure of the R35 Protein The open reading frame of the R35 cDNA encodes a putative polypeptide of 723 amino acids. A search of public protein databases identified a series of G proteincoupled receptors (GPCRs) with about 20 to 25% identity to R35 (Table 1). The list comprised invertebrate and vertebrate rhodopsin, prostaglandin, monamine, and adenosine receptors, as well as orphan receptors. All of these proteins belong to the rhodopsin-related family of GPCRs (also termed family A). The hydropathy diagram of R35 revealed a pattern that is typical for GPCRs. Hydrophobic stretches indicate the presence of 7 transmembrane domains (TMs; Fig. 2A). The hydropathy diagram and sequence alignments with other GPCRs enabled us to predict R35’s transmembrane topology (Fig. 2B). As known for other GPCRs, R35 may undergo some posttranslational modifications (for review, e.g., Probst et al., 1992): N-glycosylations of asparagine residues in the amino terminus (Asn 7, Asn 11, and Asn 19); formation of a disulfide bridge between two extracellular cysteine residues (Cys 103 and Cys 181); and palmitoylation of intracellular cysteine residues following TM 7 (Cys 368, Cys 370, and Cys 374). The intracellular carboxy terminus of R35 comprises roughly half of the predicted polypeptide. With about

360 amino acids it currently seems to represent the longest carboxy terminus of any rhodopsin-related GPCR reported up to now. The amino acid sequence of the carboxy terminus contains no significant similarities to known GPCRs or other proteins.

Cloning of R35 Orthologs As sequence alignments of homologous proteins often provide valuable information about functional relevant domains or single amino acids, we isolated R35 fragments from different vertebrate species by PCR under low stringency conditions using genomic DNA as template. R35 partial sequences from TM2 to TM7 were obtained from Meleagris gallopavo (turkey), Anser anser (goose), Struthio camelus (ostrich), Sitta europea (nuthatch), Chelonoidis denticulata (south-american yellow-footed tortoise), and Elaphe guttata (corn snake; Fig. 3). Compared with the sequence of chicken R35, the percentage of amino acid identities are as follows: 95% (turkey), 92% (goose), 84% (ostrich), 68% (nuthatch), 77% (tortoise), and 61% (corn snake). Two cysteine residues that could potentially form a disulfide bridge were present in all species analyzed. All genomic sequences contained an intron in TM 6 which varied in size between 1 and 2 kb. The percentage of amino acid identity was determined for the TMs, the extra (e)- and intracellular (i) loops: 51% (TM 2), 58% (e 1), 56% (TM 3), 15% (i 2), 61% (TM 4), 58% (e 2), 56% (TM 5), 17% (i 3), 86% (TM 6), 22% (e 3), 75% (TM 7).

In Vivo Expression of R35 We next assayed the in vivo expression of R35 by mRNA in situ hybridization in chick embryos. We initially compared the pattern of R35 expression with the pattern of the NGF receptor trkA in DRGs. In situ hybridization revealed that R35 expression is mainly confined to the medial subpopulation of DRG neurons (Fig. 4A), a pattern very similar to that obtained using a trkA probe on a neighboring section (Fig. 4B). In the trigeminal ganglion, R35 hybridization signal was mainly present in the dorsal region of the ganglion (Fig. 4C), analogous to the expression of trkA in this ganglion (data not shown; Williams et al., 1995). A neighboring section probed for the NT3 receptor trkC exhibited an almost complementary pattern (Fig. 4D). In the spinal cord at E8, the most prominent hybridization signal was present in the motor columns (Fig.

34

Friedel et al.

FIG. 2. (A) The hydropathy diagram (Kyte and Doolittle, 1982) of the putative R35 polypeptide reveals the typical pattern of a 7-transmembrane receptor. (B) Predicted transmembrane topology of R35. The scheme includes potential posttranslational modifications: N-glycosylations (Asn 7, 11, and 19), and extracellular disulfide bridge (Cys 103 and 181), and intracellular palmitoyl anchors (Cys 368, 370, and 374).

4E). Also the mantle zone and some cells in the roof plate were labeled. The ventricular zone and the floor plate were devoid of signal.

As development proceeds, the expression of R35 is more restricted in the spinal cord, and at E16, R35 mRNA could be detected only in motoneurons (Fig. 4F).

A Novel 7-Transmembrane Receptor

35

FIG. 3. Alignment of chicken R35 with putative orthologs of other vertebrates (partial sequences). Conserved residues are indicated by dots, gaps are represented by underscores, and the putative transmembrane domains are marked by gray boxes. The two conserved cysteine residues which potentially form a disulfide bridge are indicated by asterisks. The arrowhead above TM6 indicates the conserved position of an intron in the R35 gene. Species names: Gallus gallus (chicken), Meleagris gallopavo (turkey), Anser anser (goose), Struthio camelus (ostrich), Sitta europea (nuthatch), Chelonoidis denticulata (south american yellow-footed tortoise), and Elaphe guttata (corn snake).

Semiquantitative RT-PCR of spinal cord tissue at various time points confirmed a peak of R35 expression at E8 compared with E16 when R35 expression was a fourth (Fig. 4G; see also Fig. 1B). Besides sensory ganglia and spinal cord, R35 is also expressed in a small number of other neuronal popula-

tions. In the CNS, two structures exhibited a distinct R35 expression pattern. In the developing cerebellum the external granule cell layer (EGL) revealed a very strong hybridization signal (Fig. 5A). Interestingly, the signal was concentrated over the outer part of the EGL, which consists mainly of proliferating neuroblasts (Fig.

36

Friedel et al.

FIG. 4. (A, B) Micrographs of mRNA in situ hybridizations for R35 (A) and trkA (B). Neighboring sections containing a DRG of an E12 embryo are shown. Boundaries of DRGs are marked by a broken line. Dorsal is up and medial is left. The hybridization signals for both genes are concentrated in the medial portion of the DRG, suggesting coexpression of R35 and trkA. (C, D) Neighboring sections of a E10 trigeminal ganglion, probed for R35 (C) and trkC (D). Hybridization signal for R35 is mainly localized in the dorsal area of the ganglion. The trkC signal reveals a fairly complementary expression in the ventral area of the ganglion. (E) Transverse section of an E8 spinal cord. R35 hybridization signal is detectable in the roof plate (rp), mantle zone (mz), motorcolumn (mc), and the meninges (men). The ventricular zone (vz) and the floor plate (fp) are devoid of signal. (F) At E16, the R35 expression in the spinal cord is mainly restricted to motoneurons (arrowheads). Scale bars: 100 ␮m (A–D) and 500 ␮m (E, F). (G) RT-PCR analysis of R35 in the spinal cord reveals a dynamic expression pattern, with maximal R35 expression around E8. GAPDH served as control. PCR cycles: 30 for R35 and 17 for GAPDH.

5B; Hanaway, 1967). In contrast, many cells remained unlabeled in the inner EGL which contains emigrating postmitotic neurons. In the retina, the retinal ganglion cell layer was prominently labeled (Fig. 5C). The subependymal layer of the tectum showed weaker and more dispersed R35 expression (data not shown). R35 expression was also detectable in two concentric layers of cells in the gut wall (Fig. 5D). These cells presumably correspond to enteric neurons of the plexus submucosus. R35 expression was also detected in sympathetic ganglia (Fig. 5E). The only nonneuronal cells which revealed R35 expression were found in the urogenital system where the hybridization signal was associated with a small sub-

population of kidney cells (Fig. 5E) and the gonads (Fig. 5F).

DISCUSSION R35 and the GPCR Superfamily Although sequence comparisons identified R35 as a rhodopsin-related GPCR, the similarities are too low to identify R35 as a member of any known subfamily. Members of the prostanoid receptor subfamily seem to be the closest relatives, and the prostanoid receptors EP 4 , DP, and EP 2 exhibited the highest identities

37

A Novel 7-Transmembrane Receptor

FIG. 5. (A) Sagittal section of an E14 cerebellum. Strong R35 expression was detectable in the external granule cell layer (EGL). (B) High power bright field view of white square in (A). Silver grains are concentrated over the outer EGL (arrowheads), while many cells in the inner EGL are devoid of signal. (C) In the E10 retina, R35 is mainly expressed in the retinal ganglion cell layer (arrowheads). The pigment epithelium (which resembles under dark-field illumination a hybridization signal) is marked by small thin arrows. (D) In the wall of the E12 gut, two concentric layers were labeled by the R35 probe (arrowheads), which correspond presumably to the enteric neurons of the plexus myentericus and submucosus. (E) Cross section of an E12 trunk. Dorsal is up and medial is left. R35 signal is present in the medial portion of the DRG (drg), the sympathetic ganglion (sg), and a subpopulation of kidney (metanephros) cells. (F) Hybridization signal in E12 gonads (arrowheads). Scale bars: 100 ␮m (A, C–F) and 20 ␮m (B).

with R35 (24.5 to 25.9%). Interestingly, the R35 gene shares an intron with the prostanoid receptors genes at an equivalent position in TM 6 (reported for the prostanoid receptors EP 1 , EP 2 , EP 3 , EP 4 , FP, and IP: Okuda-Ashitaka et al., 1996; Kennedy et al., 1999; Ushikubi et al., 1998; Arakawa et al., 1996; Ezashi et al., 1997; Murata et al., 1997). Yet, R35 is unlikely to be a genuine member of prostanoid receptors, because all prostanoid receptors contain a highly conserved motif in TM7, which is involved in ligand binding (Pierce et al., 1995). This motif (RxxxxxxIxDPW) is not present in R35. The relatedness of about 20 –25% to other GPCRs is typical for the distance between GPCR subfamilies. For example, the EP 4 receptor reveals identities of 22% to serotonin and 25% to adrenergic receptors, the closest related subfamilies.

With members of its own subfamily it shares at least 30% identity. Therefore, R35 may be a member of a novel GPCR subfamily.

Putative Functional Domains According to the current model of GPCR structure, the ligand binding site is formed inside the membrane by a barrel-like arrangement of the TMs (Bikker et al., 1998; Bockaert and Pin, 1999). Interestingly, the alignment of R35 orthologs revealed TM 6 and 7 as the best conserved domains of R35 (86 and 75% identity, respectively; see Fig. 3), and it seems possible that TM 6 and 7 are main interaction sites for a R35 ligand. The TM7 contains a crucial amino acid for ligand

38 binding in prostanoid receptors and rhodopsins. An arginine in the TM7 of prostanoid receptors interacts with the carboxy group of prostanoids, and a lysine in the TM 7 of rhodopsins links retinal via a covalent bond (Mullen and Akhtar, 1983; Audoly and Breyer, 1997). The TM7 of R35 lacks a charged residue at the relevant position. The TM6 of R35, however, carries a lysine in its center (Lys 315), which is the only charged amino acid in this highly conserved domain. By analogy, this lysine may have an important function for ligand binding. Despite considerable efforts by several groups, no amino acid motifs could be identified which would clearly define the specificity of a GPCR for the coupled G protein. Yet, a large body of data indicates that the amino acids at the boundaries between the TMs and the intracellular loops play a pivotal role in G protein activation (Gudermann et al., 1997; Bikker et al., 1998). Several amino acids of the intracellular loops adjacent to TM 3, TM 5, and TM6 are highly conserved between the R35 homologs. Most of these residues can be also found in other GPCRs at similar positions. For example, three residues in R35 close to TM 6 (Ser 295, Thr 299, and Lys 305) are found in identical order in bovine rhodopsin, and the substitution of any of these residues by an aliphatic amino acids leads to a significant decrease in transducin activation (Franke et al., 1992). A characteristic trait of rhodopsin-related receptors is the “DRY” motif which follows TM3. This motif contains amino acids which are necessary for coupling to G proteins in several, but not all rhodopsin-related GPCRs (Oliveira et al., 1994; Seibold et al., 1998). Its respective sequence in R35 is NFY (Asn 128, Phe 129, Tyr 130). The functional relevance of this motif in R35 remains open, but it is remarkable that R35 is unique amongst more than 1100 reported rhodopsin-like receptors in that it carries a phenylalanine in the middle of this motif (GPCRDB at http://www.gpcr.org/7tm). A striking feature of R35 is the exceptionally long intracellular carboxy terminus. It contains 24 threonine and 43 serine residues. The phosphorylation of serine and threonine residues by kinases like G protein-coupled receptor kinases (GRKs), or protein kinases A and C, is known to lead to the desensitization of GPCRs (Carman and Benovic, 1998). It is thus possible that the carboxy terminus of R35 may be involved in regulation of receptor activity. Other roles may be envisaged such as binding to dynein, which is necessary for the transport of rhodopsin to the rod outer segment, or to proteins of the Homer family, as it is the case for metabotropic glutamate receptors (Tu et al., 1998; Tai et al., 1999).

Friedel et al.

R35 Expression R35 has a very distinct pattern of expression, mostly restricted to cells of the nervous system. It is not only prominently expressed in NGF-dependent neurons of the PNS, but is also found in subpopulations of CNS neurons, like spinal cord motoneurons, retinal ganglia cells and EGL cells of the cerebellum. Also, a subpopulation of kidney cells seems to express R35. Interestingly, most of the closest related GPCRs show a wider tissue distribution than R35. For example, prostanoid receptors are found in various tissues of the body like lung, stomach, and uterus (Narumiya et al., 1999). The expression of R35 in NGF-dependent DRG neurons suggests a role in peripheral pain perception, and R35 may act here similar to a series of other GPCRs which are involved in the modulation of nociception, e.g., the receptors for cannabinoids, bradykinin, substance P, prostaglandins, ATP, or serotonin (Calignano et al., 1998; Millan, 1999). Two developing areas of the nervous system exhibited transient R35 expression: the developing spinal cord and the proliferating EGL of the cerebellum. This dynamic expression would coincide with a role for R35 in neuronal proliferation and differentiation. Conclusion R35 is a novel orphan 7-transmembrane receptor with a largely neuron-specific pattern of expression. While the chemical nature of the R35 ligand is unclear at this point, sequence comparisons suggest two classes of possible candidates: fatty acid derivatives, like prostanoids and retinal, or monamines. The identification of a ligand for R35 should facilitate the understanding of its biological function.

EXPERIMENTAL METHODS DRG Explant Cultures DRG explants were cultured as described (Friedel et al., 1997). Briefly, chick E10 lumbosacral ganglia 4, 5, and 6 were carefully dissected, washed in PBS, and transferred to polyornithine- (Sigma) and laminincoated (Life Technologies) 48-well tissue culture plates (Falcon). Culture medium consisted of Ham’s F14 (Life Technologies) supplemented with 0.1 mg/ml transferrin, 16 ␮g/ml putrescine, 6 ng/ml progesterone, 8 ng/ml sodium selenite, 100 ␮g/ml penicillin G, 60 ␮g/ml streptomycin sulfate (all reagents Sigma), and 2–100 ng/ml recombinant human NGF or NT3 (Genen-

39

A Novel 7-Transmembrane Receptor

tech). RNA was isolated from the explants after incubation for 4 days at 37°C in a 3% CO 2 atmosphere at 95% relative humidity. Reverse Transcriptase-PCR (RT-PCR) Analysis Total RNA was extracted with the RNeasy kit (Qiagen). The cDNA synthesis was performed with oligo(dT) primers and Moloney murine leukemia virus reverse transcriptase (Superscript II; Life Technologies) at 45°C for 1 h. cDNA derived from 16 ng total RNA was used as template for PCR amplification with Perkin–Elmer thermal cyclers 2400/9600 in a 50-␮l reaction volume containing 1⫻ PCR buffer (Perkin–Elmer), 1.5 mM MgCl 2, 0.2 mM dNTPs, and 0.2 ␮M of each primer (sequences below). After 3 min of denaturation at 95°C 1.5 units of Taq polymerase (Life Technologies) were added (manual “hot start”), and the temperature profile was run at 95° for 15 s, 65°C for 30 s, and 72°C for 30 s. Amplification of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA fragments was run in parallel to normalize different cDNA samples. Temperature profiles consisted of 30 cycles for R35 and 17 cycles for GAPDH. PCR products were separated by electrophoresis on agarose gels stained with SYBR Green I (Molecular Probes) and analyzed with the EASY digital imaging system (Herolab). All RT-PCR experiments were repeated with a second independent set of RNA preparations. Primers for R35: TGGAGGCATGGAAAGAACAG and TACTAAGAGCCTTGAGGCAA (241-bp product); primers for GAPDH: GGCTGCTAAGGCTGTGGGGA and TATCAGCCTCTCCCACCTCC (545-bp product). cDNA Cloning The original 284-bp R35 fingerprint fragment was used as a probe to screen a lambda gt10 cDNA library from chick E8 DRGs. The probe was radiolabeled with [ 32P]dCTP using a random primed labeling kit (Roche Molecular Biochemicals). The cDNA inserts of positive phages were subcloned into pBluescript (Stratagene) and sequenced with an automated sequencer (ABI 377; Applied Biosystems). Two further rounds of library screening were performed, using terminal fragments of the previous cDNA fragments as probes. The R35 cDNA was compiled from four overlapping lambda cDNA inserts.

Molecular Biochemicals) and used as a probe for Northern blot analysis. The Northern blot containing 2 ␮g poly(A) ⫹ RNA of various chick tissues was hybridized in Express Hyb solution (Clontech) at 65°C overnight and washed under high-stringency conditions. A control hybridization of the same blot was performed with a 0.5-kb GAPDH fragment as probe. The blot was exposed to Kodak Biomax MS films at ⫺80°C. Cloning of Genomic R35 Fragments To isolate genomic DNA, 0.5 g muscle tissue was frozen in liquid nitrogen, grounded to powder, transferred in 3 ml lysis buffer (10 mM Tris–HCl, pH 8.0, 2 mM EDTA, 0.2% SDS, 80 ␮g/ml RNase A), and incubated for 3 h at 50°C. Proteinase K was added to a final concentration of 160 ␮g/ml and the solution was incubated at 50°C overnight. DNA was purified by phenol extraction and 2-propanol precipitation. 200 ng of genomic DNA were used as templates for PCR amplifications with chicken R35 primers. All primers were 20-mers with a GC-content of 50%. PCR conditions for each species were optimized by a stepwise reduction of the annealing temperature. Amplifications were performed in a 50-␮l reaction volume containing 1⫻ PCR buffer, 0.2 mM dNTPs, and 0.2 ␮M of each primer. MgCl 2 was added to final concentrations of 1.5, 2, and 2.5 mM. After addition of 1.5 units of Taq polymerase by manual “hot start,” the temperature profile was run for 40 cycles (95° for 15 s, 55– 65°C for 30 s, and 72°C for 1 min). Reaction products of expected size were cloned into pCRII-TOPO (Invitrogen) and sequenced. All PCR reactions were set up under clean bench conditions to minimize risks of cross-contamination. mRNA in Situ Hybridization Preparation of tissue sections and hybridization with S-labeled single-stranded RNA probes were performed as described (Schnu¨rch and Risau, 1991). The probes were synthesized from linearized plasmids containing 0.5-kb cDNA fragments of chicken R35, trkA, or trkC. 35

ACKNOWLEDGMENTS Northern Blot Hybridization A 2.6-kb fragment of the R35 cDNA was radiolabeled with [ 32P]dCTP by a random primed labeling kit (Roche

We thank Claudia Cap and Jens Richter for DNA sequencing. This work was supported by Neuroscience Research, SmithKline Beecham, Harlow, UK.

40

REFERENCES Arakawa, T., Laneuville, O., Miller, C. A., Lakkides, K. M., Wingerd, B. A., DeWitt, D. L., and Smith, W. L. (1996). Prostanoid receptors of murine NIH 3T3 and RAW 264.7 cells. Structure and expression of the murine prostaglandin EP4 receptor gene. J. Biol. Chem. 271: 29569 –29575. Audoly, L., and Breyer, R. M. (1997). Substitution of charged amino acid residues in transmembrane regions 6 and 7 affect ligand binding and signal transduction of the prostaglandin EP3 receptor. Mol. Pharmacol. 51: 61– 68. Bikker, J. A., Trumpp-Kallmeyer, S., and Humblet, C. (1998). GProtein coupled receptors: Models, mutagenesis, and drug design. J. Med. Chem. 41: 2911–2927. Bockaert, J., and Pin, J. P. (1999). Molecular tinkering of G proteincoupled receptors: an evolutionary success. EMBO J. 18: 1723–1729. Calignano, A., La Rana, G., Giuffrida, A., and Piomelli, D. (1998). Control of pain initiation by endogenous cannabinoids. Nature 394: 277–281. Carman, C. V., and Benovic, J. L. (1998). G-protein-coupled receptors: Turn-ons and turn-offs. Curr. Opin. Neurobiol. 8: 335–344. Davies, A. M., Horton, A., Burton, L. E., Schmelzer, C., Vandlen, R., and Rosenthal, A. (1993). Neurotrophin-4/5 is a mammalian-specific survival factor for distinct populations of sensory neurons. J. Neurosci. 13: 4961– 4967. Ezashi, T., Sakamoto, K., Miwa, K., Okuda-Ashitaka, E., Ito, S., and Hayaishi, O. (1997). Genomic organization and characterization of the gene encoding bovine prostaglandin F2alpha receptor. Gene 190: 271–278. Franke, R. R., Sakmar, T. P., Graham, R. M., and Khorana, H. G. (1992). Structure and function in rhodopsin. Studies of the interaction between the rhodopsin cytoplasmic domain and transducin. J. Biol. Chem. 267: 14767–14774. Friedel, R. H., Schnu¨rch, H., Stubbusch, J., and Barde, Y. A. (1997). Identification of genes differentially expressed by nerve growth factor- and neurotrophin-3-dependent sensory neurons. Proc. Natl. Acad. Sci. USA 94: 12670 –12675. Gudermann, T., Schoneberg, T., and Schultz, G. (1997). Functional and structural complexity of signal transduction via G-proteincoupled receptors. Annu. Rev. Neurosci. 20: 399 – 427. Hanaway, J. (1967). Formation and differentiation of the external granular layer of the chick cerebellum. J. Comp. Neurol. 131: 1–14. Kennedy, C. R., Zhang, Y., Brandon, S., Guan, Y., Coffee, K., Funk, C. D., Magnuson, M. A., Oates, J. A., Breyer, M. D., and Breyer, R. M. (1999). Salt-sensitive hypertension and reduced fertility in mice lacking the prostaglandin EP2 receptor. Nat. Med. 5: 217–220. Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105–132. Millan, M. J. (1999). The induction of pain: an integrative review. Prog. Neurobiol. 57: 1–164. Mullen, E., and Akhtar, M. (1983). Structural studies on membranebound bovine rhodopsin. Biochem. J. 211: 45–54.

Friedel et al.

Murata, T., Ushikubi, F., Matsuoka, T., Hirata, M., Yamasaki, A., Sugimoto, Y., Ichikawa, A., Aze, Y., Tanaka, T., Yoshida, N., Ueno, A., Oh-ishi, S., and Narumiya (1997). Altered pain perception and inflammatory response in mice lacking prostacyclin receptor. Nature 388: 678 – 682. Narumiya, S., Sugimoto, Y., and Ushikubi, F. (1999). Prostanoid receptors: Structures, properties, and functions. Physiol. Rev. 79: 1193– 1226. Okuda-Ashitaka, E., Sakamoto, K., Ezashi, T., Miwa, K., Ito, S., and Hayaishi, O. (1996). Suppression of prostaglandin E receptor signaling by the variant form of EP1 subtype. J. Biol. Chem. 271: 31255–32161. Oliveira, L., Paiva, A. C., Sander, C., and Vriend, G. (1994). A common step for signal transduction in G protein-coupled receptors. Trends Pharmacol. Sci. 15: 170 –172. Perl, E. R. (1992). Function of dorsal root ganglion neurons: An overview. In Sensory Neurons: Diversity, Development, and Plasticity (S. A. Scott, Ed.) pp. 3–23. Oxford Univ. Press, Oxford. Pierce, K. L., Gil, D. W., Woodward, D. F., and Regan, J. W. (1995). Cloning of human prostanoid receptors. Trends Pharmacol. Sci. 16: 253–256. Probst, W. C., Snyder, L. A., Schuster, D. I., Brosius, J., and Sealfon, S. C. (1992). Sequence alignment of the G-protein coupled receptor superfamily. DNA Cell Biol. 11: 1–20. Schnu¨rch, H., and Risau, W. (1991). Differentiating and mature neurons express the acidic fibroblast growth factor gene during chick neural development. Development 111: 1143–1154. Seibold, A., Dagarag, M., and Birnbaumer, M. (1998). Mutations of the DRY motif that preserve beta 2-adrenoceptor coupling. Recept. Chann. 5: 375–385. Tai, A. W., Chuang, J. Z., Bode, C., Wolfrum, U., and Sung, C. H. (1999). Rhodopsin’s carboxy-terminal cytoplasmic tail acts as a membrane receptor for cytoplasmic dynein by binding to the dynein light chain Tctex-1. Cell 97: 877– 887. Tu, J. C., Xiao, B., Yuan, J. P., Lanahan, A. A., Leoffert, K., Li, M., Linden, D. J., and Worley, P. F. (1998). Homer binds a novel proline-rich motif and links group 1 metabotropic glutamate receptors with IP3 receptors. Neuron 21: 717–726. Ushikubi, F., Segi, E., Sugimoto, Y., Murata, T., Matsuoka, T., Kobayashi, T., Hizaki, H., Tuboi, K., Katsuyama, M., Ichikawa, A., Tanaka, T., Yoshida, N., and Narumiya, S. (1998). Impaired febrile response in mice lacking the prostaglandin E receptor subtype EP3. Nature 395: 281–284. Williams, R., Ba¨ckstrom, A., Kullander, K., Hallbo¨o¨k, F., and Ebendal, T. (1995). Developmentally regulated expression of mRNA for neurotrophin high-affinity (trk) receptors within chick trigeminal sensory neurons. Eur. J. Neurosci. 7: 116 –128. Yamashita, T., Tucker, K. L., and Barde, Y. A. (1999). Neurotrophin binding to the p75 receptor modulates Rho activity and axonal outgrowth. Neuron 24: 585–593. Received July 7, 2000 Accepted September 8, 2000