- Email: [email protected]
A novel adenosine-based molecular beacon probe for room temperature nucleic acid rapid detection in cotton thread device
Analytica Chimica Acta 861 (2015) 69–73
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
A novel adenosine-based molecular beacon probe for room temperature nucleic acid rapid detection in cotton thread device Ting-E. Du, Yiyun Wang, Yi Zhang, Tian Zhang, Xun Mao * Key Laboratory of Synthetic and Natural Functional Molecule Chemistry of Ministry of Education, College of Chemistry & Materials Science, Northwest University, Xi'an, Shaanxi Province 710127, PR China
H I G H L I G H T S
G R A P H I C A L A B S T R A C T
Natural cotton thread-based pointof-care diagnosis devices. A room temperature nucleic acid detection method. A novel molecular beacon technique based on poly adenosine and coralyne interaction. The test device is capable of discrimination single base mismatched sequences. Simple preparation, low cost, rapid detection, easy to handle.
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 November 2014 Received in revised form 19 December 2014 Accepted 25 December 2014 Available online 27 December 2014
We used cotton thread as substrate to develop a novel room temperature DNA detection device for low-cost, sensitive and rapid detection of a human genetic disease, hereditary tyrosinemia type I related DNA sequences. A novel adenosine based molecular beacon (ABMB) probe modified on gold nanoparticle was used as reporter probe. In the presence of coralyne, a small molecule which can react with adenosines, the ABMB would form a hairpin structure just like traditional molecular beacon used extensively. In the presence of target DNA sequences, the hairpin structure of ABMB modified on gold nanoparticles will be opened and the biotin group modified at one end of the DNA probes will be released and react with the streptavidin immobilized on the test zone of the cotton thread. The response of the thread based DNA test device is linear over the range of 2.5–100 nM complementary DNA. The ability of our developed device for discriminating the single base mismatched DNA related to a human genetic disease, hereditary tyrosinemia type I, was improved comparing with previous report. It is worth mentioning that the whole assay procedure for DNA test is performed under room temperature which simplified the assay procedures greatly. ã 2015 Elsevier B.V. All rights reserved.
Keywords: Room temperature Cotton thread device Point-of-care diagnosis Single base mismatch discrimination
1. Introduction
* Corresponding author. Tel.: +2988303287; fax: +27872334483. E-mail address: [email protected] (X. Mao). http://dx.doi.org/10.1016/j.aca.2014.12.044 0003-2670/ ã 2015 Elsevier B.V. All rights reserved.
Tyagi and Kramer [1] first reported the fluorescent molecular beacon (MB) in 1996 as nucleic acid probe, being able to initiate conformational change spontaneously due to the hybridization with complementary nucleic acid target. In recent years, nanomaterials including gold nanoparticle and carbon nanotube were employed as
70
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
substrates to immobilize molecular beacons. Bockisch et al. developed a novel DNA stem-loop structured probe for enzymatic detection of nucleic acid target based on the molecular beacon immobilized on the surface of microplate and electrode [2,3]. The study of interaction between adenosine and coralyne was first reported by Ren and Chaires in 1999 [4]. In 2012, Lin and Tseng utilized coralyne, a special molecule able to interact with adenosine, to design a novel molecular beacon. In the report, the fluorescence method was used to realize quantitative detection of target DNA molecules successfully [5]. However, their obtained results indicated that the discrimination of single base mismatched target DNA sequences were not satisfied. We have improved the performance by using microplate as substrate for fluorescence test based on the similar strategy [6]. Whitesides and Shen have proposed cotton thread as a support for making microfluidic circuits and rapid diagnostic tests [7,8]. Natural cotton thread has also been reported by David as a support for transporting and mixing liquids in lateral flow immunochromatographic assays for quantitative high-sensitivity immunoassays [9,10]. Lateral flow strip was used extensively in biomarker and disease biosensors due to its assay formats [11–19]. These cotton thread based devices own some advantages of lateral flow strip, but even possess some superior advantages due to its internal characters mentioned above. All these make it an ideal candidate for point-of-care and on-site diagnosis applications. Here we explored a cotton thread-based device for rapid, sensitive and quantitative detection of human genetic disease related DNA. The ability of our developed cotton thread-based DNA detection device for discriminating the single base mismatched DNA related to a human genetic disease, hereditary tyrosinemia type I [20] was realized by using a novel adenosine based molecular beacon probes (ABMB) which was labeled on gold nanoparticles. In the presence of target DNA sequences, the hairpin structure of ABMB modified on gold nanoparticles will be opened and the biotin group modified at one end of the DNA probes will be released and react with the streptavidin immobilized on the test zone of the thread. The thread was pasted on two parallel placed double faced adhesive tapes, and an absorbent pad was applied at the downstream end. The glass fiber loading gold nanoparticle conjugate was attached to the other end of the thread. The immunoassay format of the device is more like a lateral flow strip biosensor: sample solution and running buffer were dropped directly on the glass fiber to rehydrate the conjugates. After waiting for fifteen minutes, a red band would appear in the presence of specific analyte, which can be used as a qualitative mean. Quantitative detection can be realized by recording the color intensity of the test zone with a scanner and “ImageJ” software. The response of the thread based DNA test device is linear over the range of 2.5–100 nM complementary DNA. The ability of our developed device for discriminating the single base mismatched DNA related to a human genetic disease, hereditary tyrosinemia type I, was improved comparing with previous report. It is worth mentioning that the whole assay was conducted at room temperature in less than 0.5 h, which greatly simplify the assay procedures.
2. Experimental 2.1. Materials and reagents Cotton thread (100% mercerized) was purchased from a thread store (Xi'an). Albumin bovine serum (BSA) and human serum were supplied by Dingguo Biological Products (Beijing, China). Streptavidin from Streptomyces Avidin, and coralyne were
Table 1 DNA sequences of ABMB and tested DNA. Name
Sequence (50 –30 )
DNA1 DNA2 DNA3 DNA4 DNA5 DNA6
SH-AAAAAAAATGGACCAGATACTCACCGGAAAAAAAAA-Biotin CCGGTGAGTATCTGG CCGGTGAATATCTGG CCGGTGATTATCTGG CCGGTGACTATCTGG TCAGTGGGGTTGGACGGGATGGTGCCTGAA
obtained from Sigma–Aldrich (Shanghai, China). 3-mercapto propionic acid (MPA) was purchased from Aladdin Chemistry Co. Ltd. (Shanghai, China). DNA sequences (Table 1)were supplied by Sangon Biotech (Shanghai, China). 0.1 M HEPES (pH 7.0, 0.2 M NaCl) was used as incubating buffer. All other chemicals were of analytical reagent grade. All buffer solutions were prepared using ultrapure water. 2.2. Instrumentation Basic pH meter was purchased from Sartorius (Beijing, China). Sterilization kettle was supplied by Shanghai Boxun Industry & Commerce Co. Ltd. (Shanghai, China). High pure water distiller was obtained from Changzhou Guohua electric appliance Co. Ltd. (Jiangsu, China). CanoScan 9000F was supplied by Canon Co. Ltd. (Thailand). Drying oven was supplied by Yiheng technology Co., Ltd. (Shanghai, China). 2.3. Synthesis of gold nanoparticles (Au NPs) Au NPs with the diameter of 40 5 nm was prepared using the citrate reduction method, as described briefly as follows. 1.5 mL 1% trisodium citrate solution for synthesis of 40 5 nm Au NPs was rapidly added into a stirred boiling HAuCl4 (100 mL, 0.01%, w/v) solution. After several minutes, the color of the solution changed from violet to deep red. The obtained solution was heated for another 15 min to ensure a stable color followed by slow cooling to room temperature under stirring. The obtained Au NPs solutions were stored at 4 C for future use. 2.4. Pre-treatment of adenosine-based molecular beacon and its immobilization A well designed DNA probe modified a thiol group and a biotin group on each end was titled as DNA1 (Table 1). DNA1 was immobilized on the surface of Au NPs (40 5 nm) through self assembling. It is worth mentioning that 14 mL of 5 mM DNA probe used should be treated subsequently at 95 C and ice-cold water bath for 10 and 30 min, respectively, followed by adding 0.7 mL of 2 mM coralyne and 55.3 mL of 0.1 M HEPES (pH 7.0, 0.2 M NaCl) and reacting at room temperature for 30 min to form a hairpin structure just like traditional molecular beacon probe. The formed hairpin structure DNA probe was titled as adenosine based molecular beacon probe (ABMB). The above ABMB was added to 1 mL Au NP solution (pH 6.5) to stand for 24 h at 4 C, the conjugate was slowly aged with addition of BSA until reach a final concentration of 1%, then 1.12 mL 375 mM MPA was added, followed by adding NaCl to reach 0.05 M final concentration. The solution was allowed to stand for another 24 h at 4 C, followed by 10 min centrifugation at 6500 rpm to concentrate the conjugates by two times. After the supernatant was discarded, the precipitated Au NP conjugate was resuspended in 1 mL of dispersion buffer (0 .1 M HEPES, pH 7.0, 0.2 M NaCl, 1% BSA), and then stored at 4 C before use. The formed gold nanoparticle conjugate was titled as Au NP-ABMB.
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
2.5. Construction of cotton thread-based device for DNA detection
3. Results and discussion
The most components of the cotton thread are cellulose. The cellulose has many hydrophilic hydroxyl groups. Cotton threads were boiled by 2 M NaCl for 30 min, and then soaked in 0.01% H2O2 and 0.01 M HCl for 5 min, respectively, followed by washing with large amount of ultrapure water. Finally, cotton threads were dried at 37 C and stored for further use. The test zone was coated with 0.4 mL (applied as two aliquots of 0.2 mL, with 10 min drying at 37 C after each step) of streptavidin at a concentration of 2.0 mg mL1, and then dried at 37 C for 1 h in drying oven. The streptavidin bound tightly to the surface of the cotton thread through a combination of electrostatic and hydrophobic interactions [10]. Double faced adhesive tapes were stuck to a clean plastic pad in parallel ways with a space wide about 4 cm. Streptavidin coated cotton threads were attached to these adhesive tapes and the test zone on the thread was located in the middle of the space. An absorbent pad and a glass fiber (1.5 4.0 mm) were placed at each end of the thread to serve as a capillary pump to draw the liquid and sample pad for loading sample solutions, respectively.
3.1. Cotton thread-based device for DNA test
2.6. Assay procedure To perform an assay, eight microliters sample solution containing a desired concentration of complementary and single base mismatched DNA sequences were added to 50 mL Au NP–ABMB conjugates to react for 30 min. The mixture solution was added onto the sample pad, and the solution migrated toward the absorbent pad. The test zone was evaluated visually within 15 min. For quantitative measurements, the optical intensity of the red bands was read using the scanner combined with “ImageJ” software. For detection of target DNA in complex biological matrixes, such as serum, 4 mL of serum spiked with different quantities of target DNA was applied onto the biosensor, and then 4 mL of running buffer was applied. 0.1 M HEPES (pH 7.0, 0.2 M NaCl) was running buffer. Other procedures are similar to above mentioned procedures.
71
For the construction of the cotton thread-based DNA detection device, we designed a specific DNA probe which has ability to recognize the fumarylacetoacetate hydrolase gene mutation for human genetic disease, hereditary tyrosinemia type I. The DNA probe has 8 adenosine bases at each end and an 18 mer sequences in the middle of the DNA probe which has ability to interact with complementary DNA sequence (DNA2) through hybridization. Moreover, the DNA probe with a thiol group and a biotin group on each end was titled as DNA1. As illustrated in Scheme 1, DNA1 will form a hairpin structure in the presence of coralyne. Some previous references indicated that coralyne is a small molecule which can react with adsonine in a molar ratio of 1:4 [5,21–23]. The formed hairpin structure DNA probe was immobilized on the surface of Au NPs (40 5 nm) through self assembling to form a gold nanoparticle conjugate (Au NP–DNA1). In the presence of complementary DNA sequence, the hairpin structure will be opened and the biotin group will be released and keep far away from the gold nanoparticle surface. BSA was added to block the nonspecific sites on the gold nanoparticles. The mixture solution was finally moved to the sample pad of the cotton thread device and fluid through the thread to the adsorbent pad. The gold nanoparticle conjugates will be captured by the streptavidin pre-immobilized on the test zone. A red band can be observed with naked eyes as a qualitative test mean. The assay results were visible to the eye and were quantified using a commercial scanner. A scanner is an economic alternative to a densitometer that is commonly used to read lateral flow tests. Typical photo-images (A) and corresponding responses of the cotton thread based device (B) in the presence of 0 and 100 nM of target DNA2 are shown in Fig. 1. As can be seen in Fig. 1, red bands will appear on the test zone of threads in the presence of target DNA2, while no red bands can be observed in the absence of target DNA2. The difference of the color intensity peaks is evident as can be seen in the Fig. 1B.
[(Fig._1)TD$IG] [(Schem_1)TD$FIG]
Scheme 1. The principle of cotton thread-based device for DNA detection.
Fig. 1. Typical photo images (A) and corresponding responses (B) of the cotton thread-based immunoassay device in the presence of 0 and 100 nM target DNA2. The intensities of red bands on the test zone were calculated using the image processing software ImageJ.
72
[(Fig._2)TD$IG]
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
Fig. 2. Effect of hybridization time on the color intensity of the device (from left to right: 5, 10, 20, 30, 40, 60 min). The hybridization temperature was room temperature; the concentration of complementary target DNA2 was 50 nM.
3.2. Optimization of experimental condition 3.2.1. Effect of hybridization time The kinetics of hairpin invasion by the target was analyzed by monitoring color intensity as a function of hybridization time. The effect of hybridization time on the color intensity in the presence of 50 nM target DNA2 sequence once ABMB was used as capture probe is shown in Fig. 2. The signal intensity (gray bars) increased with a gradually increasing hybridization time up to 30 min and would keep stable after 30 min, while the background (black bars) almost kept stable with the increasing hybridization time. However, signal intensity (gray bars) is similar for 30 and 60 min hybridization reaction (Fig. 2), so 30 min hybridization was selected as the optimized condition. 3.2.2. Effect of hybridization temperature of capture probe According to similar reports, coralyne, a small crescent-shaped molecule, is placed onto the flute of the formed duplex with a stoichiometry of 1 coralyne per 4 adenine bases [5,21–23]. The signal intensity increased with a gradually increasing hybridization temperature (Fig. 3, gray bars), while the background (Fig. 3, black bars) would increase with enhancing hybridization temperature from 25 C to 60 C. Considering to obtain relative higher signal to noise ratio of the biosensor, 25 C were used as the optimal hybridization temperature for ABMB. Conducting bioassay under room temperature means that fewer instruments will be used through the whole assay.
[(Fig._4)TD$IG]
Fig. 4. Effect of immobilizing times of streptavidin on the test zone (A) two times and (B) four times; the concentration of complementary target DNA2 was 100 nM.
3.2.3. Effect of immobilizing times of streptavidin on the test zone The response of the device is relevant to the times of immobilizing streptavidin on the test zone. Fig. 4 shows that the effect of the times of immobilizing streptavidin on the test zone responses in the presence of 100 nM complementary target DNA2 sequence. The results showed that the background (blank bars) and corresponding responses (gray bars) of the device would increase with the increasing of streptavidin immobilizing times. The signal to noise ratio (S/N) was found to be the highest for immobilizing streptavidin two times (Fig. 4A). The decrease in the S/N at more immobilizing times is ascribed to the increased background signal (Fig. 4B). Therefore, immobilizing twice was selected as the optimal immobilizing time in the following experiments. 3.2.4. Detection of target DNA in human serum To test the practicability of the device, experiments were performed by detection of target DNA2 in human serum (Fig. 5). The sample solutions were prepared by spiking target DNA2 into human serum. The resulting calibration plot (Fig. 5A) of the logarithm of peak areas versus target DNA2 quantity is linear over the 2.5–100 nM range with a detection limit of 2.5 nM (based on S/N = 3). A series of measurements of 50 nM target DNA2 with eight well prepared cotton thread based devices yielded a reproducible signal with a relative standard deviation of 9.8% (data not shown). Comparing with our previous work [6] the cotton thread based DNA detection device greatly simplifies the whole assay procedures. The performance of the device for detection of target DNA2 in human serum demonstrates the promise of using the proposed device for developing diagnostic medical systems in clinical applications.
[(Fig._3)TD$IG] [(Fig._5)TD$IG]
Fig. 3. Effect of hybridization temperature on the color intensity of the device. Thirty minutes hybridization time; the concentration of complementary target DNA2 was 50 nM.
Fig. 5. The resulting calibration curve (left) of the cotton thread-based DNA detection in the presence of different concentration of complementary DNA2 sequences and corresponding peaks (right) in human serum sample solutions under optimal conditions. From a to f: 2.5, 5, 10, 20, 50 and 100 nM.
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
[(Fig._6)TD$IG]
73
Acknowledgments This work was supported by the National Natural Science Foundation of China (Grant no. 21205094), NFFTBS (No. J1103311 and J1210057) and by the New Faculty Startup Funds of Northwest University in Shaanxi Province (Grant no. PR12011). References
Fig. 6. Obtained responses of the device in the presence of 0 nM complementary target DNA2 (A), 50 nM non-complementary target DNA6 (B), 50 nM single base mismatched target DNA3 (C), 50 nM single base mismatched target DNA4 (D), 50 nM single base mismatched target DNA5 (E) and 50 nM complementary target DNA2 (F) in human serum sample solutions under optimal conditions.
3.3. The discrimination of single base mismatched DNA In the study, we designed a sequence (DNA1) which has ability to recognize the fumarylacetoacetate hydrolase gene mutation for human genetic disease, hereditary tyrosinemia type I [20]. The response histograms of the cotton thread DNA detection device in the presence of 0 nM complementary target DNA2 (A), 50 nM non-complementary target DNA6 (B), 50 nM single base mismatched target DNA3 (C), 50 nM single base mismatched target DNA4 (D), 50 nM single base mismatched target DNA5 (E) and 50 nM complementary target DNA2 (F) are shown in Fig. 6. Results indicated that the developed device has ability to discriminate single base mismatched DNA sequence. These results showed our designed DNA probe hold great promise for specifically identification of the gene of disease. Comparing with the results of previous report [5], the ability for discriminating the single base mismatched DNA of our developed device was improved undoubtedly. 4. Conclusions In conclusion, we introduced a novel room temperature DNA detection device by using adenosine based molecular beacon probe. These special protocols greatly simplified assay procedures for DNA test due to assay format is just like traditional lateral flow strip. Moreover, the whole assays were conducted under room temperature. The cotton thread based device provides an alternative tool for diseases biomarkers detection in developing countries due to the low cost, simple preparation and user-friendly characters of the cotton thread. The device for DNA test employed a novel DNA probe just like traditional molecular beacon probe. The novel DNA probe would form a hairpin structure in the presence of a small molecule, coralyne. The design has an advantage over traditional molecular beacon probe due to the relatively lower affinity of the hairpin structure, which made the DNA detection in room temperature realizable. The sample solution required for device is less than 10 microliters due to the small size of the thread, conjugate pads and sample pad employed. The internal characters of cotton threads made it an ideal candidate for multiplexing test. Future works will focus on improving detection sensitivity for DNA test by introducing various DNA amplification protocols.
[1] S. Tyagi, F.R. Kramer, Molecular beacons: probes that fluoresce upon hybridization, Nat. Biotechnol. 14 (1996) 303–308. [2] B. Bockisch, T. Grunwald1, E. Spillner, R. Bredehorst, Immobilized stem-loop structured probes as conformational switches for enzymatic detection of microbial 16S rRNA, Nucleic Acids Res. 33 (2005) e101. [3] X. Mao, J.H. Jiang, X.M. Xu, X. Chu, Y. Luo, G.L. Shen, R.Q. Yu, Enzymatic amplification detection of DNA based on molecular beacon biosensors, Biosens. Bioelectron. 23 (2008) 1555–1561. [4] J.S. Ren, J.B. Chaires, Sequence and structural selectivity of nucleic acid binding ligands, Biochemistry 38 (1999) 16067–16075. [5] Y.H. Lin, W.L. Tseng, A room-temperature adenosine-based molecular beacon for highly sensitive detection of nucleic acids, Chem. Commun. 48 (2012) 6262–6264. [6] T.-E. Du, X. Mao, M.Y. Jin, T. Zhang, Y. Zhang, A novel room temperature nucleic acid detection method based on immobilization of adenosine-based molecular beacon, Sens. Actuators B 198 (2014) 194–200. [7] M. Reches, K.A. Mirica, R. Dasgupta, M.D. Dickey, M.J. Butte, G.M. Whitesides, Thread as a matrix for biomedical assays, ACS Appl. Mater. Interfaces 2 (2010) 1722–1728. [8] X. Li, J.F. Tian, W. Shen, Thread as a versatile material for low-cost microfluidic diagnostics, ACS Appl. Mater. Interfaces 2 (2010) 1–6. [9] R. Safavieh, G.Z. Zhou, D. Juncker, Microfluidics made of yarns and knots: from fundamental properties to simple networks and operations, Lab Chip 11 (2011) 2618–2624. [10] G. Zhou, X. Mao, D. Juncker, Immunochromatographic assay on thread, Anal. Chem. 84 (2012) 7736–7743. [11] X. Mao, M. Baloda, A.S. Gurung, Y. Lin, G.D. Liu, Multiplex electrochemical immunoassay using gold nanoparticle probes and immunochromatographic strips, Electrochem. Commun. 10 (2008) 1636–1640. [12] H. Xu, X. Mao, Q.X. Zeng, S.F. Wang, A.N. Kawde, G.D. Liu, Aptamerfunctionalized gold nanoparticles as probes in a dry-reagent strip biosensor for protein analysis, Anal. Chem. 81 (2009) 669–675. [13] X. Mao, Y.Q. Ma, A. Zhang, L.R. Zhang, L.W. Zeng, G.D. Liu, Disposable nucleic acid biosensors based on gold nanoparticle probes and lateral flow strip, Anal. Chem. 81 (2009) 1660–1668. [14] X. Mao, H. Xu, Q.X. Zeng, L.W. Zeng, G.D. Liu, Molecular beacon-functionalized gold nanoparticles as probes in dry-reagent strip biosensor for DNA analysis, Chem. Commun. 306 (7) (2009) 5–306. [15] G.D. Liu, X. Mao, J.A. Phillips, H. Xu, W.H. Tan, L.W. Zeng, Aptamer-nanoparticle strip biosensor for sensitive detection of cancer cells, Anal. Chem. 81 (2009) 10013–10018. [16] C.C. Ge, L.X. Yu, Z.Y. Fang, L.W. Zeng, An enhanced strip biosensor for rapid and sensitive detection of histone methylation, Anal. Chem. 85 (2013) 9343–9349. [17] A.M.M. Rosa, A.F. Louro, S.A.M. Martins, A.M. Ina’cio João, D. Azevedo, M.F. Prazeres, Capture and detection of DNA hybrids on paper via the anchoring of antibodies with fusions of carbohydrate binding modules and ZZ-domains, Anal. Chem. 86 (2014) 4340–4347. [18] A.W. Martinez, S.T. Phillips, M.J. Butte, G.M. Whitesides, Patterned paper as a platform for inexpensive low-volume, portable bioassays, Angew. Chem. Int. Ed. 46 (2007) 1318–1320. [19] C. Millipore, A short guide: developing immunochromatographic test strips, 1996. [20] P.S. Andersen, C. Jespersgaard, J. Vuust, M. Christiansen, L.A. Larsen, Highthroughput single strand conformation polymorphism mutation detection by automated capillary array electrophoresis: validation of the method, Hum. Mutat. 21 (2003) 116–122. [21] M. Polak, N.V. Hud, Controlling nucleic acid secondary structure by intercalation: effects of DNA strand length on coralyne-driven duplex disproportionation, Nucleic Acids Res. 30 (2002) 983–992. [22] S.S. Jain, M. Polak, N.V. Hud, Controlling nucleic acid secondary structure by intercalation: effects of DNA strand length on coralyne-driven duplex disproportionation, Nucleic Acids Res. 31 (2003) 4608–4615. [23] Ö. Persil, C.T. Santai, S.S. Jain, N.V. Hud, Assembly of an antiparallel homoadenine DNA duplex by small-molecule binding, J. Am. Chem. Soc. 126 (2004) 8644–8645.
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
A novel adenosine-based molecular beacon probe for room temperature nucleic acid rapid detection in cotton thread device Ting-E. Du, Yiyun Wang, Yi Zhang, Tian Zhang, Xun Mao * Key Laboratory of Synthetic and Natural Functional Molecule Chemistry of Ministry of Education, College of Chemistry & Materials Science, Northwest University, Xi'an, Shaanxi Province 710127, PR China
H I G H L I G H T S
G R A P H I C A L A B S T R A C T
Natural cotton thread-based pointof-care diagnosis devices. A room temperature nucleic acid detection method. A novel molecular beacon technique based on poly adenosine and coralyne interaction. The test device is capable of discrimination single base mismatched sequences. Simple preparation, low cost, rapid detection, easy to handle.
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 November 2014 Received in revised form 19 December 2014 Accepted 25 December 2014 Available online 27 December 2014
We used cotton thread as substrate to develop a novel room temperature DNA detection device for low-cost, sensitive and rapid detection of a human genetic disease, hereditary tyrosinemia type I related DNA sequences. A novel adenosine based molecular beacon (ABMB) probe modified on gold nanoparticle was used as reporter probe. In the presence of coralyne, a small molecule which can react with adenosines, the ABMB would form a hairpin structure just like traditional molecular beacon used extensively. In the presence of target DNA sequences, the hairpin structure of ABMB modified on gold nanoparticles will be opened and the biotin group modified at one end of the DNA probes will be released and react with the streptavidin immobilized on the test zone of the cotton thread. The response of the thread based DNA test device is linear over the range of 2.5–100 nM complementary DNA. The ability of our developed device for discriminating the single base mismatched DNA related to a human genetic disease, hereditary tyrosinemia type I, was improved comparing with previous report. It is worth mentioning that the whole assay procedure for DNA test is performed under room temperature which simplified the assay procedures greatly. ã 2015 Elsevier B.V. All rights reserved.
Keywords: Room temperature Cotton thread device Point-of-care diagnosis Single base mismatch discrimination
1. Introduction
* Corresponding author. Tel.: +2988303287; fax: +27872334483. E-mail address: [email protected] (X. Mao). http://dx.doi.org/10.1016/j.aca.2014.12.044 0003-2670/ ã 2015 Elsevier B.V. All rights reserved.
Tyagi and Kramer [1] first reported the fluorescent molecular beacon (MB) in 1996 as nucleic acid probe, being able to initiate conformational change spontaneously due to the hybridization with complementary nucleic acid target. In recent years, nanomaterials including gold nanoparticle and carbon nanotube were employed as
70
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
substrates to immobilize molecular beacons. Bockisch et al. developed a novel DNA stem-loop structured probe for enzymatic detection of nucleic acid target based on the molecular beacon immobilized on the surface of microplate and electrode [2,3]. The study of interaction between adenosine and coralyne was first reported by Ren and Chaires in 1999 [4]. In 2012, Lin and Tseng utilized coralyne, a special molecule able to interact with adenosine, to design a novel molecular beacon. In the report, the fluorescence method was used to realize quantitative detection of target DNA molecules successfully [5]. However, their obtained results indicated that the discrimination of single base mismatched target DNA sequences were not satisfied. We have improved the performance by using microplate as substrate for fluorescence test based on the similar strategy [6]. Whitesides and Shen have proposed cotton thread as a support for making microfluidic circuits and rapid diagnostic tests [7,8]. Natural cotton thread has also been reported by David as a support for transporting and mixing liquids in lateral flow immunochromatographic assays for quantitative high-sensitivity immunoassays [9,10]. Lateral flow strip was used extensively in biomarker and disease biosensors due to its assay formats [11–19]. These cotton thread based devices own some advantages of lateral flow strip, but even possess some superior advantages due to its internal characters mentioned above. All these make it an ideal candidate for point-of-care and on-site diagnosis applications. Here we explored a cotton thread-based device for rapid, sensitive and quantitative detection of human genetic disease related DNA. The ability of our developed cotton thread-based DNA detection device for discriminating the single base mismatched DNA related to a human genetic disease, hereditary tyrosinemia type I [20] was realized by using a novel adenosine based molecular beacon probes (ABMB) which was labeled on gold nanoparticles. In the presence of target DNA sequences, the hairpin structure of ABMB modified on gold nanoparticles will be opened and the biotin group modified at one end of the DNA probes will be released and react with the streptavidin immobilized on the test zone of the thread. The thread was pasted on two parallel placed double faced adhesive tapes, and an absorbent pad was applied at the downstream end. The glass fiber loading gold nanoparticle conjugate was attached to the other end of the thread. The immunoassay format of the device is more like a lateral flow strip biosensor: sample solution and running buffer were dropped directly on the glass fiber to rehydrate the conjugates. After waiting for fifteen minutes, a red band would appear in the presence of specific analyte, which can be used as a qualitative mean. Quantitative detection can be realized by recording the color intensity of the test zone with a scanner and “ImageJ” software. The response of the thread based DNA test device is linear over the range of 2.5–100 nM complementary DNA. The ability of our developed device for discriminating the single base mismatched DNA related to a human genetic disease, hereditary tyrosinemia type I, was improved comparing with previous report. It is worth mentioning that the whole assay was conducted at room temperature in less than 0.5 h, which greatly simplify the assay procedures.
2. Experimental 2.1. Materials and reagents Cotton thread (100% mercerized) was purchased from a thread store (Xi'an). Albumin bovine serum (BSA) and human serum were supplied by Dingguo Biological Products (Beijing, China). Streptavidin from Streptomyces Avidin, and coralyne were
Table 1 DNA sequences of ABMB and tested DNA. Name
Sequence (50 –30 )
DNA1 DNA2 DNA3 DNA4 DNA5 DNA6
SH-AAAAAAAATGGACCAGATACTCACCGGAAAAAAAAA-Biotin CCGGTGAGTATCTGG CCGGTGAATATCTGG CCGGTGATTATCTGG CCGGTGACTATCTGG TCAGTGGGGTTGGACGGGATGGTGCCTGAA
obtained from Sigma–Aldrich (Shanghai, China). 3-mercapto propionic acid (MPA) was purchased from Aladdin Chemistry Co. Ltd. (Shanghai, China). DNA sequences (Table 1)were supplied by Sangon Biotech (Shanghai, China). 0.1 M HEPES (pH 7.0, 0.2 M NaCl) was used as incubating buffer. All other chemicals were of analytical reagent grade. All buffer solutions were prepared using ultrapure water. 2.2. Instrumentation Basic pH meter was purchased from Sartorius (Beijing, China). Sterilization kettle was supplied by Shanghai Boxun Industry & Commerce Co. Ltd. (Shanghai, China). High pure water distiller was obtained from Changzhou Guohua electric appliance Co. Ltd. (Jiangsu, China). CanoScan 9000F was supplied by Canon Co. Ltd. (Thailand). Drying oven was supplied by Yiheng technology Co., Ltd. (Shanghai, China). 2.3. Synthesis of gold nanoparticles (Au NPs) Au NPs with the diameter of 40 5 nm was prepared using the citrate reduction method, as described briefly as follows. 1.5 mL 1% trisodium citrate solution for synthesis of 40 5 nm Au NPs was rapidly added into a stirred boiling HAuCl4 (100 mL, 0.01%, w/v) solution. After several minutes, the color of the solution changed from violet to deep red. The obtained solution was heated for another 15 min to ensure a stable color followed by slow cooling to room temperature under stirring. The obtained Au NPs solutions were stored at 4 C for future use. 2.4. Pre-treatment of adenosine-based molecular beacon and its immobilization A well designed DNA probe modified a thiol group and a biotin group on each end was titled as DNA1 (Table 1). DNA1 was immobilized on the surface of Au NPs (40 5 nm) through self assembling. It is worth mentioning that 14 mL of 5 mM DNA probe used should be treated subsequently at 95 C and ice-cold water bath for 10 and 30 min, respectively, followed by adding 0.7 mL of 2 mM coralyne and 55.3 mL of 0.1 M HEPES (pH 7.0, 0.2 M NaCl) and reacting at room temperature for 30 min to form a hairpin structure just like traditional molecular beacon probe. The formed hairpin structure DNA probe was titled as adenosine based molecular beacon probe (ABMB). The above ABMB was added to 1 mL Au NP solution (pH 6.5) to stand for 24 h at 4 C, the conjugate was slowly aged with addition of BSA until reach a final concentration of 1%, then 1.12 mL 375 mM MPA was added, followed by adding NaCl to reach 0.05 M final concentration. The solution was allowed to stand for another 24 h at 4 C, followed by 10 min centrifugation at 6500 rpm to concentrate the conjugates by two times. After the supernatant was discarded, the precipitated Au NP conjugate was resuspended in 1 mL of dispersion buffer (0 .1 M HEPES, pH 7.0, 0.2 M NaCl, 1% BSA), and then stored at 4 C before use. The formed gold nanoparticle conjugate was titled as Au NP-ABMB.
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
2.5. Construction of cotton thread-based device for DNA detection
3. Results and discussion
The most components of the cotton thread are cellulose. The cellulose has many hydrophilic hydroxyl groups. Cotton threads were boiled by 2 M NaCl for 30 min, and then soaked in 0.01% H2O2 and 0.01 M HCl for 5 min, respectively, followed by washing with large amount of ultrapure water. Finally, cotton threads were dried at 37 C and stored for further use. The test zone was coated with 0.4 mL (applied as two aliquots of 0.2 mL, with 10 min drying at 37 C after each step) of streptavidin at a concentration of 2.0 mg mL1, and then dried at 37 C for 1 h in drying oven. The streptavidin bound tightly to the surface of the cotton thread through a combination of electrostatic and hydrophobic interactions [10]. Double faced adhesive tapes were stuck to a clean plastic pad in parallel ways with a space wide about 4 cm. Streptavidin coated cotton threads were attached to these adhesive tapes and the test zone on the thread was located in the middle of the space. An absorbent pad and a glass fiber (1.5 4.0 mm) were placed at each end of the thread to serve as a capillary pump to draw the liquid and sample pad for loading sample solutions, respectively.
3.1. Cotton thread-based device for DNA test
2.6. Assay procedure To perform an assay, eight microliters sample solution containing a desired concentration of complementary and single base mismatched DNA sequences were added to 50 mL Au NP–ABMB conjugates to react for 30 min. The mixture solution was added onto the sample pad, and the solution migrated toward the absorbent pad. The test zone was evaluated visually within 15 min. For quantitative measurements, the optical intensity of the red bands was read using the scanner combined with “ImageJ” software. For detection of target DNA in complex biological matrixes, such as serum, 4 mL of serum spiked with different quantities of target DNA was applied onto the biosensor, and then 4 mL of running buffer was applied. 0.1 M HEPES (pH 7.0, 0.2 M NaCl) was running buffer. Other procedures are similar to above mentioned procedures.
71
For the construction of the cotton thread-based DNA detection device, we designed a specific DNA probe which has ability to recognize the fumarylacetoacetate hydrolase gene mutation for human genetic disease, hereditary tyrosinemia type I. The DNA probe has 8 adenosine bases at each end and an 18 mer sequences in the middle of the DNA probe which has ability to interact with complementary DNA sequence (DNA2) through hybridization. Moreover, the DNA probe with a thiol group and a biotin group on each end was titled as DNA1. As illustrated in Scheme 1, DNA1 will form a hairpin structure in the presence of coralyne. Some previous references indicated that coralyne is a small molecule which can react with adsonine in a molar ratio of 1:4 [5,21–23]. The formed hairpin structure DNA probe was immobilized on the surface of Au NPs (40 5 nm) through self assembling to form a gold nanoparticle conjugate (Au NP–DNA1). In the presence of complementary DNA sequence, the hairpin structure will be opened and the biotin group will be released and keep far away from the gold nanoparticle surface. BSA was added to block the nonspecific sites on the gold nanoparticles. The mixture solution was finally moved to the sample pad of the cotton thread device and fluid through the thread to the adsorbent pad. The gold nanoparticle conjugates will be captured by the streptavidin pre-immobilized on the test zone. A red band can be observed with naked eyes as a qualitative test mean. The assay results were visible to the eye and were quantified using a commercial scanner. A scanner is an economic alternative to a densitometer that is commonly used to read lateral flow tests. Typical photo-images (A) and corresponding responses of the cotton thread based device (B) in the presence of 0 and 100 nM of target DNA2 are shown in Fig. 1. As can be seen in Fig. 1, red bands will appear on the test zone of threads in the presence of target DNA2, while no red bands can be observed in the absence of target DNA2. The difference of the color intensity peaks is evident as can be seen in the Fig. 1B.
[(Fig._1)TD$IG] [(Schem_1)TD$FIG]
Scheme 1. The principle of cotton thread-based device for DNA detection.
Fig. 1. Typical photo images (A) and corresponding responses (B) of the cotton thread-based immunoassay device in the presence of 0 and 100 nM target DNA2. The intensities of red bands on the test zone were calculated using the image processing software ImageJ.
72
[(Fig._2)TD$IG]
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
Fig. 2. Effect of hybridization time on the color intensity of the device (from left to right: 5, 10, 20, 30, 40, 60 min). The hybridization temperature was room temperature; the concentration of complementary target DNA2 was 50 nM.
3.2. Optimization of experimental condition 3.2.1. Effect of hybridization time The kinetics of hairpin invasion by the target was analyzed by monitoring color intensity as a function of hybridization time. The effect of hybridization time on the color intensity in the presence of 50 nM target DNA2 sequence once ABMB was used as capture probe is shown in Fig. 2. The signal intensity (gray bars) increased with a gradually increasing hybridization time up to 30 min and would keep stable after 30 min, while the background (black bars) almost kept stable with the increasing hybridization time. However, signal intensity (gray bars) is similar for 30 and 60 min hybridization reaction (Fig. 2), so 30 min hybridization was selected as the optimized condition. 3.2.2. Effect of hybridization temperature of capture probe According to similar reports, coralyne, a small crescent-shaped molecule, is placed onto the flute of the formed duplex with a stoichiometry of 1 coralyne per 4 adenine bases [5,21–23]. The signal intensity increased with a gradually increasing hybridization temperature (Fig. 3, gray bars), while the background (Fig. 3, black bars) would increase with enhancing hybridization temperature from 25 C to 60 C. Considering to obtain relative higher signal to noise ratio of the biosensor, 25 C were used as the optimal hybridization temperature for ABMB. Conducting bioassay under room temperature means that fewer instruments will be used through the whole assay.
[(Fig._4)TD$IG]
Fig. 4. Effect of immobilizing times of streptavidin on the test zone (A) two times and (B) four times; the concentration of complementary target DNA2 was 100 nM.
3.2.3. Effect of immobilizing times of streptavidin on the test zone The response of the device is relevant to the times of immobilizing streptavidin on the test zone. Fig. 4 shows that the effect of the times of immobilizing streptavidin on the test zone responses in the presence of 100 nM complementary target DNA2 sequence. The results showed that the background (blank bars) and corresponding responses (gray bars) of the device would increase with the increasing of streptavidin immobilizing times. The signal to noise ratio (S/N) was found to be the highest for immobilizing streptavidin two times (Fig. 4A). The decrease in the S/N at more immobilizing times is ascribed to the increased background signal (Fig. 4B). Therefore, immobilizing twice was selected as the optimal immobilizing time in the following experiments. 3.2.4. Detection of target DNA in human serum To test the practicability of the device, experiments were performed by detection of target DNA2 in human serum (Fig. 5). The sample solutions were prepared by spiking target DNA2 into human serum. The resulting calibration plot (Fig. 5A) of the logarithm of peak areas versus target DNA2 quantity is linear over the 2.5–100 nM range with a detection limit of 2.5 nM (based on S/N = 3). A series of measurements of 50 nM target DNA2 with eight well prepared cotton thread based devices yielded a reproducible signal with a relative standard deviation of 9.8% (data not shown). Comparing with our previous work [6] the cotton thread based DNA detection device greatly simplifies the whole assay procedures. The performance of the device for detection of target DNA2 in human serum demonstrates the promise of using the proposed device for developing diagnostic medical systems in clinical applications.
[(Fig._3)TD$IG] [(Fig._5)TD$IG]
Fig. 3. Effect of hybridization temperature on the color intensity of the device. Thirty minutes hybridization time; the concentration of complementary target DNA2 was 50 nM.
Fig. 5. The resulting calibration curve (left) of the cotton thread-based DNA detection in the presence of different concentration of complementary DNA2 sequences and corresponding peaks (right) in human serum sample solutions under optimal conditions. From a to f: 2.5, 5, 10, 20, 50 and 100 nM.
T.-E. Du et al. / Analytica Chimica Acta 861 (2015) 69–73
[(Fig._6)TD$IG]
73
Acknowledgments This work was supported by the National Natural Science Foundation of China (Grant no. 21205094), NFFTBS (No. J1103311 and J1210057) and by the New Faculty Startup Funds of Northwest University in Shaanxi Province (Grant no. PR12011). References
Fig. 6. Obtained responses of the device in the presence of 0 nM complementary target DNA2 (A), 50 nM non-complementary target DNA6 (B), 50 nM single base mismatched target DNA3 (C), 50 nM single base mismatched target DNA4 (D), 50 nM single base mismatched target DNA5 (E) and 50 nM complementary target DNA2 (F) in human serum sample solutions under optimal conditions.
3.3. The discrimination of single base mismatched DNA In the study, we designed a sequence (DNA1) which has ability to recognize the fumarylacetoacetate hydrolase gene mutation for human genetic disease, hereditary tyrosinemia type I [20]. The response histograms of the cotton thread DNA detection device in the presence of 0 nM complementary target DNA2 (A), 50 nM non-complementary target DNA6 (B), 50 nM single base mismatched target DNA3 (C), 50 nM single base mismatched target DNA4 (D), 50 nM single base mismatched target DNA5 (E) and 50 nM complementary target DNA2 (F) are shown in Fig. 6. Results indicated that the developed device has ability to discriminate single base mismatched DNA sequence. These results showed our designed DNA probe hold great promise for specifically identification of the gene of disease. Comparing with the results of previous report [5], the ability for discriminating the single base mismatched DNA of our developed device was improved undoubtedly. 4. Conclusions In conclusion, we introduced a novel room temperature DNA detection device by using adenosine based molecular beacon probe. These special protocols greatly simplified assay procedures for DNA test due to assay format is just like traditional lateral flow strip. Moreover, the whole assays were conducted under room temperature. The cotton thread based device provides an alternative tool for diseases biomarkers detection in developing countries due to the low cost, simple preparation and user-friendly characters of the cotton thread. The device for DNA test employed a novel DNA probe just like traditional molecular beacon probe. The novel DNA probe would form a hairpin structure in the presence of a small molecule, coralyne. The design has an advantage over traditional molecular beacon probe due to the relatively lower affinity of the hairpin structure, which made the DNA detection in room temperature realizable. The sample solution required for device is less than 10 microliters due to the small size of the thread, conjugate pads and sample pad employed. The internal characters of cotton threads made it an ideal candidate for multiplexing test. Future works will focus on improving detection sensitivity for DNA test by introducing various DNA amplification protocols.
[1] S. Tyagi, F.R. Kramer, Molecular beacons: probes that fluoresce upon hybridization, Nat. Biotechnol. 14 (1996) 303–308. [2] B. Bockisch, T. Grunwald1, E. Spillner, R. Bredehorst, Immobilized stem-loop structured probes as conformational switches for enzymatic detection of microbial 16S rRNA, Nucleic Acids Res. 33 (2005) e101. [3] X. Mao, J.H. Jiang, X.M. Xu, X. Chu, Y. Luo, G.L. Shen, R.Q. Yu, Enzymatic amplification detection of DNA based on molecular beacon biosensors, Biosens. Bioelectron. 23 (2008) 1555–1561. [4] J.S. Ren, J.B. Chaires, Sequence and structural selectivity of nucleic acid binding ligands, Biochemistry 38 (1999) 16067–16075. [5] Y.H. Lin, W.L. Tseng, A room-temperature adenosine-based molecular beacon for highly sensitive detection of nucleic acids, Chem. Commun. 48 (2012) 6262–6264. [6] T.-E. Du, X. Mao, M.Y. Jin, T. Zhang, Y. Zhang, A novel room temperature nucleic acid detection method based on immobilization of adenosine-based molecular beacon, Sens. Actuators B 198 (2014) 194–200. [7] M. Reches, K.A. Mirica, R. Dasgupta, M.D. Dickey, M.J. Butte, G.M. Whitesides, Thread as a matrix for biomedical assays, ACS Appl. Mater. Interfaces 2 (2010) 1722–1728. [8] X. Li, J.F. Tian, W. Shen, Thread as a versatile material for low-cost microfluidic diagnostics, ACS Appl. Mater. Interfaces 2 (2010) 1–6. [9] R. Safavieh, G.Z. Zhou, D. Juncker, Microfluidics made of yarns and knots: from fundamental properties to simple networks and operations, Lab Chip 11 (2011) 2618–2624. [10] G. Zhou, X. Mao, D. Juncker, Immunochromatographic assay on thread, Anal. Chem. 84 (2012) 7736–7743. [11] X. Mao, M. Baloda, A.S. Gurung, Y. Lin, G.D. Liu, Multiplex electrochemical immunoassay using gold nanoparticle probes and immunochromatographic strips, Electrochem. Commun. 10 (2008) 1636–1640. [12] H. Xu, X. Mao, Q.X. Zeng, S.F. Wang, A.N. Kawde, G.D. Liu, Aptamerfunctionalized gold nanoparticles as probes in a dry-reagent strip biosensor for protein analysis, Anal. Chem. 81 (2009) 669–675. [13] X. Mao, Y.Q. Ma, A. Zhang, L.R. Zhang, L.W. Zeng, G.D. Liu, Disposable nucleic acid biosensors based on gold nanoparticle probes and lateral flow strip, Anal. Chem. 81 (2009) 1660–1668. [14] X. Mao, H. Xu, Q.X. Zeng, L.W. Zeng, G.D. Liu, Molecular beacon-functionalized gold nanoparticles as probes in dry-reagent strip biosensor for DNA analysis, Chem. Commun. 306 (7) (2009) 5–306. [15] G.D. Liu, X. Mao, J.A. Phillips, H. Xu, W.H. Tan, L.W. Zeng, Aptamer-nanoparticle strip biosensor for sensitive detection of cancer cells, Anal. Chem. 81 (2009) 10013–10018. [16] C.C. Ge, L.X. Yu, Z.Y. Fang, L.W. Zeng, An enhanced strip biosensor for rapid and sensitive detection of histone methylation, Anal. Chem. 85 (2013) 9343–9349. [17] A.M.M. Rosa, A.F. Louro, S.A.M. Martins, A.M. Ina’cio João, D. Azevedo, M.F. Prazeres, Capture and detection of DNA hybrids on paper via the anchoring of antibodies with fusions of carbohydrate binding modules and ZZ-domains, Anal. Chem. 86 (2014) 4340–4347. [18] A.W. Martinez, S.T. Phillips, M.J. Butte, G.M. Whitesides, Patterned paper as a platform for inexpensive low-volume, portable bioassays, Angew. Chem. Int. Ed. 46 (2007) 1318–1320. [19] C. Millipore, A short guide: developing immunochromatographic test strips, 1996. [20] P.S. Andersen, C. Jespersgaard, J. Vuust, M. Christiansen, L.A. Larsen, Highthroughput single strand conformation polymorphism mutation detection by automated capillary array electrophoresis: validation of the method, Hum. Mutat. 21 (2003) 116–122. [21] M. Polak, N.V. Hud, Controlling nucleic acid secondary structure by intercalation: effects of DNA strand length on coralyne-driven duplex disproportionation, Nucleic Acids Res. 30 (2002) 983–992. [22] S.S. Jain, M. Polak, N.V. Hud, Controlling nucleic acid secondary structure by intercalation: effects of DNA strand length on coralyne-driven duplex disproportionation, Nucleic Acids Res. 31 (2003) 4608–4615. [23] Ö. Persil, C.T. Santai, S.S. Jain, N.V. Hud, Assembly of an antiparallel homoadenine DNA duplex by small-molecule binding, J. Am. Chem. Soc. 126 (2004) 8644–8645.