- Email: [email protected]
A novel alternatively spliced interleukin-1 receptor accessory protein mIL-1RAcP687
Available online at www.sciencedirect.com
Molecular Immunology 45 (2008) 1374–1384
A novel alternatively spliced interleukin-1 receptor accessory protein mIL-1RAcP687 Hsin-Lin Lu 1 , Chih-Yung Yang 1 , Hui-Chun Chen, Chia-Sui Hung, Yu-Chi Chiang, Ling-Pai Ting ∗ Institute of Microbiology and Immunology, School of Life Sciences, National Yang-Ming University, Pei-Tou, Taipei 11221, Taiwan, ROC Received 24 August 2007; received in revised form 3 September 2007; accepted 6 September 2007 Available online 18 October 2007
Abstract The 570-amino acid membrane form of IL-1RAcP (mIL-1RAcP) plays a pivotal role in the IL-1 signal transduction and response. We have identified another membrane form of IL-1RAcP with 687 amino acids (named as mIL-1RAcP687 hereon). Its except the last amino acid N-terminal 448 amino acid portion, containing three extracellular immunoglobulin domains, one transmembrane domain, and Box 1 and Box 2 of Toll/IL1 Receptor (TIR) domain, is identical to that of mIL-1RAcP. In contrast, the C-terminal 239 amino acid portion of mIL-1RAcP687, containing Box 3 of TIR domain, is unique. The mIL-1RAcP687 splice variant is derived from the first 11 exons except 9b, and a newly identified exon 13 of IL-1RAcP gene, while mIL-1RAcP is derived from the first 12 exons except 9b. Furthermore, mIL-1RAcP687 can associate with proteins involved in the upstream IL-1 signaling pathway such as IL-1RI, Tollip, and MyD88. It thus activates downstream signaling events to activate transcription factor NF-B, and induce the expression of IL-1 responsive genes such as TNF-␣ and GM-CSF. These results demonstrate that like mIL-1RAcP, mIL-1RAcP687 functions in the IL-1 signal transduction and response. Identification of mIL-1RAcP687 adds further complexity to the regulation of IL-1 signaling and its subsequent response. © 2007 Elsevier Ltd. All rights reserved. Keywords: IL-1 receptor accessory protein; Interleukin-1; IL-1 receptor; IL-1 signal transduction; MyD88; Tollip
1. Introduction The proinflammatory cytokine interleukin-1 (IL-1) initiates a wide variety of inflammatory and immunological responses to infection, stress, and tissue damage (Dinarello, 1996). IL-1 response is initiated by binding of IL-1 to type I IL-1 receptor (IL-1RI). A second protein, the membrane form of IL-1 receptor accessory protein (mIL-1RAcP), is recruited to the IL-1/IL-1RI complex. It is an essential component of the IL1RI receptor complex for signaling (Cullinan et al., 1998; Greenfeder et al., 1995; Huang et al., 1997; Wesche et al., 1997b). This trimeric IL-1/IL-1RI/IL-1RAcP complex recruits several adaptor proteins and kinases, including myeloid differentiation factor 88 (MyD88), Toll-interacting protein (Tollip), and members of the IL-1RI-associated kinase family (Burns
∗ 1
Corresponding author. Tel.: +886 2 28267106; fax: +886 2 28212880. E-mail address: [email protected] (L.-P. Ting). Both the authors made equal contributions to this work.
0161-5890/$ – see front matter © 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2007.09.002
et al., 1998; Huang et al., 2005; Janssens and Beyaert, 2003; Medzhitov et al., 1998; Wesche et al., 1997a). Signal events trigger the activation of IB kinase (IKK) complex and specific mitogen-activated protein kinase kinases (MKKs). The former phosphorylates the nuclear factor B inhibitor (IB) and leads to the activation of nuclear factor B (NF-B), which translocates into nucleus and regulates the expression of IL-1 response genes. The latter phosphorylates and activates members of the c-Jun N-terminal kinase (JNK)/p38 mitogenactivated protein kinase (MAPK) family, which translocates into nucleus and phosphorylates several transcription factors of the basic leucine zipper family, like c-Jun and c-Fos (Dunne and O’Neill, 2003; Li and Qin, 2005; Subramaniam et al., 2004). The human IL-1RAcP gene located on chromosome 3q28 has been reported to contain 12 exons spanning more than 137 kb (Jensen et al., 2000). Three alternatively spliced IL-1RAcP mRNAs have previously been identified (Huang et al., 1997; Jensen et al., 2000; Jensen and Whitehead, 2003). The splice variant derived from 12 exons except 9b encodes the 570 amino
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
acid membrane form of IL-1RAcP (named as mIL-1RAcP), comprising the three extracellular Ig domains, the transmembrane domain, and intracellular domain including TIR domain. TIR domain possesses three conserved regions (Boxes 1–3) that contain crucial amino acids for signaling. mIL-1RAcP forms a complex with IL-1/IL-1RI to initiate the signal transduction of IL-1 (Huang et al., 1997). The splice variant derived from the first nine exons encodes the 356 amino acid-long soluble form of IL-1RAcP, sIL-1RAcP. It lacks the transmembrane and intracellular domain. The sIL-1RAcP, which is produced in response to stress and/or acute-phase induction and present at high levels in human serum, has been suggested to act as an inhibitor of IL-1 signaling, possibly via competitive inhibition of the interaction between mIL-1RAcP and IL-1/IL-1RI complex (Jensen et al., 2000). Furthermore, it increases the affinity of binding of human IL-1␣ and IL-1 to the soluble human type II IL-1 receptor (IL-1RII) by approximately 100-fold and thereby enhances the ability of IL-1RII to inhibit IL-1 signaling (Smith et al., 2003). The splice variant derived from 12 exons except exon 9 encodes the 346 amino acid-long soluble form of IL-1RAcP, sIL-1RAcP, which has a unique second half of the third Ig domain. The sIL-1RAcP, which is exclusively expressed in staurosporine-treated cells, may have similar functions as sIL-1RAcP (Jensen and Whitehead, 2003). We have identified another membrane form of IL-1RAcP with 687 amino acids (named as mIL-1RAcP687 hereafter). Its N-terminal 448 amino acid-long portion is identical to that of mIL-1RAcP. In contrast, the C-terminal 239 amino acidlong portion of IL-1RAcP687 is unique. The mIL-1RAcP687 is encoded by the first 11 exons except 9b, and a previously unidentified exon 13 of IL-1RAcP gene. Furthermore, mIL1RAcP687, like mIL-1RAcP, interacts with the upstream IL-1 signaling molecules such as IL-1RI, Tollip, and MyD88. It transduces signal to activate transcription factor NF-B, and induce the expression of IL-1 responsive genes TNF-␣ and GM-CSF.
1375
vector to generate pFLAG-mIL-1RAcP687. The full-length IL1RI was inserted downstream of a CMV promoter in a pCMV vector to generate pIL-1RI. pFLAG-mIL-1RAcP was previously described (Yang et al., 2006). 2.3. Reverse transcriptase-PCR and nested PCR The Ready-to-GoTM kit was used for RT-PCR according to the manufacturer’s recommendation. RT-PCR reactions containing total cellular RNA of human hepatoma HuH7 cells and primers were done in a single-tube format and a 50 l reaction volume. For mIL-1RAcP, exon 12 reverse primer (rpr12, GAGCTCGAGCACCCCTTGTTCTTT, underlined nts indicate nts 1958 and 1941, respectively) is the primer used for RT reaction; exon 6 primer (pr6-2, nts 895–916, CTGTAAAGGTAGTAGGCTCTCC) and rpr12 are the primers used for PCR reaction; exon 9a primer (pr9a, TAGCGCAGCTATGTCTGTCATGC, underlined nts indicate nts 1186 and 1207, respectively) and rpr12 are the primers used for nest PCR reaction; nest PCR product was 780 bps long. For mIL-1RAcP687, exon 13 primer (rpr13-2, nts 2253–2233, CGTTGTTATTGGATAAGTCCG) is the primer used for RT reaction; exon 1 (pr1, nts 2–19, GCCGGGATCCAGGTCTCC), exon 2 (pr2, nts 119–139, GCATCGTCATGTGATCATCAC), exon 3 (pr3, nts 207–232, ATGACACTTCTGTGGTGTGTAGTCGAG), exon 5 (pr5, nts 571–590, GCAGCAAAGTTGCATTTCCC) primers, and the other exon 6 (pr6-1, nts 797–814, GAGTTTCCTCATTGCCTT) primer are forward primers, respectively, and rpr13-2 was the reverse primer for PCR reaction; pr9a and the other exon 13 primer (rpr13-1, nts 1610–1588, CAGAACAACAATCATCCTTCTGC) are the primers used for nest PCR reaction; nest PCR product is 426 bps long. Nest PCR products were detected by Southern blot using EST06168 as the probe according to the standard procedure. 2.4. Cell culture and transfection
2. Materials and methods 2.1. Clones, vectors, reagents, and antibodies HIBBB70 containing EST06168 in lafmid BA vector was purchased from American Type Culture Collection. Human BAC clone RPCI-11-487B5.TJ containing the IL-1RAcP gene was from Research Genetics. Antibody against Myc was from Roche Applied Science. pCMV-Myc vector was from Stratagene. pCMV vector was constructed from our laboratory. Others are as previously described (Yang et al., 2006). 2.2. Expression vectors For cytoplasmic expression in human embryonic kidney HEK293T cells, the full-length Tollip and MyD88 were fused downstream to a Myc tag in pCMV-Myc vector to generate pMyc-Tollip and pMyc-MyD88, respectively. For membrane expression, the full-length mIL-1RAcP687 without signal peptide was fused downstream to the FLAG tag in a pFLAGCMV1
HEK293T cells as well as human hepatoma HA22T/VGH and HuH-7 cells were cultured and transfected with plasmid DNA as previously described (Yang et al., 2006). 2.5. Immunoprecipitation and Western blot Immunoprecipitation with anti-FLAG M2 beads and Western blot were performed as previously described (Yang et al., 2006). 2.6. Electrophoretic mobility shift assay Nuclear extracts of HEK293T cells were prepared and electrophoretic mobility shift assays were performed as previously described (Yang et al., 2006). 2.7. Enzyme-linked immunosorbent assay HA22T/VGH cells were seeded in 12-well flat-bottom plates and cultured for 1 day. Cells were co-transfected with expression
1376
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
plasmids as indicated for 36 h and then stimulated with 10 ng/ml of IL-1 for 16 h. Levels of TNF-␣ and GM-CSF in the culture media were measured by enzyme-linked immunosorbent assay (ELISA). ELISA was performed by adding 50 l of each sample to a 96-well plate of TNF-␣ and GM-CSF ELISA kits according to the manufacturer’s recommendation. Each experiment was performed in triplicate wells and final results were the average of three independent experiments. 3. Results 3.1. Identification of a novel membrane form of IL-1RAcP An EST clone (GenBank accession no. T08277.1) of human infant brain cDNA library was identified by us to share the sequence homology with previously reported mIL-1RAcP (GenBank NM 002182). We therefore sequenced the entire EST clone. An analysis of this sequence reveals that the 5 end sequence from nts 1 to 590 of EST06168 shows 100% identity to that from nts 962 to 1551, corresponding to the partial sequence of exon 7 and complete sequence of exons 8, 9a, 10, and 11, of mIL-1RAcP. The nts 591–1950 sequence of EST06168 does not match that after nt 1551 (exon 12) of mIL1RAcP, but contains a polyadenylation signal and the poly(A)
tail (Supplementary Fig. 1A). Accordingly, the sequence of Nterminal 196 amino acids of EST06168 shows 100% identity to that of the 253–448 amino acid region of mIL-1RAcP. The sequence of amino acid 197–315 of the former shows 33% identity and 57% similarity to amino acid 449–570 sequence of the latter. In addition, this EST contains extra 120 amino acids in its C terminus (Supplementary Fig. 1B). This analysis suggests that EST06168 may have arisen from an alternatively spliced variant of IL-1RAcP gene. To understand whether EST06168 is indeed a splice variant, the sequence of IL-1RAcP gene was analyzed. Human BAC clone RPCI-11-487B5.TJ containing the IL-1RAcP gene after exon 3 and spanning more than 177 kb was sequenced and analyzed. By comparing the sequence of EST06168 (corresponding to nts 962–2911 of mIL1RAcP687, GenBank EF591790) with the sequence obtained from RPCI-11-487B5.TJ (GenBank EF608598) and that of GenBank AC008249, NT 005612, and NW 921807, the 3 -end sequence of EST06168 matches a previously unidentified exon, exon 13 (Tables 1 and 2, Fig. 1A). The exon 13 sequence of EST06168 is completely identical to the gene sequence except an extra 52 nts from nts 1543 to 1594 of EST06168, which is absent in the gene sequence. The splicing acceptor sequence was identified as atagATAC. A polyadenylation signal is within exon 13. Therefore, the IL-1RAcP gene contains at least thirteen
Table 1 Overview of exons, introns and junctions sequences in the human IL-1 RAcP gene
*Capital alphabets (A, T, C, G) represent sequences in exons, while a, t, c, g are sequences in introns. Underline represents the poly(A) signal. Italics are predicted 5 donor sequences. The size of exon 12 is the size based on the predicted 5 donor sequence of intron 12. The size of 13 is the size before poly(A).
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
1377
Table 2 Generation of four IL-lRAcP mRNAs by alternative splicing Exon
RNA segment/protein domain
mRNA position (bp)
Exons in mIL-lRAcP
Exons in mILlRAcP687
Exons in sIL-lRAcP
Exons in sIL-lRAcP
1 2 3 4 5 6 7 8 9a 9b 10 11 12 13
5 UTR 5 UTR Signal peptide Ig 1 Ig 2A Ig 2B
1–118 119–205 206–270 271–556 557–743 744–909 910–981 982–1108 1109–1257 [1258–2041] 1258–1407, {1109–1258} 1408–1551, {1259–1402} (1552–5462), {1403–5313} 1552–2911
+ + + + + + + + + − + + + −
+ + + + + + + + + − + + − +
+ + + + + + + + + + − − − −
+ + + + + + + + − − + + + −
Ig 3A Ig 3B [Soluble C-terminal + 3 UTR] Transmembrane {Ig 3C} Intracellular {3 UTR} (Intracellular + 3 UTR), {3 UTR} Intracellular + 3 UTR
Exons present or absent in four alternative splicing RNAs of IL-lRAcP gene are indicated with + or −, respectively. Protein and RNA regions in parenthesis, angle bracket, square bracket, and braces are unique for mIL-lRAcP, mIL-1 RAcP687, sIL-1 RAcP, and sIL-lRAcP, respectively.
Fig. 1. Genomic organization of alternatively spliced variants of the human IL-1RAcP gene and its four proteins. (A) Genomic organization of the human IL-1RAcP gene and its four alternative splicing mRNAs. Positions of intron-exon boundaries were identified from the sequence of human BAC clone RPCI-11-487B5.TJ, and that of GenBank accession numbers AC008249, NT 005612, and NW 921807, mIL-1RAcP (GenBank NM 002182), mIL-1RAcP687, sIL-1RAcP (GenBank AF167343), and sIL-1RAcP (GenBank AF538734). The sequence of mIL-1RAcP687 and RPCI-11-487B5.TJ was deposited in GenBank (EF591790 and EF608598, respectively) by us. Exons are depicted as boxes, introns as thin lines, and mRNAs as thick lines. (A)n represents the poly(A) tails. (B) Schematic structure of the membrane and soluble forms of human IL-1RAcP proteins. Both soluble forms, sIL-1RAcP and sIL-1RAcP, contain the extracellular domain but lack the transmembrane and intracellular domains of the membrane forms, mIL-1RAcP and mIL-1RAcP687. SP, signal peptide; Ig, immunoglobulin domain; TM, transmembrane domain; TIR, Toll/IL1 Receptor domain. Solid triangles indicate the alternative splicing sites.
1378
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
Fig. 2. Detection of the entire mIL-1RAcP687 mRNA. Total RNA of human hepatoma HuH-7 cells was used for RT-PCR, followed by nest PCR. For mIL-1RAcP, RT-PCR was performed with the forward primer in exon 6 (pr6-2) and the mIL-1RAcP-specific reverse primer in exon 12 (rpr12). Nest PCR was then performed by using forward primer in exon 9a (pr9a) and rpr12 primer. The product is predicted to be a 780-bp fragment. For mIL-1RAcP687, RT-PCR was performed with five forward primers corresponding to sequences in exon 1, 2, 3, 5, and 6 (pr1, 2, 3, 5, and 6-1), respectively, and the mIL-1RAcP687-specific reverse primer in exon 13 (rpr13-2). Nest PCR was then performed by using pr9a and the other mIL-1RAcP687-specific reverse primer in exon 13 (rpr13-1). The products are predicted to be 426-bp fragments. Experimental details are described as in Section 2. (A) Primers used for RT-PCR and nest PCR are shown on the top. (B) The nest PCR products were detected by Southern blot using EST06168 as the probe.
exons spanning more than 142 kb, and at least four alternatively spliced IL-1RAcP mRNAs are generated.
functional. Furthermore, there is no known structural or functional domain present in the extra C-terminal 120 amino acids of mIL-1RAcP687.
3.2. Identification of mIL-1RAcP687 mRNA If EST06168 represents the partial sequence of a new IL1RAcP alternatively spliced mRNA, which contains the first 11 exons except 9b, and a newly identified exon 13, the encoded protein will be a membrane form IL-1RAcP with 687 amino acids (named mIL-1RAcP687). To demonstrate the presence of this mIL-1RAcP687 mRNA, total RNA of human hepatoma HuH-7 cells was used for RT-PCR. Nest PCR was then performed. The products are predicted to be 426- and 780-bp long fragments for mIL-1RAcP687 and mIL-1RAcP, respectively. The nest RTPCR products were detected by Southern blot analysis using EST06168 as the probe (Fig. 2). The nest RT-PCR products were also cloned and sequenced. Their sequence is consistent with the prediction, demonstrating the presence of mIL-1RAcP687 RNA in HuH-7 cells. Therefore, the mIL-1RAcP687 RNA is composed of the first 11 exons except 9b, and exon 13 (Fig. 1A, Table 2). 3.3. mIL-1RAcP687 as a new membrane IL-1RAcP protein mIL-1RAcP687 comprises three extracellular Ig domains, one transmembrane domain, and a unique intracellular domain (Fig. 3). The Box 1 sequence of TIR domain in mIL-1RAcP687 is identical to that of mIL-1RAcP, while the last amino acids in Box 2 (asparagine instead of isoleucine) and in Box 3 (alanine instead of glutamine) of mIL-1RAcP687, respectively, are different from those of mIL-1RAcP. It has been known that the most conserved sequences in Box 2 GYKLCI–RD–PGGI and Box 3 FWKK are GYKLCI–RD–PG and FW, respectively (Dunne and O’Neill, 2003). Therefore, amino acids 449 and 539 of mIL-1RAcP687 are not in the most conserved position. It is quite possible that the TIR domain of mIL-1RAcP687 is
3.4. Association of mIL-1RAcP687 with IL-1RI and recruitment of IL-1 signaling cascade components To examine whether mIL-1RAcP687 functions to form an IL1/IL-1RI/IL-1RAcP complex, we first tested its association with the upstream component of IL-1 signal transduction pathway. Human embryonic kidney HEK293T cells were co-transfected with IL-1RI as well as either FLAG-mIL-1RAcP or FLAG-mIL1RAcP687 and treated briefly with different amount of IL-1 or left untreated. M2 beads were used to immunoprecipitate FLAGmIL-1RAcP and FLAG-mIL-1RAcP687 proteins in whole cell extracts, and IL-1RI in the M2-immunoprecipitated complex was detected by anti-IL-1RI antibody. As shown in Fig. 4A, IL1RI was detected in the mIL-1RAcP immunocomplex obtained from untreated cells. Association between mIL-1RAcP and IL1RI was likely resulted from spontaneous activation due to overexpression of the two proteins. The amount of coprecipitating IL-1RI was observed to increase with the increasing amount of IL-1. These results are consistent with the previous report (Huang et al., 1997). Weak association of mIL-1RAcP687 with IL-1RI was also detected in the absence of IL-1 induction, and this association was increased with the increasing IL-1 amount. These results indicate that similar to mIL-1RAcP, mIL-1RAcP687 associates with IL-1RI in an IL-1-dependent manner. As shown in Fig. 4B, Myc-Tollip in the M2immunoprecipitated complex was detected using anti-Myc antibody. Tollip was able to associate with mIL-1RAcP as previously reported (Burns et al., 2000; Casadio et al., 2001). Association between Tollip and mIL-1RAcP was not stimulated by IL-1. Like mIL-1RAcP, Tollip associated with mIL-1RAcP687, which was not stimulated by IL-1. The asso-
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
1379
Fig. 3. Sequence alignment of four human IL-1RAcP proteins, two membrane forms and two soluble forms. SP, Ig, TM, Boxes 1–3 of TIR domains are underlined. Black, dark grey, and light grey shadows represent amino acid identity among four, three, and two proteins, respectively. + Similarity of amino acids.
ciation level of Tollip with mIL-1RAcP687 was about the same as with mIL-1RAcP. IL-1RI did not increase the association between Tollip and either mIL-1RAcP or mIL-1RAcP687 (data not shown). Furthermore, with IL-1RI overexpression, the association of either mIL-1RAcP or mIL-1RAcP687 with Tollip was not induced by IL-1. The association level of Tollip with mIL-1RAcP687 was also about the same as with mIL-1RAcP. These results indicate that similar to mIL-1RAcP, mIL1RAcP687 recruits Tollip in an IL-1RI- and IL-1-independent manner. As shown in Fig. 4C, the association of MyD88 with mIL1RAcP was not detected. However, association was significantly increased by the co-overexpressed IL-1RI and then further stimulated by IL-1. In contrast, MyD88 was able to associate with mIL-1RAcP687 in the absence of IL-1RI overexpression and IL-1 treatment. This association was not significantly stimulated by the co-expressed IL-1RI and additional IL-1 treatment. As shown in Fig. 4D, in similar experiments using
different amounts of IL-1, the association of MyD88 with mIL-1RAcP increased with an increase in IL-1, while association with mIL-1RAcP687 did not change. Furthermore, either mIL-1RAcP or mIL-1RAcP687 was associated with IL-1RI in an IL-1-dependent manner, which is the same as the condition without MyD88 overexpression (Fig. 4A). These results indicate that the recruitment of MyD88 to mIL-1RAcP is IL-1RI- and IL-1-dependent, while recruiting MyD88 to mIL-1RAcP687 is IL-1RI- and IL-1-independent. 3.5. Increase of NF-κB DNA binding by mIL-1RAcP687 NF-B activation in HEK293T cells overexpressing either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 was assessed by electrophoretic mobility shift assay. As shown in Fig. 5A, the NF-B DNA binding activity was increased by overexpression of IL-1RI, FLAG-mIL-1RAcP, or FLAG-mIL-1RAcP687, and then further stimulated by IL-1 treatment. It was further
1380
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
Fig. 4. Association of mIL-1RAcP687 with IL-1RI and recruitment of IL-1 signaling cascade components. (A) Association of mIL-1RAcP687 with IL-1RI. HEK293T cells were co-transfected with IL-1RI and either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 for 14 h. Cells were then incubated in complete medium for 34 h, changed to serum-starved medium for 1 h, and left untreated or treated with indicated amount of IL-1 in ng/ml for 5 min. (B) Recruitment of Tollip. HEK293T cells co-transfected with either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 and Myc-Tollip with (lanes 7–12) or without IL-1RI (lanes 1–6) were stimulated with 100 ng/ml of IL-1 for 10 min. (C and D) Recruitment of MyD88. HEK293T cells co-transfected with either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 and Myc-MyD88 with or without IL-1RI were stimulated with 100 ng/ml of IL-1 in (C) or indicated amount of IL-1 in ng/ml in (D) for 10 min or left untreated.
increased by co-overexpression of IL-1RI with either FLAGmIL-1RAcP or FLAG-mIL-1RAcP687. As shown in Fig. 5B, the increase in NF-B DNA binding activity correlated well with the increase in the amount of either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 expression. These results demonstrate that similar to mIL-1RAcP, mIL-1RAcP687 overexpression induces NF-B activation in an IL-1RI- and IL-1-dependent manner. 3.6. Expression of IL-1 responsive genes induced by IL-1 The expression of tumor necrosis factor-␣ (TNF-␣) and granulocyte macrophage-colony stimulating factor (GM-CSF) can be induced by IL-1. Levels of TNF-␣ and GM-CSF proteins secreted by human hepatoma HA22T/VGH cells overexpressing IL-1RI, FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 alone or in combination with or without IL-1 treatment were measured by ELISA. As shown in Fig. 6, overexpression of IL-1RI, FLAGmIL-1RAcP or FLAG-mIL-1RAcP687 increased the level of the secreted TNF-␣ and GM-CSF, respectively. The level of the secreted TNF-␣ or GM-CSF was further stimulated by IL1. When either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 was overexpressed with IL-1RI, the level of the secreted TNF␣ or GM-CSF was further increased compared to IL-1RI alone. These results demonstrate that similar to mIL-1RAcP, mIL-1RAcP687 overexpression stimulates the expression of
TNF-␣ and GM-CSF in an IL-1RI- and IL-1-dependent manner. 4. Discussion We have now identified a new alternatively spliced product of human IL-1RAcP gene, the membrane form mIL-1RAcP687. The N-terminal 448 amino acid region of mIL-1RAcP687, which is identical to that of mIL-1RAcP, contains three extracellular Ig domains, one transmembrane domain, and Box 1 and Box 2 except the last amino acid of TIR domain. However, mIL-1RAcP687 contains a unique 239 amino acid intracellular domain including Box 3 of TIR domain. Despite their difference in the intracellular domain, both mIL-1RAcP and mIL-1RAcP687 interact with proteins involved in the upstream IL-1 signaling pathway such as IL-1RI, Tollip, and MyD88, transduce IL-1 signal to activate transcription factor NF-B, and induce the expression of IL-1-responsive genes such as TNF-␣ and GM-CSF. In contrast, sIL-1RAcP and possibly sIL-1RAcP inhibit IL-1 response (Huang et al., 1997; Jensen et al., 2000; Jensen and Whitehead, 2003; Smith et al., 2003). Although both mIL-1RAcP and sIL-1RAcP mRNAs are widely expressed in human tissues, their relative proportion, when responding to IL1, stress, and/or acute-phase induction, differs significantly in a tissue-specific manner (Jensen and Whitehead, 2004). It will be interesting to know the proportion of these four IL-1RAcP
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
1381
Fig. 5. Induction of NF-B activation by mIL-1RAcP687 overexpression. (A) HEK293T cells were transfected with either FLAG-mIL-1RAcP or FLAG-mIL1RAcP687 with or without IL-1RI for 12 h. Cells were then incubated in serum-starved medium for 1 h, and stimulated with 10 ng/ml of IL-1 for 40 min or left untreated. (B) HEK293T cells were co-transfected with IL-1RI and increasing amounts of either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 for 12 h. Cells were harvested and divided into two parts. One part was used to prepare nuclear extracts for EMSA using NF-B binding site as probe (top panel), while another part was used to prepare whole cell extracts for Western blot using anti-FLAG (middle panel) and anti-IL-1RI (bottom panel) antibody, respectively.
splice variants in different physiological conditions. Proportional expression of these four IL-1RAcP splice variants may play an important role in determining response. mIL-1RAcP, which increases avidity of IL-1 to IL-1RI by about five-fold, is essential in the formation of an active complex to trigger signaling (Cullinan et al., 1998; Huang et al., 1997; Wesche et al., 1997b). We show that mIL-1RAcP associates with IL-1RI and this association is further stimulated by IL-1, which are consistent with previous findings (Huang et al., 1997). IL-1 binds IL-1RI through Ig-like domains 1 and 2 of IL1RI. This cooperative binding causes a conformational change to make Ig-like domain 3 of IL-1RI wrap around the IL-1, which
allows interaction between IL-1RI and mIL-1RAcP (Vigers et al., 1997). Casadio et al. (2001) have suggested a model in which mIL-1RAcP wraps around the IL-1/IL-1RI complex such that mIL-1RAcP predominantly interacts with IL-1RI. The extracellular domain of mIL-1RAcP is sufficient to interact with IL-1RI (Huang et al., 1997; Jensen et al., 2000). mIL-1RAcP was further shown to interact with IL-1RI (bound to IL-1) through its second and/or third Ig domain (Neumann et al., 2000). We show here that similar to mIL-1RAcP, mIL-1RAcP687 is able to associate with IL-1RI and this association is IL-1-dependent. Since their sequence before amino acid 449 including extracellular domain is identical, our results lend further support to the notion
1382
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
Fig. 6. Production of TNF-␣ and GM-CSF by mIL-1RAcP687 overexpression. Levels of TNF-␣ (top panel) and GM-CSF (bottom panel) in culture media after transfection of HA22T/VGH cells with IL-1RI (RI), mIL-1RAcP (RAcP), or mIL-1RAcP687 (RAcP687) alone or in combination for 36 h followed by treatment of IL-1 (10 ng/ml) for 16 h were measured with ELISA. Results presented are means ± S.D. and represent the average of three independent experiments performed in triplicate wells (P < 0.001 in both TNF-␣ and GM-CSF).
that the extracellular domain of membrane IL-1RAcP proteins is sufficient to interact with IL-1RI. With regard to the recruitment of Tollip to membrane IL1RAcP proteins, we show that mIL-1RAcP recruits Tollip, and this recruitment is not further stimulated by IL-1. These results are consistent with previous findings (Burns et al., 2000). As for the essential sequence for recruitment of Tollip to mIL-1RAcP, it has been shown that a mIL-1RAcP mutant, lacking the Cterminal amino acid 533–570 region including Box 3 of TIR domain, is able to recruit Tollip (Burns et al., 2000). The eight amino acid-long stretch from amino acid 527–534, which corresponds to loop EE and is close to the conserved Box 3, is not required for Tollip recruitment (Radons et al., 2003). These previous results suggest that the sequence after amino acid 526 is not essential. Our results show that mIL-1RAcP687 recruits Tollip to a level similar to mIL-1RAcP. Furthermore, mIL-1RAcP687 recruits Tollip in an IL-1-independent manner, which is also similar to mIL-1RAcP. Although the sequence after amino acid 448 is different between mIL-1RAcP687 and mIL-1RAcP, our results cannot exclude the important role of the sequence after amino acid 449 or of the TIR domain in the recruitment of Tollip to membrane IL-1RAcP proteins. Even though mIL-1RAcP687 and mIL-1RAcP have different sequence after amino acid 448, the amino acid 449–567 sequence of mIL-1RAcP687 still has 33% identity and 57% similarity to the amino acid 449–570 sequence of mIL-1RAcP. As for the three conserved boxes of TIR domain, both proteins have identical Box 1 sequence. The most conserved sequence in Box 2 (GYKLCI–RD–PGGI) is GYKLCI–RD–PG (Burns et al., 1998; Wesche et al., 1997a). It is quite possible that the change of last amino acid of Box 2 from isoleucine in mIL-1RAcP to asparagine in mIL-1RAcP687 does
not affect the function of TIR domain. Similarly, the most conserved sequence in Box 3 (FWKK) is FW (Burns et al., 1998; Wesche et al., 1997a). The change of last amino acid from glutamine in mIL-1RAcP to alanine in mIL-1RAcP687 may not influence the TIR domain function either. We show that mIL-1RAcP does not recruit MyD88, but the recruitment is significantly increased by the co-expressed IL-1RI and further stimulated by IL-1. These results are consistent with previous reports (Burns et al., 1998; Wesche et al., 1997a). In contrast, we show that mIL-1RAcP687 recruits MyD88 without the overexpressed IL-1RI and IL-1 treatment. This recruitment is not significantly stimulated by the co-expressed IL-1RI and further IL-1 treatment. Previously, it has been shown that although mIL-1RAcP mutant lacking the C-terminal 37 amino acid region including Box 3 of TIR domain is able to recruit Tollip, it is defective in MyD88 recruitment (Burns et al., 2000). Moreover, amino acids from 527 to 534 are not essential for Tollip association, but critical for recruitment of MyD88 (Radons et al., 2003). These previous results suggest that the sequence after amino acid 526 is important for MyD88 recruitment. The sequence after amino acid 448 is different between these two membrane forms of IL-1RAcP. Our results suggest that their difference in sequence after amino acid 448 apparently contributes to their difference in the MyD88 recruitment. As discussed above, the TIR domain of mIL-1RAcP687 may have the same function as the TIR domain of mIL-1RAcP. Sequence other than TIR domain may play a role in regulating the recruitment of MyD88 to membrane forms of IL-1RAcP proteins. In consistence with previous reports (Huang et al., 1997; Wesche et al., 1997a), we show that expression of mIL-1RAcP increases the NF-B DNA binding activity, which is further increased by co-expression of IL-1RI. We have also shown that the NF-B DNA binding activity is increased in an IL1-dependent manner. Similar to mIL-1RAcP, overexpression of mIL-1RAcP687 induces NF-B activation in an IL-1RIand IL-1-dependent manner. Overexpression of either mIL1RAcP or mIL-1RAcP687 also increases the expression of IL-1responsive genes such as TNF-␣ and GM-CSF in an IL-1RIand IL-1-dependent manner. These results indicate that despite that the sequence after amino acid 448 is different between mIL-1RAcP687 and mIL-1RAcP, and their IL-1 and IL-1RI dependence of MyD88 recruitment is different, their final IL-1 response is very similar. The pleiotropic cytokine IL-1, which is produced in response to inflammatory stimuli, regulates development and maintenance of the inflammatory reaction (Fitzgerald et al., 2001). Prolonged IL-1 production and release as well as biological effects of IL-1 may lead to a high risk of pathological derangements. In addition to its production and availability at the site of inflammation, the IL-1 biological response through receptormediated signal transduction of target cells needs to be tightly regulated. Usage of different genes is one of the mechanisms to regulate the IL-1 signaling cascade. For example, IL-1RI, with mIL-1RAcP, initiates IL-1 signal transduction and leads to cell activation. On the other hand, IL-1RII, which has a very short intracellular domain lacking the TIR domain, serves as
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
a negative regulator of IL-1 signaling by binding IL-1 as an IL-1 sink, preventing downstream signaling as a decoy receptor, and producing soluble IL-1RII (Neumann et al., 2000). Another example is IL-1 itself. Ten individual members of the IL-1 gene superfamily have been identified to date. Among them, IL-18 (IL-1F4) is the receptor agonist for IL-1␣ (IL-1F1) and IL-1 (IL-1F2), whereas IL-1 receptor antagonist (IL-1Ra, IL-1F3) is the receptor antagonist (Dinarello, 2002). IL-1F6, IL-1F8, and IL-1F9 activate the pathway leading to NF-B activation through IL-1 receptor-related protein (IL-1Rrp2) and mIL-1RAcP (Towne et al., 2004). In addition to using different genes, alternative splicing is another mechanism. MyD88s, which is a splice variant of MyD88 (lacking ID), acts as a dominant-negative inhibitor of IL-1-induced NF-B activation via its inability to induce phosphorylation of IRAK-1 (Janssens et al., 2002). IRAK1b, a splice variant of IRAK1, lacks kinase activity and exhibits a prolonged half-life, allowing NF-B activation to be maintained at a more modest and sustainable level (Jensen and Whitehead, 2001). Another splice variant of IRAK1, IRAK1c, functions as a dominant-negative inhibitor because it lacks kinase activity and cannot be phosphorylated by IRAK4, thus remaining associated with Tollip (Rao et al., 2005). As described in this study, four alternatively spliced products are generated from IL-1RAcP gene. The two membrane and two soluble isoforms have opposite roles, supporting and suppressing IL-1 signaling (Huang et al., 1997; Jensen et al., 2000; Jensen and Whitehead, 2003; Smith et al., 2003). Thereby, identification of mIL-1 RAcP687 adds further complexity to the variety of mechanisms that regulate IL-1 signaling and the subsequent inflammatory response. Acknowledgements We are grateful to Suh-Der Tsen (Institute of Microbiology & Immunology, National Yang-Ming University, Taipei, ROC) for critical reading of the manuscript. We greatly appreciate the outstanding technical service of Sequencing Center of VGH National Yang-Ming University Genome Research Center for sequencing human BAC clone RPCI-11-487B5.TJ. This work was supported by Research Grants from the National Science Council, ROC. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molimm.2007.09.002. References Burns, K., Clatworthy, J., Martin, L., Martinon, F., Plumpton, C., Maschera, B., Lewis, A., Ray, K., Tschopp, J., Volpe, F., 2000. Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell Biol. 2, 346–351. Burns, K., Martinon, F., Esslinger, C., Pahl, H., Schneider, P., Bodmer, J.L., Di Marco, F., French, L., Tschopp, J., 1998. MyD88, an adapter protein involved in interleukin-1 signaling. J. Biol. Chem. 273, 12203–12209. Casadio, R., Frigimelica, E., Bossu, P., Neumann, D., Martin, M.U., Tagliabue, A., Boraschi, D., 2001. Model of interaction of the IL-1 receptor accessory
1383
protein IL-1RAcP with the IL-1beta/IL-1R(I) complex. FEBS Lett. 499, 65–68. Cullinan, E.B., Kwee, L., Nunes, P., Shuster, D.J., Ju, G., McIntyre, K.W., Chizzonite, R.A., Labow, M.A., 1998. IL-1 receptor accessory protein is an essential component of the IL-1 receptor. J. Immunol. 161, 5614–5620. Dinarello, C.A., 1996. Biologic basis for interleukin-1 in disease. Blood 87, 2095–2147. Dinarello, C.A., 2002. The IL-1 family and inflammatory diseases. Clin. Exp. Rheumatol. 20, S1–S13. Dunne, A., O’Neill, L.A., 2003. The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci. STKE 2003, re3. Fitzgerald, K.A., Palsson-McDermott, E.M., Bowie, A.G., Jefferies, C.A., Mansell, A.S., Brady, G., Brint, E., Dunne, A., Gray, P., Harte, M.T., McMurray, D., Smith, D.E., Sims, J.E., Bird, T.A., O’Neill, L.A., 2001. Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction. Nature 413, 78–83. Greenfeder, S.A., Nunes, P., Kwee, L., Labow, M., Chizzonite, R.A., Ju, G., 1995. Molecular cloning and characterization of a second subunit of the interleukin 1 receptor complex. J. Biol. Chem. 270, 13757–13765. Huang, J., Gao, X., Li, S., Cao, Z., 1997. Recruitment of IRAK to the interleukin 1 receptor complex requires interleukin 1 receptor accessory protein. Proc. Natl. Acad. Sci. U.S.A. 94, 12829–12832. Huang, Y.S., Misior, A., Li, L.W., 2005. Novel role and regulation of the interleukin-1 receptor associated kinase (IRAK) family proteins. Cell Mol. Immunol. 2, 36–39. Janssens, S., Beyaert, R., 2003. Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members. Mol. Cell 11, 293–302. Janssens, S., Burns, K., Tschopp, J., Beyaert, R., 2002. Regulation of interleukin1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88. Curr. Biol. 12, 467–471. Jensen, L.E., Muzio, M., Mantovani, A., Whitehead, A.S., 2000. IL-1 signaling cascade in liver cells and the involvement of a soluble form of the IL-1 receptor accessory protein. J. Immunol. 164, 5277–5286. Jensen, L.E., Whitehead, A.S., 2001. IRAK1b, a novel alternative splice variant of interleukin-1 receptor-associated kinase (IRAK), mediates interleukin-1 signaling and has prolonged stability. J. Biol. Chem. 276, 29037–29044. Jensen, L.E., Whitehead, A.S., 2003. Expression of alternatively spliced interleukin-1 receptor accessory protein mRNAs is differentially regulated during inflammation and apoptosis. Cell Signal. 15, 793–802. Jensen, L.E., Whitehead, A.S., 2004. The 3 untranslated region of the membrane-bound IL-1R accessory protein mRNA confers tissue-specific destabilization. J. Immunol. 173, 6248–6258. Li, X., Qin, J., 2005. Modulation of Toll-interleukin 1 receptor mediated signaling. J. Mol. Med. 83, 258–266. Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., Janeway Jr., C.A., 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 2, 253–258. Neumann, D., Kollewe, C., Martin, M.U., Boraschi, D., 2000. The membrane form of the type II IL-1 receptor accounts for inhibitory function. J. Immunol. 165, 3350–3357. Radons, J., Dove, S., Neumann, D., Altmann, R., Botzki, A., Martin, M.U., Falk, W., 2003. The interleukin 1 (IL-1) receptor accessory protein Toll/IL1 receptor domain: analysis of putative interaction sites in vitro mutagenesis and molecular modeling. J. Biol. Chem. 278, 49145–49153. Rao, N., Nguyen, S., Ngo, K., Fung-Leung, W.P., 2005. A novel splice variant of interleukin-1 receptor (IL-1R)-associated kinase 1 plays a negative regulatory role in Toll/IL-1R-induced inflammatory signaling. Mol. Cell. Biol. 25, 6521–6532. Smith, D.E., Hanna, R., Della, F., Moore, H., Chen, H., Farese, A.M., MacVittie, T.J., Virca, G.D., Sims, J.E., 2003. The soluble form of IL-1 receptor accessory protein enhances the ability of soluble type II IL-1 receptor to inhibit IL-1 action. Immunity 18, 87–96. Subramaniam, S., Stansberg, C., Cunningham, C., 2004. The interleukin 1 receptor family. Dev. Comp. Immunol. 28, 415–428. Towne, J.E., Garka, K.E., Renshaw, B.R., Virca, G.D., Sims, J.E., 2004. Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP
1384
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
to activate the pathway leading to NF-kappaB and MAPKs. J. Biol. Chem. 279, 13677–13688. Vigers, G.P., Anderson, L.J., Caffes, P., Brandhuber, B.J., 1997. Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta. Nature 386, 190–194. Wesche, H., Henzel, W.J., Shillinglaw, W., Li, S., Cao, Z., 1997a. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7, 837–847.
Wesche, H., Korherr, C., Kracht, M., Falk, W., Resch, K., Martin, M.U., 1997b. The interleukin-1 receptor accessory protein (IL-1RAcP) is essential for IL-1-induced activation of interleukin-1 receptor-associated kinase (IRAK) and stress-activated protein kinases (SAP kinases). J. Biol. Chem. 272, 7727–7731. Yang, C.Y., Kuo, T.H., Ting, L.P., 2006. Human hepatitis B viral e antigen interacts with cellular interleukin-1 receptor accessory protein and triggers interleukin-1 response. J. Biol. Chem. 281, 34525–34536.
Molecular Immunology 45 (2008) 1374–1384
A novel alternatively spliced interleukin-1 receptor accessory protein mIL-1RAcP687 Hsin-Lin Lu 1 , Chih-Yung Yang 1 , Hui-Chun Chen, Chia-Sui Hung, Yu-Chi Chiang, Ling-Pai Ting ∗ Institute of Microbiology and Immunology, School of Life Sciences, National Yang-Ming University, Pei-Tou, Taipei 11221, Taiwan, ROC Received 24 August 2007; received in revised form 3 September 2007; accepted 6 September 2007 Available online 18 October 2007
Abstract The 570-amino acid membrane form of IL-1RAcP (mIL-1RAcP) plays a pivotal role in the IL-1 signal transduction and response. We have identified another membrane form of IL-1RAcP with 687 amino acids (named as mIL-1RAcP687 hereon). Its except the last amino acid N-terminal 448 amino acid portion, containing three extracellular immunoglobulin domains, one transmembrane domain, and Box 1 and Box 2 of Toll/IL1 Receptor (TIR) domain, is identical to that of mIL-1RAcP. In contrast, the C-terminal 239 amino acid portion of mIL-1RAcP687, containing Box 3 of TIR domain, is unique. The mIL-1RAcP687 splice variant is derived from the first 11 exons except 9b, and a newly identified exon 13 of IL-1RAcP gene, while mIL-1RAcP is derived from the first 12 exons except 9b. Furthermore, mIL-1RAcP687 can associate with proteins involved in the upstream IL-1 signaling pathway such as IL-1RI, Tollip, and MyD88. It thus activates downstream signaling events to activate transcription factor NF-B, and induce the expression of IL-1 responsive genes such as TNF-␣ and GM-CSF. These results demonstrate that like mIL-1RAcP, mIL-1RAcP687 functions in the IL-1 signal transduction and response. Identification of mIL-1RAcP687 adds further complexity to the regulation of IL-1 signaling and its subsequent response. © 2007 Elsevier Ltd. All rights reserved. Keywords: IL-1 receptor accessory protein; Interleukin-1; IL-1 receptor; IL-1 signal transduction; MyD88; Tollip
1. Introduction The proinflammatory cytokine interleukin-1 (IL-1) initiates a wide variety of inflammatory and immunological responses to infection, stress, and tissue damage (Dinarello, 1996). IL-1 response is initiated by binding of IL-1 to type I IL-1 receptor (IL-1RI). A second protein, the membrane form of IL-1 receptor accessory protein (mIL-1RAcP), is recruited to the IL-1/IL-1RI complex. It is an essential component of the IL1RI receptor complex for signaling (Cullinan et al., 1998; Greenfeder et al., 1995; Huang et al., 1997; Wesche et al., 1997b). This trimeric IL-1/IL-1RI/IL-1RAcP complex recruits several adaptor proteins and kinases, including myeloid differentiation factor 88 (MyD88), Toll-interacting protein (Tollip), and members of the IL-1RI-associated kinase family (Burns
∗ 1
Corresponding author. Tel.: +886 2 28267106; fax: +886 2 28212880. E-mail address: [email protected] (L.-P. Ting). Both the authors made equal contributions to this work.
0161-5890/$ – see front matter © 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2007.09.002
et al., 1998; Huang et al., 2005; Janssens and Beyaert, 2003; Medzhitov et al., 1998; Wesche et al., 1997a). Signal events trigger the activation of IB kinase (IKK) complex and specific mitogen-activated protein kinase kinases (MKKs). The former phosphorylates the nuclear factor B inhibitor (IB) and leads to the activation of nuclear factor B (NF-B), which translocates into nucleus and regulates the expression of IL-1 response genes. The latter phosphorylates and activates members of the c-Jun N-terminal kinase (JNK)/p38 mitogenactivated protein kinase (MAPK) family, which translocates into nucleus and phosphorylates several transcription factors of the basic leucine zipper family, like c-Jun and c-Fos (Dunne and O’Neill, 2003; Li and Qin, 2005; Subramaniam et al., 2004). The human IL-1RAcP gene located on chromosome 3q28 has been reported to contain 12 exons spanning more than 137 kb (Jensen et al., 2000). Three alternatively spliced IL-1RAcP mRNAs have previously been identified (Huang et al., 1997; Jensen et al., 2000; Jensen and Whitehead, 2003). The splice variant derived from 12 exons except 9b encodes the 570 amino
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
acid membrane form of IL-1RAcP (named as mIL-1RAcP), comprising the three extracellular Ig domains, the transmembrane domain, and intracellular domain including TIR domain. TIR domain possesses three conserved regions (Boxes 1–3) that contain crucial amino acids for signaling. mIL-1RAcP forms a complex with IL-1/IL-1RI to initiate the signal transduction of IL-1 (Huang et al., 1997). The splice variant derived from the first nine exons encodes the 356 amino acid-long soluble form of IL-1RAcP, sIL-1RAcP. It lacks the transmembrane and intracellular domain. The sIL-1RAcP, which is produced in response to stress and/or acute-phase induction and present at high levels in human serum, has been suggested to act as an inhibitor of IL-1 signaling, possibly via competitive inhibition of the interaction between mIL-1RAcP and IL-1/IL-1RI complex (Jensen et al., 2000). Furthermore, it increases the affinity of binding of human IL-1␣ and IL-1 to the soluble human type II IL-1 receptor (IL-1RII) by approximately 100-fold and thereby enhances the ability of IL-1RII to inhibit IL-1 signaling (Smith et al., 2003). The splice variant derived from 12 exons except exon 9 encodes the 346 amino acid-long soluble form of IL-1RAcP, sIL-1RAcP, which has a unique second half of the third Ig domain. The sIL-1RAcP, which is exclusively expressed in staurosporine-treated cells, may have similar functions as sIL-1RAcP (Jensen and Whitehead, 2003). We have identified another membrane form of IL-1RAcP with 687 amino acids (named as mIL-1RAcP687 hereafter). Its N-terminal 448 amino acid-long portion is identical to that of mIL-1RAcP. In contrast, the C-terminal 239 amino acidlong portion of IL-1RAcP687 is unique. The mIL-1RAcP687 is encoded by the first 11 exons except 9b, and a previously unidentified exon 13 of IL-1RAcP gene. Furthermore, mIL1RAcP687, like mIL-1RAcP, interacts with the upstream IL-1 signaling molecules such as IL-1RI, Tollip, and MyD88. It transduces signal to activate transcription factor NF-B, and induce the expression of IL-1 responsive genes TNF-␣ and GM-CSF.
1375
vector to generate pFLAG-mIL-1RAcP687. The full-length IL1RI was inserted downstream of a CMV promoter in a pCMV vector to generate pIL-1RI. pFLAG-mIL-1RAcP was previously described (Yang et al., 2006). 2.3. Reverse transcriptase-PCR and nested PCR The Ready-to-GoTM kit was used for RT-PCR according to the manufacturer’s recommendation. RT-PCR reactions containing total cellular RNA of human hepatoma HuH7 cells and primers were done in a single-tube format and a 50 l reaction volume. For mIL-1RAcP, exon 12 reverse primer (rpr12, GAGCTCGAGCACCCCTTGTTCTTT, underlined nts indicate nts 1958 and 1941, respectively) is the primer used for RT reaction; exon 6 primer (pr6-2, nts 895–916, CTGTAAAGGTAGTAGGCTCTCC) and rpr12 are the primers used for PCR reaction; exon 9a primer (pr9a, TAGCGCAGCTATGTCTGTCATGC, underlined nts indicate nts 1186 and 1207, respectively) and rpr12 are the primers used for nest PCR reaction; nest PCR product was 780 bps long. For mIL-1RAcP687, exon 13 primer (rpr13-2, nts 2253–2233, CGTTGTTATTGGATAAGTCCG) is the primer used for RT reaction; exon 1 (pr1, nts 2–19, GCCGGGATCCAGGTCTCC), exon 2 (pr2, nts 119–139, GCATCGTCATGTGATCATCAC), exon 3 (pr3, nts 207–232, ATGACACTTCTGTGGTGTGTAGTCGAG), exon 5 (pr5, nts 571–590, GCAGCAAAGTTGCATTTCCC) primers, and the other exon 6 (pr6-1, nts 797–814, GAGTTTCCTCATTGCCTT) primer are forward primers, respectively, and rpr13-2 was the reverse primer for PCR reaction; pr9a and the other exon 13 primer (rpr13-1, nts 1610–1588, CAGAACAACAATCATCCTTCTGC) are the primers used for nest PCR reaction; nest PCR product is 426 bps long. Nest PCR products were detected by Southern blot using EST06168 as the probe according to the standard procedure. 2.4. Cell culture and transfection
2. Materials and methods 2.1. Clones, vectors, reagents, and antibodies HIBBB70 containing EST06168 in lafmid BA vector was purchased from American Type Culture Collection. Human BAC clone RPCI-11-487B5.TJ containing the IL-1RAcP gene was from Research Genetics. Antibody against Myc was from Roche Applied Science. pCMV-Myc vector was from Stratagene. pCMV vector was constructed from our laboratory. Others are as previously described (Yang et al., 2006). 2.2. Expression vectors For cytoplasmic expression in human embryonic kidney HEK293T cells, the full-length Tollip and MyD88 were fused downstream to a Myc tag in pCMV-Myc vector to generate pMyc-Tollip and pMyc-MyD88, respectively. For membrane expression, the full-length mIL-1RAcP687 without signal peptide was fused downstream to the FLAG tag in a pFLAGCMV1
HEK293T cells as well as human hepatoma HA22T/VGH and HuH-7 cells were cultured and transfected with plasmid DNA as previously described (Yang et al., 2006). 2.5. Immunoprecipitation and Western blot Immunoprecipitation with anti-FLAG M2 beads and Western blot were performed as previously described (Yang et al., 2006). 2.6. Electrophoretic mobility shift assay Nuclear extracts of HEK293T cells were prepared and electrophoretic mobility shift assays were performed as previously described (Yang et al., 2006). 2.7. Enzyme-linked immunosorbent assay HA22T/VGH cells were seeded in 12-well flat-bottom plates and cultured for 1 day. Cells were co-transfected with expression
1376
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
plasmids as indicated for 36 h and then stimulated with 10 ng/ml of IL-1 for 16 h. Levels of TNF-␣ and GM-CSF in the culture media were measured by enzyme-linked immunosorbent assay (ELISA). ELISA was performed by adding 50 l of each sample to a 96-well plate of TNF-␣ and GM-CSF ELISA kits according to the manufacturer’s recommendation. Each experiment was performed in triplicate wells and final results were the average of three independent experiments. 3. Results 3.1. Identification of a novel membrane form of IL-1RAcP An EST clone (GenBank accession no. T08277.1) of human infant brain cDNA library was identified by us to share the sequence homology with previously reported mIL-1RAcP (GenBank NM 002182). We therefore sequenced the entire EST clone. An analysis of this sequence reveals that the 5 end sequence from nts 1 to 590 of EST06168 shows 100% identity to that from nts 962 to 1551, corresponding to the partial sequence of exon 7 and complete sequence of exons 8, 9a, 10, and 11, of mIL-1RAcP. The nts 591–1950 sequence of EST06168 does not match that after nt 1551 (exon 12) of mIL1RAcP, but contains a polyadenylation signal and the poly(A)
tail (Supplementary Fig. 1A). Accordingly, the sequence of Nterminal 196 amino acids of EST06168 shows 100% identity to that of the 253–448 amino acid region of mIL-1RAcP. The sequence of amino acid 197–315 of the former shows 33% identity and 57% similarity to amino acid 449–570 sequence of the latter. In addition, this EST contains extra 120 amino acids in its C terminus (Supplementary Fig. 1B). This analysis suggests that EST06168 may have arisen from an alternatively spliced variant of IL-1RAcP gene. To understand whether EST06168 is indeed a splice variant, the sequence of IL-1RAcP gene was analyzed. Human BAC clone RPCI-11-487B5.TJ containing the IL-1RAcP gene after exon 3 and spanning more than 177 kb was sequenced and analyzed. By comparing the sequence of EST06168 (corresponding to nts 962–2911 of mIL1RAcP687, GenBank EF591790) with the sequence obtained from RPCI-11-487B5.TJ (GenBank EF608598) and that of GenBank AC008249, NT 005612, and NW 921807, the 3 -end sequence of EST06168 matches a previously unidentified exon, exon 13 (Tables 1 and 2, Fig. 1A). The exon 13 sequence of EST06168 is completely identical to the gene sequence except an extra 52 nts from nts 1543 to 1594 of EST06168, which is absent in the gene sequence. The splicing acceptor sequence was identified as atagATAC. A polyadenylation signal is within exon 13. Therefore, the IL-1RAcP gene contains at least thirteen
Table 1 Overview of exons, introns and junctions sequences in the human IL-1 RAcP gene
*Capital alphabets (A, T, C, G) represent sequences in exons, while a, t, c, g are sequences in introns. Underline represents the poly(A) signal. Italics are predicted 5 donor sequences. The size of exon 12 is the size based on the predicted 5 donor sequence of intron 12. The size of 13 is the size before poly(A).
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
1377
Table 2 Generation of four IL-lRAcP mRNAs by alternative splicing Exon
RNA segment/protein domain
mRNA position (bp)
Exons in mIL-lRAcP
Exons in mILlRAcP687
Exons in sIL-lRAcP
Exons in sIL-lRAcP
1 2 3 4 5 6 7 8 9a 9b 10 11 12 13
5 UTR 5 UTR Signal peptide Ig 1 Ig 2A Ig 2B
1–118 119–205 206–270 271–556 557–743 744–909 910–981 982–1108 1109–1257 [1258–2041] 1258–1407, {1109–1258} 1408–1551, {1259–1402} (1552–5462), {1403–5313} 1552–2911
+ + + + + + + + + − + + + −
+ + + + + + + + + − + + − +
+ + + + + + + + + + − − − −
+ + + + + + + + − − + + + −
Ig 3A Ig 3B [Soluble C-terminal + 3 UTR] Transmembrane {Ig 3C} Intracellular {3 UTR} (Intracellular + 3 UTR), {3 UTR} Intracellular + 3 UTR
Exons present or absent in four alternative splicing RNAs of IL-lRAcP gene are indicated with + or −, respectively. Protein and RNA regions in parenthesis, angle bracket, square bracket, and braces are unique for mIL-lRAcP, mIL-1 RAcP687, sIL-1 RAcP, and sIL-lRAcP, respectively.
Fig. 1. Genomic organization of alternatively spliced variants of the human IL-1RAcP gene and its four proteins. (A) Genomic organization of the human IL-1RAcP gene and its four alternative splicing mRNAs. Positions of intron-exon boundaries were identified from the sequence of human BAC clone RPCI-11-487B5.TJ, and that of GenBank accession numbers AC008249, NT 005612, and NW 921807, mIL-1RAcP (GenBank NM 002182), mIL-1RAcP687, sIL-1RAcP (GenBank AF167343), and sIL-1RAcP (GenBank AF538734). The sequence of mIL-1RAcP687 and RPCI-11-487B5.TJ was deposited in GenBank (EF591790 and EF608598, respectively) by us. Exons are depicted as boxes, introns as thin lines, and mRNAs as thick lines. (A)n represents the poly(A) tails. (B) Schematic structure of the membrane and soluble forms of human IL-1RAcP proteins. Both soluble forms, sIL-1RAcP and sIL-1RAcP, contain the extracellular domain but lack the transmembrane and intracellular domains of the membrane forms, mIL-1RAcP and mIL-1RAcP687. SP, signal peptide; Ig, immunoglobulin domain; TM, transmembrane domain; TIR, Toll/IL1 Receptor domain. Solid triangles indicate the alternative splicing sites.
1378
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
Fig. 2. Detection of the entire mIL-1RAcP687 mRNA. Total RNA of human hepatoma HuH-7 cells was used for RT-PCR, followed by nest PCR. For mIL-1RAcP, RT-PCR was performed with the forward primer in exon 6 (pr6-2) and the mIL-1RAcP-specific reverse primer in exon 12 (rpr12). Nest PCR was then performed by using forward primer in exon 9a (pr9a) and rpr12 primer. The product is predicted to be a 780-bp fragment. For mIL-1RAcP687, RT-PCR was performed with five forward primers corresponding to sequences in exon 1, 2, 3, 5, and 6 (pr1, 2, 3, 5, and 6-1), respectively, and the mIL-1RAcP687-specific reverse primer in exon 13 (rpr13-2). Nest PCR was then performed by using pr9a and the other mIL-1RAcP687-specific reverse primer in exon 13 (rpr13-1). The products are predicted to be 426-bp fragments. Experimental details are described as in Section 2. (A) Primers used for RT-PCR and nest PCR are shown on the top. (B) The nest PCR products were detected by Southern blot using EST06168 as the probe.
exons spanning more than 142 kb, and at least four alternatively spliced IL-1RAcP mRNAs are generated.
functional. Furthermore, there is no known structural or functional domain present in the extra C-terminal 120 amino acids of mIL-1RAcP687.
3.2. Identification of mIL-1RAcP687 mRNA If EST06168 represents the partial sequence of a new IL1RAcP alternatively spliced mRNA, which contains the first 11 exons except 9b, and a newly identified exon 13, the encoded protein will be a membrane form IL-1RAcP with 687 amino acids (named mIL-1RAcP687). To demonstrate the presence of this mIL-1RAcP687 mRNA, total RNA of human hepatoma HuH-7 cells was used for RT-PCR. Nest PCR was then performed. The products are predicted to be 426- and 780-bp long fragments for mIL-1RAcP687 and mIL-1RAcP, respectively. The nest RTPCR products were detected by Southern blot analysis using EST06168 as the probe (Fig. 2). The nest RT-PCR products were also cloned and sequenced. Their sequence is consistent with the prediction, demonstrating the presence of mIL-1RAcP687 RNA in HuH-7 cells. Therefore, the mIL-1RAcP687 RNA is composed of the first 11 exons except 9b, and exon 13 (Fig. 1A, Table 2). 3.3. mIL-1RAcP687 as a new membrane IL-1RAcP protein mIL-1RAcP687 comprises three extracellular Ig domains, one transmembrane domain, and a unique intracellular domain (Fig. 3). The Box 1 sequence of TIR domain in mIL-1RAcP687 is identical to that of mIL-1RAcP, while the last amino acids in Box 2 (asparagine instead of isoleucine) and in Box 3 (alanine instead of glutamine) of mIL-1RAcP687, respectively, are different from those of mIL-1RAcP. It has been known that the most conserved sequences in Box 2 GYKLCI–RD–PGGI and Box 3 FWKK are GYKLCI–RD–PG and FW, respectively (Dunne and O’Neill, 2003). Therefore, amino acids 449 and 539 of mIL-1RAcP687 are not in the most conserved position. It is quite possible that the TIR domain of mIL-1RAcP687 is
3.4. Association of mIL-1RAcP687 with IL-1RI and recruitment of IL-1 signaling cascade components To examine whether mIL-1RAcP687 functions to form an IL1/IL-1RI/IL-1RAcP complex, we first tested its association with the upstream component of IL-1 signal transduction pathway. Human embryonic kidney HEK293T cells were co-transfected with IL-1RI as well as either FLAG-mIL-1RAcP or FLAG-mIL1RAcP687 and treated briefly with different amount of IL-1 or left untreated. M2 beads were used to immunoprecipitate FLAGmIL-1RAcP and FLAG-mIL-1RAcP687 proteins in whole cell extracts, and IL-1RI in the M2-immunoprecipitated complex was detected by anti-IL-1RI antibody. As shown in Fig. 4A, IL1RI was detected in the mIL-1RAcP immunocomplex obtained from untreated cells. Association between mIL-1RAcP and IL1RI was likely resulted from spontaneous activation due to overexpression of the two proteins. The amount of coprecipitating IL-1RI was observed to increase with the increasing amount of IL-1. These results are consistent with the previous report (Huang et al., 1997). Weak association of mIL-1RAcP687 with IL-1RI was also detected in the absence of IL-1 induction, and this association was increased with the increasing IL-1 amount. These results indicate that similar to mIL-1RAcP, mIL-1RAcP687 associates with IL-1RI in an IL-1-dependent manner. As shown in Fig. 4B, Myc-Tollip in the M2immunoprecipitated complex was detected using anti-Myc antibody. Tollip was able to associate with mIL-1RAcP as previously reported (Burns et al., 2000; Casadio et al., 2001). Association between Tollip and mIL-1RAcP was not stimulated by IL-1. Like mIL-1RAcP, Tollip associated with mIL-1RAcP687, which was not stimulated by IL-1. The asso-
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
1379
Fig. 3. Sequence alignment of four human IL-1RAcP proteins, two membrane forms and two soluble forms. SP, Ig, TM, Boxes 1–3 of TIR domains are underlined. Black, dark grey, and light grey shadows represent amino acid identity among four, three, and two proteins, respectively. + Similarity of amino acids.
ciation level of Tollip with mIL-1RAcP687 was about the same as with mIL-1RAcP. IL-1RI did not increase the association between Tollip and either mIL-1RAcP or mIL-1RAcP687 (data not shown). Furthermore, with IL-1RI overexpression, the association of either mIL-1RAcP or mIL-1RAcP687 with Tollip was not induced by IL-1. The association level of Tollip with mIL-1RAcP687 was also about the same as with mIL-1RAcP. These results indicate that similar to mIL-1RAcP, mIL1RAcP687 recruits Tollip in an IL-1RI- and IL-1-independent manner. As shown in Fig. 4C, the association of MyD88 with mIL1RAcP was not detected. However, association was significantly increased by the co-overexpressed IL-1RI and then further stimulated by IL-1. In contrast, MyD88 was able to associate with mIL-1RAcP687 in the absence of IL-1RI overexpression and IL-1 treatment. This association was not significantly stimulated by the co-expressed IL-1RI and additional IL-1 treatment. As shown in Fig. 4D, in similar experiments using
different amounts of IL-1, the association of MyD88 with mIL-1RAcP increased with an increase in IL-1, while association with mIL-1RAcP687 did not change. Furthermore, either mIL-1RAcP or mIL-1RAcP687 was associated with IL-1RI in an IL-1-dependent manner, which is the same as the condition without MyD88 overexpression (Fig. 4A). These results indicate that the recruitment of MyD88 to mIL-1RAcP is IL-1RI- and IL-1-dependent, while recruiting MyD88 to mIL-1RAcP687 is IL-1RI- and IL-1-independent. 3.5. Increase of NF-κB DNA binding by mIL-1RAcP687 NF-B activation in HEK293T cells overexpressing either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 was assessed by electrophoretic mobility shift assay. As shown in Fig. 5A, the NF-B DNA binding activity was increased by overexpression of IL-1RI, FLAG-mIL-1RAcP, or FLAG-mIL-1RAcP687, and then further stimulated by IL-1 treatment. It was further
1380
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
Fig. 4. Association of mIL-1RAcP687 with IL-1RI and recruitment of IL-1 signaling cascade components. (A) Association of mIL-1RAcP687 with IL-1RI. HEK293T cells were co-transfected with IL-1RI and either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 for 14 h. Cells were then incubated in complete medium for 34 h, changed to serum-starved medium for 1 h, and left untreated or treated with indicated amount of IL-1 in ng/ml for 5 min. (B) Recruitment of Tollip. HEK293T cells co-transfected with either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 and Myc-Tollip with (lanes 7–12) or without IL-1RI (lanes 1–6) were stimulated with 100 ng/ml of IL-1 for 10 min. (C and D) Recruitment of MyD88. HEK293T cells co-transfected with either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 and Myc-MyD88 with or without IL-1RI were stimulated with 100 ng/ml of IL-1 in (C) or indicated amount of IL-1 in ng/ml in (D) for 10 min or left untreated.
increased by co-overexpression of IL-1RI with either FLAGmIL-1RAcP or FLAG-mIL-1RAcP687. As shown in Fig. 5B, the increase in NF-B DNA binding activity correlated well with the increase in the amount of either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 expression. These results demonstrate that similar to mIL-1RAcP, mIL-1RAcP687 overexpression induces NF-B activation in an IL-1RI- and IL-1-dependent manner. 3.6. Expression of IL-1 responsive genes induced by IL-1 The expression of tumor necrosis factor-␣ (TNF-␣) and granulocyte macrophage-colony stimulating factor (GM-CSF) can be induced by IL-1. Levels of TNF-␣ and GM-CSF proteins secreted by human hepatoma HA22T/VGH cells overexpressing IL-1RI, FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 alone or in combination with or without IL-1 treatment were measured by ELISA. As shown in Fig. 6, overexpression of IL-1RI, FLAGmIL-1RAcP or FLAG-mIL-1RAcP687 increased the level of the secreted TNF-␣ and GM-CSF, respectively. The level of the secreted TNF-␣ or GM-CSF was further stimulated by IL1. When either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 was overexpressed with IL-1RI, the level of the secreted TNF␣ or GM-CSF was further increased compared to IL-1RI alone. These results demonstrate that similar to mIL-1RAcP, mIL-1RAcP687 overexpression stimulates the expression of
TNF-␣ and GM-CSF in an IL-1RI- and IL-1-dependent manner. 4. Discussion We have now identified a new alternatively spliced product of human IL-1RAcP gene, the membrane form mIL-1RAcP687. The N-terminal 448 amino acid region of mIL-1RAcP687, which is identical to that of mIL-1RAcP, contains three extracellular Ig domains, one transmembrane domain, and Box 1 and Box 2 except the last amino acid of TIR domain. However, mIL-1RAcP687 contains a unique 239 amino acid intracellular domain including Box 3 of TIR domain. Despite their difference in the intracellular domain, both mIL-1RAcP and mIL-1RAcP687 interact with proteins involved in the upstream IL-1 signaling pathway such as IL-1RI, Tollip, and MyD88, transduce IL-1 signal to activate transcription factor NF-B, and induce the expression of IL-1-responsive genes such as TNF-␣ and GM-CSF. In contrast, sIL-1RAcP and possibly sIL-1RAcP inhibit IL-1 response (Huang et al., 1997; Jensen et al., 2000; Jensen and Whitehead, 2003; Smith et al., 2003). Although both mIL-1RAcP and sIL-1RAcP mRNAs are widely expressed in human tissues, their relative proportion, when responding to IL1, stress, and/or acute-phase induction, differs significantly in a tissue-specific manner (Jensen and Whitehead, 2004). It will be interesting to know the proportion of these four IL-1RAcP
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
1381
Fig. 5. Induction of NF-B activation by mIL-1RAcP687 overexpression. (A) HEK293T cells were transfected with either FLAG-mIL-1RAcP or FLAG-mIL1RAcP687 with or without IL-1RI for 12 h. Cells were then incubated in serum-starved medium for 1 h, and stimulated with 10 ng/ml of IL-1 for 40 min or left untreated. (B) HEK293T cells were co-transfected with IL-1RI and increasing amounts of either FLAG-mIL-1RAcP or FLAG-mIL-1RAcP687 for 12 h. Cells were harvested and divided into two parts. One part was used to prepare nuclear extracts for EMSA using NF-B binding site as probe (top panel), while another part was used to prepare whole cell extracts for Western blot using anti-FLAG (middle panel) and anti-IL-1RI (bottom panel) antibody, respectively.
splice variants in different physiological conditions. Proportional expression of these four IL-1RAcP splice variants may play an important role in determining response. mIL-1RAcP, which increases avidity of IL-1 to IL-1RI by about five-fold, is essential in the formation of an active complex to trigger signaling (Cullinan et al., 1998; Huang et al., 1997; Wesche et al., 1997b). We show that mIL-1RAcP associates with IL-1RI and this association is further stimulated by IL-1, which are consistent with previous findings (Huang et al., 1997). IL-1 binds IL-1RI through Ig-like domains 1 and 2 of IL1RI. This cooperative binding causes a conformational change to make Ig-like domain 3 of IL-1RI wrap around the IL-1, which
allows interaction between IL-1RI and mIL-1RAcP (Vigers et al., 1997). Casadio et al. (2001) have suggested a model in which mIL-1RAcP wraps around the IL-1/IL-1RI complex such that mIL-1RAcP predominantly interacts with IL-1RI. The extracellular domain of mIL-1RAcP is sufficient to interact with IL-1RI (Huang et al., 1997; Jensen et al., 2000). mIL-1RAcP was further shown to interact with IL-1RI (bound to IL-1) through its second and/or third Ig domain (Neumann et al., 2000). We show here that similar to mIL-1RAcP, mIL-1RAcP687 is able to associate with IL-1RI and this association is IL-1-dependent. Since their sequence before amino acid 449 including extracellular domain is identical, our results lend further support to the notion
1382
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
Fig. 6. Production of TNF-␣ and GM-CSF by mIL-1RAcP687 overexpression. Levels of TNF-␣ (top panel) and GM-CSF (bottom panel) in culture media after transfection of HA22T/VGH cells with IL-1RI (RI), mIL-1RAcP (RAcP), or mIL-1RAcP687 (RAcP687) alone or in combination for 36 h followed by treatment of IL-1 (10 ng/ml) for 16 h were measured with ELISA. Results presented are means ± S.D. and represent the average of three independent experiments performed in triplicate wells (P < 0.001 in both TNF-␣ and GM-CSF).
that the extracellular domain of membrane IL-1RAcP proteins is sufficient to interact with IL-1RI. With regard to the recruitment of Tollip to membrane IL1RAcP proteins, we show that mIL-1RAcP recruits Tollip, and this recruitment is not further stimulated by IL-1. These results are consistent with previous findings (Burns et al., 2000). As for the essential sequence for recruitment of Tollip to mIL-1RAcP, it has been shown that a mIL-1RAcP mutant, lacking the Cterminal amino acid 533–570 region including Box 3 of TIR domain, is able to recruit Tollip (Burns et al., 2000). The eight amino acid-long stretch from amino acid 527–534, which corresponds to loop EE and is close to the conserved Box 3, is not required for Tollip recruitment (Radons et al., 2003). These previous results suggest that the sequence after amino acid 526 is not essential. Our results show that mIL-1RAcP687 recruits Tollip to a level similar to mIL-1RAcP. Furthermore, mIL-1RAcP687 recruits Tollip in an IL-1-independent manner, which is also similar to mIL-1RAcP. Although the sequence after amino acid 448 is different between mIL-1RAcP687 and mIL-1RAcP, our results cannot exclude the important role of the sequence after amino acid 449 or of the TIR domain in the recruitment of Tollip to membrane IL-1RAcP proteins. Even though mIL-1RAcP687 and mIL-1RAcP have different sequence after amino acid 448, the amino acid 449–567 sequence of mIL-1RAcP687 still has 33% identity and 57% similarity to the amino acid 449–570 sequence of mIL-1RAcP. As for the three conserved boxes of TIR domain, both proteins have identical Box 1 sequence. The most conserved sequence in Box 2 (GYKLCI–RD–PGGI) is GYKLCI–RD–PG (Burns et al., 1998; Wesche et al., 1997a). It is quite possible that the change of last amino acid of Box 2 from isoleucine in mIL-1RAcP to asparagine in mIL-1RAcP687 does
not affect the function of TIR domain. Similarly, the most conserved sequence in Box 3 (FWKK) is FW (Burns et al., 1998; Wesche et al., 1997a). The change of last amino acid from glutamine in mIL-1RAcP to alanine in mIL-1RAcP687 may not influence the TIR domain function either. We show that mIL-1RAcP does not recruit MyD88, but the recruitment is significantly increased by the co-expressed IL-1RI and further stimulated by IL-1. These results are consistent with previous reports (Burns et al., 1998; Wesche et al., 1997a). In contrast, we show that mIL-1RAcP687 recruits MyD88 without the overexpressed IL-1RI and IL-1 treatment. This recruitment is not significantly stimulated by the co-expressed IL-1RI and further IL-1 treatment. Previously, it has been shown that although mIL-1RAcP mutant lacking the C-terminal 37 amino acid region including Box 3 of TIR domain is able to recruit Tollip, it is defective in MyD88 recruitment (Burns et al., 2000). Moreover, amino acids from 527 to 534 are not essential for Tollip association, but critical for recruitment of MyD88 (Radons et al., 2003). These previous results suggest that the sequence after amino acid 526 is important for MyD88 recruitment. The sequence after amino acid 448 is different between these two membrane forms of IL-1RAcP. Our results suggest that their difference in sequence after amino acid 448 apparently contributes to their difference in the MyD88 recruitment. As discussed above, the TIR domain of mIL-1RAcP687 may have the same function as the TIR domain of mIL-1RAcP. Sequence other than TIR domain may play a role in regulating the recruitment of MyD88 to membrane forms of IL-1RAcP proteins. In consistence with previous reports (Huang et al., 1997; Wesche et al., 1997a), we show that expression of mIL-1RAcP increases the NF-B DNA binding activity, which is further increased by co-expression of IL-1RI. We have also shown that the NF-B DNA binding activity is increased in an IL1-dependent manner. Similar to mIL-1RAcP, overexpression of mIL-1RAcP687 induces NF-B activation in an IL-1RIand IL-1-dependent manner. Overexpression of either mIL1RAcP or mIL-1RAcP687 also increases the expression of IL-1responsive genes such as TNF-␣ and GM-CSF in an IL-1RIand IL-1-dependent manner. These results indicate that despite that the sequence after amino acid 448 is different between mIL-1RAcP687 and mIL-1RAcP, and their IL-1 and IL-1RI dependence of MyD88 recruitment is different, their final IL-1 response is very similar. The pleiotropic cytokine IL-1, which is produced in response to inflammatory stimuli, regulates development and maintenance of the inflammatory reaction (Fitzgerald et al., 2001). Prolonged IL-1 production and release as well as biological effects of IL-1 may lead to a high risk of pathological derangements. In addition to its production and availability at the site of inflammation, the IL-1 biological response through receptormediated signal transduction of target cells needs to be tightly regulated. Usage of different genes is one of the mechanisms to regulate the IL-1 signaling cascade. For example, IL-1RI, with mIL-1RAcP, initiates IL-1 signal transduction and leads to cell activation. On the other hand, IL-1RII, which has a very short intracellular domain lacking the TIR domain, serves as
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
a negative regulator of IL-1 signaling by binding IL-1 as an IL-1 sink, preventing downstream signaling as a decoy receptor, and producing soluble IL-1RII (Neumann et al., 2000). Another example is IL-1 itself. Ten individual members of the IL-1 gene superfamily have been identified to date. Among them, IL-18 (IL-1F4) is the receptor agonist for IL-1␣ (IL-1F1) and IL-1 (IL-1F2), whereas IL-1 receptor antagonist (IL-1Ra, IL-1F3) is the receptor antagonist (Dinarello, 2002). IL-1F6, IL-1F8, and IL-1F9 activate the pathway leading to NF-B activation through IL-1 receptor-related protein (IL-1Rrp2) and mIL-1RAcP (Towne et al., 2004). In addition to using different genes, alternative splicing is another mechanism. MyD88s, which is a splice variant of MyD88 (lacking ID), acts as a dominant-negative inhibitor of IL-1-induced NF-B activation via its inability to induce phosphorylation of IRAK-1 (Janssens et al., 2002). IRAK1b, a splice variant of IRAK1, lacks kinase activity and exhibits a prolonged half-life, allowing NF-B activation to be maintained at a more modest and sustainable level (Jensen and Whitehead, 2001). Another splice variant of IRAK1, IRAK1c, functions as a dominant-negative inhibitor because it lacks kinase activity and cannot be phosphorylated by IRAK4, thus remaining associated with Tollip (Rao et al., 2005). As described in this study, four alternatively spliced products are generated from IL-1RAcP gene. The two membrane and two soluble isoforms have opposite roles, supporting and suppressing IL-1 signaling (Huang et al., 1997; Jensen et al., 2000; Jensen and Whitehead, 2003; Smith et al., 2003). Thereby, identification of mIL-1 RAcP687 adds further complexity to the variety of mechanisms that regulate IL-1 signaling and the subsequent inflammatory response. Acknowledgements We are grateful to Suh-Der Tsen (Institute of Microbiology & Immunology, National Yang-Ming University, Taipei, ROC) for critical reading of the manuscript. We greatly appreciate the outstanding technical service of Sequencing Center of VGH National Yang-Ming University Genome Research Center for sequencing human BAC clone RPCI-11-487B5.TJ. This work was supported by Research Grants from the National Science Council, ROC. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.molimm.2007.09.002. References Burns, K., Clatworthy, J., Martin, L., Martinon, F., Plumpton, C., Maschera, B., Lewis, A., Ray, K., Tschopp, J., Volpe, F., 2000. Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell Biol. 2, 346–351. Burns, K., Martinon, F., Esslinger, C., Pahl, H., Schneider, P., Bodmer, J.L., Di Marco, F., French, L., Tschopp, J., 1998. MyD88, an adapter protein involved in interleukin-1 signaling. J. Biol. Chem. 273, 12203–12209. Casadio, R., Frigimelica, E., Bossu, P., Neumann, D., Martin, M.U., Tagliabue, A., Boraschi, D., 2001. Model of interaction of the IL-1 receptor accessory
1383
protein IL-1RAcP with the IL-1beta/IL-1R(I) complex. FEBS Lett. 499, 65–68. Cullinan, E.B., Kwee, L., Nunes, P., Shuster, D.J., Ju, G., McIntyre, K.W., Chizzonite, R.A., Labow, M.A., 1998. IL-1 receptor accessory protein is an essential component of the IL-1 receptor. J. Immunol. 161, 5614–5620. Dinarello, C.A., 1996. Biologic basis for interleukin-1 in disease. Blood 87, 2095–2147. Dinarello, C.A., 2002. The IL-1 family and inflammatory diseases. Clin. Exp. Rheumatol. 20, S1–S13. Dunne, A., O’Neill, L.A., 2003. The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci. STKE 2003, re3. Fitzgerald, K.A., Palsson-McDermott, E.M., Bowie, A.G., Jefferies, C.A., Mansell, A.S., Brady, G., Brint, E., Dunne, A., Gray, P., Harte, M.T., McMurray, D., Smith, D.E., Sims, J.E., Bird, T.A., O’Neill, L.A., 2001. Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction. Nature 413, 78–83. Greenfeder, S.A., Nunes, P., Kwee, L., Labow, M., Chizzonite, R.A., Ju, G., 1995. Molecular cloning and characterization of a second subunit of the interleukin 1 receptor complex. J. Biol. Chem. 270, 13757–13765. Huang, J., Gao, X., Li, S., Cao, Z., 1997. Recruitment of IRAK to the interleukin 1 receptor complex requires interleukin 1 receptor accessory protein. Proc. Natl. Acad. Sci. U.S.A. 94, 12829–12832. Huang, Y.S., Misior, A., Li, L.W., 2005. Novel role and regulation of the interleukin-1 receptor associated kinase (IRAK) family proteins. Cell Mol. Immunol. 2, 36–39. Janssens, S., Beyaert, R., 2003. Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members. Mol. Cell 11, 293–302. Janssens, S., Burns, K., Tschopp, J., Beyaert, R., 2002. Regulation of interleukin1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88. Curr. Biol. 12, 467–471. Jensen, L.E., Muzio, M., Mantovani, A., Whitehead, A.S., 2000. IL-1 signaling cascade in liver cells and the involvement of a soluble form of the IL-1 receptor accessory protein. J. Immunol. 164, 5277–5286. Jensen, L.E., Whitehead, A.S., 2001. IRAK1b, a novel alternative splice variant of interleukin-1 receptor-associated kinase (IRAK), mediates interleukin-1 signaling and has prolonged stability. J. Biol. Chem. 276, 29037–29044. Jensen, L.E., Whitehead, A.S., 2003. Expression of alternatively spliced interleukin-1 receptor accessory protein mRNAs is differentially regulated during inflammation and apoptosis. Cell Signal. 15, 793–802. Jensen, L.E., Whitehead, A.S., 2004. The 3 untranslated region of the membrane-bound IL-1R accessory protein mRNA confers tissue-specific destabilization. J. Immunol. 173, 6248–6258. Li, X., Qin, J., 2005. Modulation of Toll-interleukin 1 receptor mediated signaling. J. Mol. Med. 83, 258–266. Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., Janeway Jr., C.A., 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 2, 253–258. Neumann, D., Kollewe, C., Martin, M.U., Boraschi, D., 2000. The membrane form of the type II IL-1 receptor accounts for inhibitory function. J. Immunol. 165, 3350–3357. Radons, J., Dove, S., Neumann, D., Altmann, R., Botzki, A., Martin, M.U., Falk, W., 2003. The interleukin 1 (IL-1) receptor accessory protein Toll/IL1 receptor domain: analysis of putative interaction sites in vitro mutagenesis and molecular modeling. J. Biol. Chem. 278, 49145–49153. Rao, N., Nguyen, S., Ngo, K., Fung-Leung, W.P., 2005. A novel splice variant of interleukin-1 receptor (IL-1R)-associated kinase 1 plays a negative regulatory role in Toll/IL-1R-induced inflammatory signaling. Mol. Cell. Biol. 25, 6521–6532. Smith, D.E., Hanna, R., Della, F., Moore, H., Chen, H., Farese, A.M., MacVittie, T.J., Virca, G.D., Sims, J.E., 2003. The soluble form of IL-1 receptor accessory protein enhances the ability of soluble type II IL-1 receptor to inhibit IL-1 action. Immunity 18, 87–96. Subramaniam, S., Stansberg, C., Cunningham, C., 2004. The interleukin 1 receptor family. Dev. Comp. Immunol. 28, 415–428. Towne, J.E., Garka, K.E., Renshaw, B.R., Virca, G.D., Sims, J.E., 2004. Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP
1384
H.-L. Lu et al. / Molecular Immunology 45 (2008) 1374–1384
to activate the pathway leading to NF-kappaB and MAPKs. J. Biol. Chem. 279, 13677–13688. Vigers, G.P., Anderson, L.J., Caffes, P., Brandhuber, B.J., 1997. Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta. Nature 386, 190–194. Wesche, H., Henzel, W.J., Shillinglaw, W., Li, S., Cao, Z., 1997a. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7, 837–847.
Wesche, H., Korherr, C., Kracht, M., Falk, W., Resch, K., Martin, M.U., 1997b. The interleukin-1 receptor accessory protein (IL-1RAcP) is essential for IL-1-induced activation of interleukin-1 receptor-associated kinase (IRAK) and stress-activated protein kinases (SAP kinases). J. Biol. Chem. 272, 7727–7731. Yang, C.Y., Kuo, T.H., Ting, L.P., 2006. Human hepatitis B viral e antigen interacts with cellular interleukin-1 receptor accessory protein and triggers interleukin-1 response. J. Biol. Chem. 281, 34525–34536.