A novel bivalent fusion vaccine induces broad immunoprotection against Staphylococcus aureus infection in different murine models

Accepted Manuscript A novel bivalent fusion vaccine induces broad immunoprotection against Staphylococcus aureus infection in different murine models

Liuyang Yang, Heng Zhou, Ping Cheng, Yun Yang, Yanan Tong, Qianfei Zuo, Jiao Luo, Qiang Feng, Quanming Zou, Hao Zeng PII: DOI: Reference:

S1521-6616(17)30757-X doi:10.1016/j.clim.2017.12.012 YCLIM 7989

To appear in:

Clinical Immunology

Received date: Revised date: Accepted date:

16 October 2017 16 December 2017 27 December 2017

Please cite this article as: Liuyang Yang, Heng Zhou, Ping Cheng, Yun Yang, Yanan Tong, Qianfei Zuo, Jiao Luo, Qiang Feng, Quanming Zou, Hao Zeng , A novel bivalent fusion vaccine induces broad immunoprotection against Staphylococcus aureus infection in different murine models. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Yclim(2017), doi:10.1016/ j.clim.2017.12.012

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT A novel bivalent fusion vaccine induces broad immunoprotection against Staphylococcus aureus infection in different murine models 1

1

1

1

1

1

1

Liuyang Yang , Heng Zhou , Ping Cheng , Yun Yang , Yanan Tong , Qianfei Zuo , Jiao Luo , Qiang Feng2 , Quanming Zou1* , Hao Zeng1* 1

National Engineering Research Center of Immunological Products & Department of M icrobiology and

2

PT

Biochemical Pharmacy, College of Pharmacy, Third M ilitary M edical University, Chongqing 400038, PR China,

Department of Biological and Chemical Engineering, Chongqing University of Education, Chongqing 400067,

Corresponding author: Hao Zeng ([email protected]) and Quanming Zou ([email protected]), at National

SC

*

RI

PR China.

Engineering Research Center of Immunological Products, Department of M icrobiology and Biochemical Pharmacy, College of Pharmacy, Third M ilitary M edical University, Chongqing 400038, PR China. Phone: 86-023-68752376.

AC C

EP T

ED

MA

NU

Fax: 086-023-68752376.

ACCEPTED MANUSCRIPT Abstract

SC

RI

PT

With more and more drug-resistant Staphylococcus aureus strains emerging in hospitals, there is an urgent need to develop an effective vaccine to combat S. aureus infection. In this study, we constructed a novel bivalent fusion vaccine, SpA-DKKAA-FnBPA37-507 (SF), based on the D domain of staphylococcal protein A (SpA) and the A domain of fibronectin-binding protein A (FnBPA). Immunisation with SF induced a more ideal protective effect compared with the single components alone in a sepsis model. It also showed broad immunoprotection against seven FnBPA isotypes. Vaccination with SF induced strong antibodies responses and Th1/Th17 polarized cellular responses. Further we demonstrated the protective effect of antibodies by the opsonophagocytic assay (OPA) and passive immunisation. Moreover, vaccination with SF showed protective efficacy in a murine pneumonia model and skin abscess model. These results suggest that SF can be regarded as a promising vaccine candidate for the prevention of S. aureus infections.

AC C

EP T

ED

MA

NU

Keywords: Staphylococcus aureus, vaccine, staphylococcal protein A (SpA), fibronectin-binding protein A (FnBPA)

ACCEPTED MANUSCRIPT 1. Introduction

PT

Staphylococcus aureus (S. aureus) is a Gram-positive, extracellular bacterium that causes a variety of community- and hospital-acquired diseases, such as bacteraemia, pneumonia and skin infections [1]. Recently, strains with resistance to multiple antibiotics, including methicillin-resistant strains (MRSA) and vancomycin-resistant strains (VRSA), are becoming increasingly prominent in hospitals [2]. Since most clinical isolates are resistant to a variety of antimicrobial agents, the choices for effective antimicrobial therapy are usually limited. There is an urgent need for effective preventive vaccines to prevent S. aureus infections [3, 4].

NU

SC

RI

S. aureus expresses a broad range of virulence factors, including surface proteins, also known as cell wall-anchored (CWA) proteins, that play critical roles in the pathogenesis of S. aureus-caused disease [5]. These surface proteins exhibit different functions: some can help S. aureus adhesion to and invasion of host cells and tissues, and some can help bacteria form biofilms to evade immune responses [6], suggesting that these CWA proteins are essential to help S. aureus survive during the commensal state or invasive infections in humans. Thus, vaccines based on these proteins may help combat S. aureus infections.

AC C

EP T

ED

MA

Staphylococcal protein A (SpA) is a multifunctional bacterial CWA protein that is present in almost all S. aureus strains [7]. It contributes to the virulence of S. aureus through its heavy chain binding to the Fc region of IgG to disrupt opsonisation and phagocytosis [8]. Evidence for the critical role of SpA as a virulence factor was demonstrated in models of sepsis [9, 10], pneumonia [11] and skin abscess infections [12]. Neonatal mice infected with the SpA mutant S. aureus show reduced pathogenicity in the murine bacteraemia model, and the mortality rate of mice was also significantly decreased [13]. Meanwhile, mouse monoclonal antibody SpAKKAA-mAb 3F6 shows protective immunity in neonatal mice and yields protection in the subsequent infections [10]. Immunisation with non-toxigenic SpAKKAA in animal models generated high titre antibodies [13]. SpA has been regarded as promising vaccine target for S. aureus [14], and vaccination with SpAKKAA also elicited protective immunity against S. aureus infections. Fibronectin-binding protein A (FnBPA) belongs to a family of microbial surface components recognising adhesive matrix molecules (MSCRAMMs) and promotes bacterial attachment to fibrinogen, elastin and fibronectin [5]. The N-terminus of the FnBPA contains a signal sequence (residues 1–36) followed by the A region [15]. A gene encoding FnBPA was found in the vast majority of S. aureus strains isolated from patients with bacteraemia, infective endocarditis or continuous ambulatory peritoneal dialysis-associated peritonitis. A S. aureus strain with high expression of the fnbp gene was better able to colonise damaged valves compared with typical endocarditis isolates [15]. Due to its high conservation and high pathogenicity in clinical S. aureus isolates, FnBPA has been considered as a potential vaccine candidate [16-18].

ACCEPTED MANUSCRIPT Even though SpA and FnBPA have both been proposed as potential vaccine targets, some clinical trials based on these two candidates have failed for unpublished questions [19, 20]. Most researchers believe that a multicomponent vaccine consisting of various antigens may exhibit ideal protective effects [21, 22]. Lately, more and more studies show that a vaccine that contains two or more surface proteins would yield higher protection in mouse models than vaccines that target each protein individually [23, 24]. Therefore, it is more likely that a vaccine containing multivalent antigens could induce ideal protection in future clinical trials.

SC

RI

PT

Here, we choose SpA and FnBPA as our candidate antigens. We combined the D domain of SpA and the A domain of FnBPA to generate the novel bivalent fusion vaccine SpA-DKKAA-FnBPA37-507 (SF). We investigated whether immunisation with SF could induce strong humoral and cellular responses and whether it conferred protection in different models in vivo. We then validated the protective effects of SF in three different mouse models, indicating that SF can be regarded as a potentially promising S. aureus vaccine candidate.

NU

2. Materials and methods

MA

2.1 Animals and bacterial strains

EP T

ED

Seven- to eight-week-old female BALB/c and C57BL/6 mice were purchased from Beijing HFK Bioscience Limited Company (Beijing, People’s Republic of China). 2.00 ± 0.20 kg female New Zealand white rabbits were provided by TengXin Company (Chongqing, People’s Republic of China). Mice and rabbits were kept under specific-pathogen-free (SPF) conditions. All of the animal experiments were approved by the Animal Ethical and Experimental Committee of the Third Military Medical University (Chongqing, 2011-04).

AC C

S. aureus strain MRSA 252 was purchased from the American Type Culture Collection (Manassas, VA, USA). 8325-4, Mu50 and MW2 were kindly provided by Baolin Sun (University of Science and Technology of China). The four other clinical S. aureus strains were collected from four different hospitals in China (Supplement Table S1).The bacterial strains were cultured in tryptic soy broth, washed, and diluted with sterile phosphate-buffered saline (PBS) to an appropriate cell concentration determined spectrophotometrically at 600 nm (OD600 ). 2.2 PCR amplification The sequences were amplified from the genome of strain MRSA 252. The sequence of SpA-DKKAA was followed from the research described by Kim [13] with the glutamine9,10 and aspartate36,37 in the D domain substituted by lysine9,10 and Alanine36,37 . Then, the SpA-DKKAA-Linker gene was synthesised by Shanghai Shenggong (China). The FnBPA37-507 gene was amplified by PCR using the following PCR primers and standard PCR amplification conditions: forward,

ACCEPTED MANUSCRIPT

SC

RI

PT

5'-CGCGGATCCATGGGACAAGATAAAGAAGCTGCA-3', and reverse, 5'TTTTCCTTTTGCGGCCGCCTATCCATTATCCCATGTTAATGTAT -3'. For the SpA-DKKAA-GGTGGCGGTGGCAGC- FnBPA37-507 construct, the first round of PCR was performed using the primers P1: GCGGATCCATGGGCTTCAACAAAGATAAAAAATC and P2: TAAAAAACTTAATGAATCT to generate SpA-DKKAA -GGATAATGGATAG, and the primers P3: GGTGGCGGTGGCAGCGGACAAGATAAAGAAGCTGC and P4: TTTTCCTTTTGCGGCCGCCTATCCATTATCCCATGTTAATGTAT were used to generate GGATAATGGATAG-FnBPA37-507 . The second round of PCR was performed based on the first-round PCR products, using the outside primers P1: GCGGATCCATGGGCTTCAACAAAGATAAAAAATC and P4: TTTTCCTTTTGCGGCCGCCTATCCATTATCCCATGTTAATGTAT. SpA KKAA and SpAWT were constructed based on previously published research [25]. The PCR products were placed between BamHI and NotI restriction sites to obtain the amplified genes.

NU

2.3 Expression and purification of recombinant proteins

AC C

EP T

ED

MA

First, all of PCR products were cloned into an expression vector derived from the pGEX-6p-2 plasmid (Sangon Biotech, Shanghai). Then these vectors were transformed into the Escherichia coli strain X1/blue for expression of the recombinant proteins. Isopropyl-b-D-1-thiogalactopyranoside (IPTG) was then added to a final concentration of 0.2 mM to induce protein expression at 16°C overnight. The GST-tagged proteins were purified from the cleared lysates by Capto MMC (GE), and the N-terminal GST tag was cleaved. Thus, GST- free proteins were collected. We then used Triton X-114 phase separation to remove the endotoxin as described elsewhere. The recombinant proteins were analysed by gel- filtration using the SuperdexT M 200 10/300GL column (GE). We then performed sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) to determine the protein purity. The bicinchoninic acid (BCA) method (Pierce) was used for determining the protein concentration. The endotoxin content was detected using the tachyplens ameboyto lysate assay (Houshiji cod Inc., Xiamen, China), and the endotoxin levels of all recombinant proteins were at acceptable levels (< 2.5 pg / μg). 2.4 Detection the binding ability of protein with human IgG. The proteins were each diluted with PBS to a concentration of 500 ng/ml. A 96-well ELISA plate was then coated with 100 μL of the diluted protein solution and incubated at 4°C overnight. The plate was washed four times with washing solution (Tris 2.42 g, Tween 20 0.5 mL, adjusted to pH=7.4 by concentrated HCl and then adding ddH2 O to a total volume of 1000 mL). To each well, 200 μL blocking solution (5% (w/v) skimmed milk powder dissolved in 100 mmol/L TTBS (Tris (pH 7.5), Tween 20 0.1% (v/v), and NaCl 0.9% (w/v)) were added for blocking at 37°C for 2 h. The liquid was discarded, and the plate was washed 4 times with the washing solution. A total of 100 μL human IgG-HRP (Beijing Zhongshan Golden Bridge Biotechnology

ACCEPTED MANUSCRIPT Co. Ltd.) (1:5000) was added and incubated at 37°C for 60 min. The liquid was discarded, and the plate was washed 4 times with the washing solution. A total of 100 μL/well of freshly prepared OPD-containing developer was added and developed in the dark at room temperature for 15 minutes. Then, 50 μL 12.5% H2 SO 4 was added to stop the reaction. OD450 nm was then measured. The high OD value indicated stronger binding to human IgG, further suggesting that it was not suitable as an antigen candidate.

PT

2.5 Detection the apoptosis of B cells in vivo.

NU

SC

RI

Purified protein or PBS was injected intraperitoneally (i.p.) at a dosage of 150 μg/mouse. The spleen of each mouse was resected 4 hours later, and the red blood cells were lysed with erythrocyte lysis solution (BD Biosciences, US). The splenocytes were then incubated with FITC-anti- mouse CD19 (GK1.5) and APC-anti- mouse CD3 (GK1.5) in FACS buffer (1% BSA, 1% duck serum, and 0.01% sodium azide) at 4°C for 30 min. The cells were then washed 3 times with PBS. The percentage of B cells (CD3-CD19+) was evaluated using a FACS Calibur (BD Biosciences) and analysed using the Cell Quest Pro software (BD Biosciences).

MA

2.6 Immunisation procedure and S. aureus infection models.

ED

For active immunisation, the procedure is consistent with the previous research [26]. Briefly, the purified proteins were emulsified 1:1 in Al(PO)4 (Pierce). On days 0, 14, and 21, mice were intramuscularly injected with 100 μL of the emulsion containing 20 μg protein. PBS plus adjuvant or PBS alone was used as the control. Serum samples were collected for the enzyme- linked immunosorbent assay (ELISA) on day 28.

AC C

EP T

For the survival rates, BALB/c mice were intravenously infected with MRSA 252, Mu50, MW2 or the clinical S. aureus isolates (infection doses are all supplied in Supplement Table S1) on day 35 and monitored for survival for 12 days after infection. For bacterial burdens and histopathology analyses in the sepsis model, each mouse was intravenously administered at an infective dose [5×10 8 colony forming units (CFUs)] of MRSA 252. For the pneumonia infection model, C57BL/6 mice were first anaesthetised with isoflurane (RWD Life Science). Then, the mice were inoculated with a MRSA 252 suspension (4×108 CFUs) in the naris. For the skin abscess model, C57BL/6 mice were anaesthetized with pentobarbital (0.001 g/per mice i.p., Merck). Their backs were shaved, and they were injected subcutaneously (s.c.) with 3 × 10 7 CFU MRSA 252 in 50μL PBS. Abscess formation was monitored for 14 days at 2-days intervals. A standard formula for area [A = (π/2) × l × w] was used for calculating the size of an abscess. For skin histological analysis and bacterial burden, tissue was harvested 4 days post infection.

ACCEPTED MANUSCRIPT 2.7 Quantitative bacteriology in organs Lungs, kidneys and skin abscesses were collected at certain times and then weighed and homogenised in 2 mL of PBS. Peripheral blood was collected in heparin anticoagulant tubes. All homogenates were then plated on tryptic soy broth for 24 hours at 37°C. 2.8 Histological analysis

RI

PT

Kidney tissues (3 days post- infection in the sepsis model), lung tissues (1 day post-infection in the pneumonia model) and skin abscesses (4 days post- infection in the sepsis model) were collected and fixed with 10% formalin and embedded in paraffin.

MA

NU

SC

The severity score of lung or kidney infections was calculated by a double-blind histological analysis as previous described [26]. Each kidney section from the sepsis model mice was given a score of 0–4 (0: no abnormality; 1: area of renal tubular interstitial lesion <5%; 2: 5%-25%; 3: 25%-75%; and 4: >75%). Each lung section from the pneumonia model mice was given a score of 0–4 (no abnormality to most severe). 2.9 ELISA

EP T

ED

Serum samples were used as the primary antibodies and coated in wells of microtitre plates (Thermo Lab systems) overnight at 4°C. The secondary antibodies were HRP-conjugated goat anti- mouse IgG (Southern Biotech, Birmingham, AL, USA), anti-IgG1, or anti-IgG2a (Sigma). The titres were diluted and monitored at OD450 and defined as the highest dilution that yielded an absorbance value of more than twice the value of the pre-immune serum.

AC C

2.10 Opsonophagocytic assay (OPA) The opsonophagocytic assay was carried out based on the article previously described [26]. Briefly, the HL60 cell line (ATCC, CCL-240) was used for the opsonophagocytic cells, and MRSA 252, 8325-4 and MW2 were used as the target strains. HL60 cells were maintained in L-glutamine-containing 1640 medium (Corning) supplemented with 10% heat- inactivated FBS (HyClone), 100 U/mL penicillin and 100 μg/mL streptomycin (Gibco) at 37°C in 5% CO 2 . 0.8% N,N-dimethylformamide (Sigma) was used to differentiate the HL60 cells (5 × 10 5 cells/mL) for 4 days. Vitality results of differentiate HL60 ≥90% were cons idered acceptable for the OPA, and trypan blue tests were carried out to verify the viability. The assay was carried out in 96-well round-bottom plates, with each well (80 μL) containing the following components: 4 × 105 HL60 cells (40 μL), 103 CFUs of S. aureus strain (10 μL), mouse serum (20 μL), and a complement source (Pel Freeze, 10 μL). After 1 hour of shaking on a mini-orbital shaker (700 rpm) in an incubator (37ºC

ACCEPTED MANUSCRIPT with 5% CO 2 ), the microtitre plates were placed on ice for 20 minutes to terminate the assay. Finally, 10 μL of the reaction mixture from each well was spotted onto tryptic soy agar, and the CFUs were calculated after overnight incubation. Control samples were incubated with opsonization buffer B (OBB) instead of serum. This experiment was performed in duplicate for each sample, and the killing effect was defined as a reduction in CFUs compared with OBB control. 2.11 Passive immunisation

2.12 Cell proliferation and cytokine assays.

SC

RI

PT

Rabbits were immunised using the same procedure performed on mice to generate rabbit polyclonal antibodies. Serum was collected on day 28, and the IgG fraction was obtained. The BCA method was performed to determine the IgG concentration. Each mouse was passively immunised with an i.p. injection of 5 mg of antibody (n=10) 1 day before infection. The survival rate was monitored for 12 days.

EP T

2.13 Statistical analysis

ED

MA

NU

Splenocytes were suspended in complete media (RPMI 1640 with 10% FBS) at a concentration of 2×106 cells/mL. The cells were stimulated with or without 10 μg/mL of SpA-DKKAA, FnBPA37-507 , or SF protein, at 37°C for 5 days. The supernatants were collected, and the amounts of IFN-γ, IL-5 and IL-17A were determined by ELISA using mouse IFN-γ ELISA, IL-5 ELISA and IL-17A ELISA kits (Biolegend), respectively. Lymphocyte proliferation was determined using the cellular incorporation of 5-bromo-2-deoxyuridine (BrdU, Roche, Germany), and absorbance values were measured at 450 nm. The stimulation index (SI) was calculated by dividing the absorbance of stimulated cells by the absorbance of unstimulated cells.

AC C

Data are presented as the Means ± Standard Deviation (SD) or Means ± Standard Error of Mean (SEM). The survival rates were analysed using Kaplan–Meier survival curves. Antibody titres were analysed using Student’s t-test. Severity scoring experiments and bacterial burdens were analysed using the non-parametric Mann– Whitney test. GraphPad Prism 5.0 (GraphPad Software) was used for data analyses, and significance was accepted at P < 0.05. 3. Results 3.1 Expression and purification of SpA-DKKAA, FnBPA37-507 , and SF. First, the SpA-DKKAA and FnBPA37-507 genes were amplified by PCR, and the “GGGGS” linker was used to combine them (Fig. 1A). All recombinant fragments were cloned into the pGEX-6P-2 vector and were expressed in Escherichia coli strain X1/blue. The recombinant fragments were then expressed as soluble proteins after IPTG induction. As shown in Fig. 1B, the three recombinant proteins all corresponded

ACCEPTED MANUSCRIPT

RI

PT

to their predicted molecular masses by SDS-PAGE (Fig. 1B). Because the SpAWT could non-specifically bind to the Fc region of IgG through its heavy chain, some researchers mutate SpAWT to SpAKKAA to eliminate the IgG binding capacity [13]. In an attempt to verify the security of SF, we detected the IgG binding ability and B cell toxicity of recombinant proteins. As shown in Fig. S1A, SpAWT induced apoptosis of mice spleen B lymphocytes (P < 0.0001). In contrast, SpAKKAA, SpA-DKKAA and SF showed no toxicity to B cells compared with a PBS control group (P > 0.05). We then tested the binding ability of SF to bind with human IgG (Fig. S1B). SpAWT showed strong binding ability with human IgG (P < 0.0001), while the SpAKKAA, SpA-DKKAA and SF showed lower binding ability with human IgG. 3.2 Validation of the protective effect of SF in a lethal S. aureus sepsis model.

ED

MA

NU

SC

Mice were immunised with either SpA-DKKAA, FnBPA37-507 , or SF plus AlPO 4 as the adjuvant, and then, the protective effects were evaluated in a lethal S. aureus sepsis model. For the survival rate, the SpA-DKKAA, FnBPA37-507 , and SF group exhibited high survival rates (40%, 45%, and 75% 10 days post- infection, respectively). At the same time, the survival rates of the AlPO 4 group (10% survival) and the PBS group (0% survival) were significant lower. Compared with the AlPO 4 group, the SpA-DKKAA, FnBPA37-507 and SF group showed significant protective effects (PSpA-DKKAA = 0.0394; PFnBPA37-507 = 0.0465; and PSF < 0.0001). Meanwhile, the bivalent fusion vaccine SF induced a higher protective effect than SpA-DKKAA or FnBPA37-507 alone (Fig. 2A, PSF-SpA-DKKAA = 0.0077 and PSF- FnBPA37-507 = 0.0140). Thus, immunisation with SF can generate protective efficacy in an S. aureus sepsis model.

AC C

EP T

We then detected the bacterial burdens in kidneys 1 and 3 days post- infection in a S. aureus infection model. The bacterial burdens were relatively lower in the SF group compared with the control group (Fig. 2B, P < 0.001), which shows that vaccination with SF enhanced S. aureus elimination in kidneys. For the histological analysis, the kidneys in the AlPO 4 group showed several bacterial abscesses. In contrast, the SF group showed less inflammatory cell infiltration and renal abscesses 3 days post infection (Fig. 2C). The kidneys in the SF group showed fewer inflammatory cells, and the glomeruli also showed less damage. Meanwhile, the severity score of the kidney damage was significantly lower in the SF group (Fig. 2D). Taken together, these results show that immunisation with SF reduced the S. aureus colonisation in kidneys in the sepsis model and that the protective effect was induced. 3.3 Immunisation with SF induced a broad protective effect against seven FnBPA isotypes. Since the A domain of FnBPA occurs in at least seven different isotypes, we measured the broadness of the protective effect of SF. In Supplement Table S1, we collected seven strains based on the A domain of FnBPA. We then validated the protective effects of SF against these seven strains. As shown in Fig. 3, although there is

ACCEPTED MANUSCRIPT variation of the FnBPA A domain, immunisation with SF protected mice against all seven isotypes in the sepsis model (P <0.05). Importantly, these seven isotypes included four clinical S. aureus strains, which were isolated from four different hospitals in China (Supplement Table S1), and vaccination with SF still conferred protection in these four strains. These data show that mice immunised with SF broadly protected mice from several S. aureus strains in murine sepsis models. 3.4 Active immunisation with SF induced strong antibody responses.

SC

RI

PT

Next, we carried out the ELISA to detect the titres of antigen-specific antibody against the different recombinant proteins. Immunisation with recombinant proteins plus AlPO 4 all induced strong antibody responses. Compared with the two component antigen groups, immunisation with SF induced higher titres of total IgG and the IgG subgroups (IgG1 and IgG2a; Table 1).

MA

NU

Because the SF consists of the D domain of SpA and the A domain of FnBPA, we wanted to determine whether immunisation with SF alone could generate antibodies of the two components. As shown in the Table 2, immunisation with SF alone can generate strong antibody responses against both SpA-DKKAA and FnBPA37-507 , and the titres of IgG between the SF group and the individual group were relatively similar with no significant differences (P >0.05). 3.5 Functional antibodies induced by SF conferred protective effects.

AC C

EP T

ED

To evaluate the efficacy of the SF-specific antibodies in vivo, we carried out the passive immunisation test. Mice were passively immunised with rabbit polyclonal anti-SF IgG, with the polyclonal IgG from AlPO 4 treated groups used as the control. Administration of anti-SF antibodies showed higher protection (50% survival) compared with the AlPO 4 IgG-treated groups (0% survival, Fig. 4A). Additionally, the mice in the SF group exhibited more active behaviour than the control group. This test demonstrated that anti-SF antibodies can effectively protect mice against S. aureus infection in vivo. Next, we performed the opsonophagocytic assays (OPA), which measured antibodyand complement- mediated bacterial killing in vitro. In the presence of HL60 phagocytic cells and the complement, rabbit serum without pre-dilution exhibited opsonophagocytic activity against MRSA 252 (80% killing rate), 8325-4 (74% killing rate) and MW2 (65% killing rate; Fig. 4B). Some research regards the opsonisation indices (OI) as the serum’s OPA results, and the OI can be calculated using linear interpolation of the serum dilution killing the 50% percentage of the bacteria [27, 28]. As shown in Fig. 4B, the SF- specific antibodies were efficient in these three S. aureus strains, and the average OI values were 62 (MRSA 252), 10 (8325-4) and 6 (MW2). Taken together, these results demonstrated that immunisation with SF yielded functional antibody responses with media protective effects, and these antibodies were efficient in killing S. aureus by regulating the phagocytosis of innate immune

ACCEPTED MANUSCRIPT cells (neutrophils). 3.6 Immunisation with SF induced strong cellular responses.

RI

PT

To understand the SF vaccination- mediated protection, we also evaluated the cellular responses. First, we detected the stimulation index of splenocytes from mice immunised with SpA-DKKAA, FnBPA37-507 and SF. Compared with the AlPO 4 control group, the stimulation indices of the vaccinated groups (SpA-DKKAA, FnBPA37-507 and SF) were all significantly higher (Fig. 5A, PSpA-DKKAA = 0.0209; PFnBPA37-507 = 0.0005; and PSF < 0.0001). Among the three vaccinated groups, the SF group achieved the highest splenocyte lympho-proliferation, and this proliferation was significantly higher than that of SpA-DKKAA or FnBPA37-507 alone (PSF-SpA-DKKAA = 0.0009 and PSFFnBPA37-507 = 0.0152).

MA

NU

SC

We then measured the cytokine responses produced by the splenocytes after stimulation with recombinant proteins. As shown in Fig. 5B-D, the splenocytes from the vaccinated groups induced significantly more IFN-γ, IL-5 and IL-17A than those of the AlPO 4 group. Among the three vaccinated groups, the SF group produced the greatest amounts of cytokines, which showed that immunisation with SF induced strong cellular responses. 3.7 Determination of the protective effects in a S. aureus pneumonia model.

AC C

EP T

ED

Since many severe respiratory infections are caused by S. aureus, the efficacy of SF against S. aureus pneumonia was further explored. The mice of the AlPO 4 group challenged with S. aureus showed serious symptoms: ruffled fur, lethargy and significant weight loss (Fig. 6A). In contrast, mice in the SF group behaved much more normally for their weight controlled within a relatively acceptable range. The bacterial burdens in the blood and the whole lung were calculated at 12, 24, 48 and 72 hours post-infection. At 12 hours post infection, there was no significant difference in blood or lung between the SF group and the AlPO 4 group (Fig. 6B-C, P12h-blood > 0.05; P12h-lung > 0.05). At 24 hours post infection, the bacterial burdens in the SF group were significantly reduced compared with those in the AlPO 4 group (Fig. 6B-C). For the bacterial burdens in blood, the SF group was significantly reduced compared with the AlPO 4 group 72 hours post infection (Fig. 6B, P12h-blood > 0.05). Therefore, we concluded that immunisation with SF reduced bacterial burdens in the lung when infected with S. aureus pneumonia (Fig. 6C, P24h-lung = 0.0005, P48h-lung = 0.0226, and P72h-lung = 0.0008). For the histological analysis, the lungs in the SF group showed less haemorrhaging compared with the AlPO 4 group (Fig. 6D). Meanwhile, the severity score of the lung was consistent with the results of histological analysis (Fig. 6E), which showed that immunisation with SF could protect the lung against S. aureus infections in a pneumonia model. 3.8 Vaccination with SF can effectively reduce abscess formation in a S. aureus skin abscess model.

ACCEPTED MANUSCRIPT

RI

PT

Finally, we used a skin abscess model to further assess the protective efficacy of SF. In this model, mice were inoculated by s.c. injection in the shaved flank with MRSA 252. Weight changes in the mice were monitored on day 2 after inoculation, and the weight change of mice in the SF group was relatively controlled compared with the AlPO 4 group (Fig. 7A). The skin abscesses were harvested on day 4 for detection of the bacterial burdens and histopathology and the results showed that immunisation with SF significantly reduced bacterial burdens in the skin abscesses (Fig. 7B, P < 0.0001). The area of abscess mass was monitored at 2-day intervals for 14 d. As shown in Fig. 7C, immunisation with SF significantly reduced abscess formation. Furthermore, as shown in the H&E-stained tissue sections, abscesses were much smaller in the SF group (Fig. 7D). Therefore, vaccination with SF can effectively reduce abscess formation in a S. aureus skin abscess model.

SC

4. Discussion

EP T

ED

MA

NU

Researchers have spent a lot of effort developing an effective S. aureus vaccine in recent years, though largely unsuccessfully [22, 29, 30]. Potential explanations for the lack of efficacy include: 1) one single antigen may not be sufficient to protect humans from S. aureus infections [31] ; 2) while the antibody level was measured, the levels of functional antibodies were not specified [32]; and 3) a large proportion of immune-compromised subjects were choose as vaccine target population [23]. Given these considerations, our strategy for developing a S. aureus vaccine was 1) to select antigens which could play a synergistic effect in combating S. aureus infections; 2) to evaluate the functional antibodies by using human phagocytosis cells; and 3) to increase the reliability and predictive value of this study by using different mouse models.

AC C

SpA involved in the immune evasion of S. aureus by interfering with opsonophagocytic clearance of the pathogen [33], whereas the FnBPA mediated the bacterial attachment and colonization [15]. SpA and FnBPA are expressed in almost all S. aureus strains, and they are both conserved in most S. aureus isolates [5, 34]. We designed the GGGGS linker to link the mutated D domain of SpA and A domain of FnBPA together, and then constructed the new bivalent fusion vaccine “SF”. As we expected, the SF did not show IgG binding ability or B cell toxicity (Fig. S1). From the survival rates and pathological results in sepsis model (Fig. 2A), it is clear that immunisation with the bivalent fusion vaccine SF induced a higher protective effect than that of SpA-DKKAA or FnBPA37-507 alone. The FnBPA A domain occurs in at least seven different isotypes, and the antigenic variation may aid S. aureus to evade the host's immune responses [35]. As shown in the Fig. 3, immunisation with SF provided broad protection when mice were challenged with all seven of these isotypes (Fig. 3). In addition to the sepsis model, immunisation with SF induced robust protection in S. aureus pneumonia and skin infection models, for bacterial burdens were greatly decreased in lung or skin abscess (Fig. 6 and Fig. 7). Taken these results together, immunisation with SF provided broad protection against

ACCEPTED MANUSCRIPT different strains and different infection models.

RI

PT

The key role of antibodies in the control of S. aureus infection has been reported in vitro and in vivo [36]. We have clearly demonstrated that all the vaccinated groups had induced prominent antibody responses. Additionally, the SF group induced large quantities of total IgG, IgG1, or IgG2a compared with the SpA-DKKAA and FnBPA37-507 groups (Table 1). At the same time, immunisation with SF alone produced antibody levels that are similar to those achieved with a single component, which reveals that this bivalent fusion vaccine could induce both SpA-DKKAA and FnBPA37-507 specific antibodies (Table 2). These results show that a vaccine containing multivalent antigens may be more effective in combating S. aureus infections.

EP T

ED

MA

NU

SC

It is clear that vaccines, which either trigger antibody responses to neutralise important virulence factors or induce opsonophagocytic killing of the invading pathogen, can protect people against bacterial pathogens [37]. Lately, 514G3, a true human anti-SpA monoclonal antibody for the treatment of S. aureus bacteraemia, has entered the clinical trial stage and shows safe results with minimal side effects [38]. In our study, polyclonal antibodies targeting SF are effective in preventing bacteraemia in mouse models. In vitro, the SF-specific antibodies promote the clearance of S. aureus in the presence of the complement and neutrophils, and a 3- fold dilution of the antibodies can still reach a 50% killing rate in all three S. aureus strains used. In contrast, the antibody of the serum was exhausted when incubating with S. aureus, and the serum did not show specific killing ability of the bacteria in the OPA (Fig. 4B). These results suggested that SF-specific polyclonal antibodies are functional in killing S. aureus and directly confer protective effects.

AC C

There is growing evidence that T cells play an important role in vaccine- mediated protection of pathogens [39], including S. aureus [40]. In this study, splenocytes of the SF group produced more IFN-γ, IL-4 and IL-17A than those from individual component groups (Fig. 5B, 5D), suggesting that immunisation with SF induced a strong potential Th1, Th2, and Th17-cell mixture responses. It is widely believed that antigen-specific Th1/Th17 responses are consistent with high survival rates in different S. aureus infection models and Th2 cell responses help to promote class switching and generate great amounts of functional antibody responses [40, 41]. These results show that immunisation with SF induced strong cellular responses, which may play a functional role in protective efficacy. In conclusion, we constructed a novel bivalent fusion vaccine SF and showed that it offered protection in three different S. aureus infection models. The antibodies raised by SF show high protective effects in vivo as well as an opsonizing ability that can stimulate neutrophil activity in vitro. Immunisation with SF also yield a Th1/Th17 polarized cellular response, which may play a critical role in immunoprotection. For S. aureus expresses multiple surface proteins, we were fortunate enough to find a formulation of subunit vaccines among dozens of antigens. These results are

ACCEPTED MANUSCRIPT promising and demonstrate that SF can be regarded as an efficient vaccine candidate against S. aureus. Acknowledgements This work was supported by National Natural Science Foundation of China (NSFC, Grant No:

AC C

EP T

ED

MA

NU

SC

RI

PT

31370932, 31600745, 31400792 and 81501722).

ACCEPTED MANUSCRIPT References 1.

Lowy, F.D., Staphylococcus aureus infections. N Engl J Med, 1998. 339(8): p. 520-32.

2.

Thomer, L., O. Schneewind, and D. Missiakas, Pathogenesis of Staphylococcus aureus Bloodstream Infections. Annu Rev Pathol, 2016.

3.

Knisely, J.M., et al., Vaccines for Hospital-Associated Infections: Promise and Challenge. Clin Infect Dis, 2016.

4.

Giersing, B.K., et al., Status of vaccine research and development of vaccines for Staphylococcus aureus. Vaccine, 2016. Foster, T.J., et al., Adhesion, invasion and evasion: the many functions of the surface

PT

5.

proteins of Staphylococcus aureus. Nat Rev Microbiol, 2013. 12(1): p. 49-62. 6.

Schaffer, A.C. and J.C. Lee, Staphylococcal vaccines and immunotherapies. Infect Dis Clin

7.

RI

North Am, 2009. 23(1): p. 153-71.

Graille, M., et al., Crystal structure of a Staphylococcus aureus protein A domain complexed

SC

with the Fab fragment of a human IgM antibody: structural basis for recognition of B-cell receptors and superantigen activity. Proc Natl Acad Sci U S A, 2000. 97(10): p. 5399-404. Foster, T.J., Immune evasion by staphylococci. Nat Rev Microbiol, 2005. 3(12): p. 948-58.

9.

Kim, H.K., et al., Protein A-specific monoclonal antibodies and prevention of Staphylococcus

NU

8.

aureus disease in mice. Infect Immun, 2012. 80(10): p. 3460-70. Thammavongsa, V., et al., Protein A-neutralizing monoclonal antibody protects neonatal

MA

10.

mice against Staphylococcus aureus. Vaccine, 2015. 33(4): p. 523-526. 11.

Bubeck Wardenburg, J., R.J. Patel, and O. Schneewind, Surface proteins and exotoxins are required for the pathogenesis of Staphylococcus aureus pneumonia. Infect Immun, 2007.

12.

ED

75(2): p. 1040-4.

Kwiecinski, J., T. Jin, and E. Josefsson, Surface proteins of Staphylococcus aureus play an important role in experimental skin infection. APMIS, 2014. 122(12): p. 1240-50. Kim, H.K., et al., Nontoxigenic protein A vaccine for methicillin-resistant Staphylococcus

EP T

13.

aureus infections in mice. J Exp Med, 2010. 207(9): p. 1863-70. 14.

Dayan, G.H., et al., Staphylococcus aureus: the current state of disease, pathophysiology and strategies for prevention. Expert Rev Vaccines, 2016. 15(11): p. 1373-1392. Menzies, B.E., The role of fibronectin binding proteins in the pathogenesis of

AC C

15.

Staphylococcus aureus infections. Curr Opin Infect Dis, 2003. 16(3): p. 225-9. 16.

Narita, K., K. Asano, and A. Nakane, IL-17A plays an important role in protection induced by vaccination with fibronectin-binding domain of fibronectin-binding protein A against Staphylococcus aureus infection. Med Microbiol Immunol, 2017.

17.

Zhou, H., et al., An immunogenicity study of a newly fusion protein Cna-FnBP vaccinated against Staphylococcus aureus infections in a mice model. Vaccine, 2006. 24(22): p. 4830-7.

18.

Arrecubieta, C., et al., Vaccination with clumping factor A and fibronectin binding protein A to prevent Staphylococcus aureus infection of an aortic patch in mice. J Infect Dis, 2008. 198(4): p. 571-5.

19.

DeJonge, M., et al., Clinical trial of safety and efficacy of INH-A21 for the prevention of nosocomial staphylococcal bloodstream infection in premature infants. J Pediatr, 2007. 151(3): p. 260-5, 265 e1.

20.

Bensinger, W.I., et al., Clinical trials with staphylococcal protein A. J Biol Response Mod,

ACCEPTED MANUSCRIPT 1984. 3(3): p. 347-51. 21.

Proctor, R.A., Challenges for a universal Staphylococcus aureus vaccine. Clin Infe ct Dis, 2012. 54(8): p. 1179-86.

22.

Jansen, K.U., et al., Vaccine review: "Staphyloccocus aureus vaccines: problems and prospects". Vaccine, 2013. 31(25): p. 2723-30.

23.

Bagnoli, F., et al., Vaccine composition formulated with a novel TLR7-dependent adjuvant induces high and broad protection against Staphylococcus aureus. Proc Natl Acad Sci U S A, 2015. DeDent, A., et al., Exploring Staphylococcus aureus pathways to disease for vaccine development. Semin Immunopathol, 2012. 34(2): p. 317-33.

25.

PT

24.

Varrone, J.J., et al., Passive immunization with anti-glucosaminidase monoclonal antibodies

RI

protects mice from implant-associated osteomyelitis by mediating opsonophagocytosis of Staphylococcus aureus megaclusters. J Orthop Res, 2014. 32(10): p. 1389-96. Yang, L., et al., Protective efficacy of the chimeric Staphylococcus aureus vaccine candidate

SC

26.

IC in sepsis and pneumonia models. Sci Rep, 2016. 6: p. 20929. 27.

Dwyer, M. and M. Gadjeva, Opsonophagocytic assay. Methods Mol Biol, 2014. 1100: p.

28.

NU

373-9.

Migita, K., et al., Opsonic and Antibody Responses to Pneumococcal Polysaccharide in Rheumatoid Arthritis Patients Receiving Golimumab Plus Methotrexate. Medicine

29.

MA

(Baltimore), 2015. 94(52): p. e2184.

Projan, S.J., M. Nesin, and P.M. Dunman, Staphylococcal vaccines and immunotherapy: to dream the impossible dream? Curr Opin Pharmacol, 2006. 6(5): p. 473-9.

30.

Proctor, R.A., Is there a future for a Staphylococcus aureus vaccine? Vaccine, 2012. 30(19): p.

31.

ED

2921-7.

Shinefield, H.R. and S. Black, Prospects for active and passive immunization against Staphylococcus aureus. Pediatr Infect Dis J, 2006. 25(2): p. 167-8. Fowler, V.G., et al., Effect of an investigational vaccine for preventing Staphylococcus

EP T

32.

aureus infections after cardiothoracic surgery: a randomized trial. JAMA, 2013. 309(13): p. 1368-1378. 33.

Falugi, F., et al., Role of protein A in the evasion of host adaptive immune responses by

34.

AC C

Staphylococcus aureus. MBio, 2013. 4(5): p. e00575-13. Shopsin, B., et al., Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J Clin Microbiol, 1999. 37(11): p. 3556-63. 35.

McCarthy, A.J. and J.A. Lindsay, Genetic variation in Staphylococcus aureus surface and immune evasion genes is lineage associated: implications for vaccine design and host-pathogen interactions. BMC Microbiol, 2010. 10: p. 173.

36.

Sause, W.E., et al., Antibody-Based Biologics and Their Promise to Combat Staphylococcus aureus Infections. Trends Pharmacol Sci, 2015.

37.

Karauzum, H. and S.K. Datta, Adaptive Immunity Against Staphylococcus aureus. Curr Top Microbiol Immunol, 2016.

38.

Huynh, T., et al., Safety and Tolerability of 514G3, a True Human Anti-Protein A Monoclonal Antibody for the Tr eatment of S. aureus Bacteremia. Open Forum Infe ctious Diseases, 2016. 3(suppl_1): p. 1354-1354.

39.

Spellberg, B. and R. Daum, Development of a vaccine against Staphylococcus aureus. Semin

ACCEPTED MANUSCRIPT Immunopathol, 2012. 34(2): p. 335-48. 40.

Broker, B.M., D. Mrochen, and V. Peton, The T Cell Response to Staphylococcus aureus. Pathogens, 2016. 5(1). Parker, D., et al., CD4+ T Cells Promote the Pathogenesis of Staphylococcus aureus

EP T

ED

MA

NU

SC

RI

PT

Pneumonia. J Infect Dis, 2015. 211(5): p. 835-45.

AC C

41.

ACCEPTED MANUSCRIPT Table 1. Antibody production induced by active immunisation with recombinant proteins. Antibody response a Protein IgG

IgG1 b

SpA-DKKAA

16.0658±0.9944

FnBPA37-507

16.3658±0.5164 c

SF

14.9658±0.9428 c

7.6404±1.2130 c

16.9658±1.5635

c

P < 0.001, P < 0.001

b

c

P < 0.01, P < 0.01

10.6336±1.7617 b

P < 0.001, Pc < 0.001

Results are expressed as means of Log2 (titres) ± SD (n=10). Pb shows the statistic difference between SF group and SpA-DKKAA

PT

a

6.6117±1.4206 b

14.8658±0.7379

19.2658±0.4830 b

IgG2a b

AC C

EP T

ED

MA

NU

SC

RI

group (unpaired t test). Pc shows the statistic difference between SF group and FnBPA 37-507 group (unpaired t test).

ACCEPTED MANUSCRIPT Table 2. IgG titres for individual proteins and the bivalent fusion vaccine (SF). Individual protein Protein

immunisation *

SF immunisation *

Significance#

SpA-DKKAA

16.0658±0.9944

16.4658±0.5270

P  0.05

FnBPA37-507

16.3658±0.5164

16.2658±0.6749

P  0.05

*Results are expressed as means of Log2(titres) ± SD (n=10). Individual immunisation means immunisation with SpA-DKKAA and FnBPA37-507 alone.

PT

#Specific antibody titres raised against proteins were not significantly different when immunizing antigens were administered

AC C

EP T

ED

MA

NU

SC

RI

individually or in combination (unpaired t test).

ACCEPTED MANUSCRIPT

RI

PT

Figure 1. Cloning and expression of the recombinant protein SpA-DKKAA-FnBPA37-507(SF). (A) Schematic diagram illustrating the primary structure of the SpA-DKKAA ， FnBPA37-507 and SpA-DKKAA-FnBPA37-507 (SF). SpA harbors an N-terminal signal sequence (S), five Ig binding domains (E, D, A, B, andC), variable region (X), and C-terminal sorting signal (black boxes). FnBPA harbors a fibrinogen binding region (A), fibronectin-binding homologous repeats (B), fibronectin-binding repeat units (D), cell wall spanning region (W), membrane spanning region (M) and positively-charged tail(black boxes). (B) Recombinant structure of SpA-DKKAA (left), FnBPA37-507 (middle) and SF (right) were purified by affinity chromatography and analysed by SDS-PAGE.

EP T

ED

MA

NU

SC

Figure 2. Immunisation with SF significantly reduced both organ bacterial burdens and pathology in sepsis models. (A) BALB/c mice (n=20) were immunised with antigens plus AlPO 4 adjuvant. The mice were intravenously infected with MRSA 252 (1×10 9 CFUs), and the survival rates were monitored for 10 days. (B) Bacterial burdens in the kidneys (n=8) were calculated at 3 days post- infection. Representative results from one of three independent experiments were shown. Data were presented as box and whisters, and the medians were shown. Asterisks indicate significant differences between two groups (* P < 0.05, **P < 0.01, ***P < 0.001). (C) HE-stained kidneys from the AlPO 4 group and recombinant vaccine immunised groups at 3 days post-infection were shown. BALB/c mice were immunised with recombinant proteins as previously described. The kidneys were collected 3 days post infection, and representative histopathological sections were shown (magnification=400×). (D) Severity scores of kidneys (n=10) from the AlPO 4 group and SF groups at 3 days post- infection were shown. Data were presented as scatter plots, and the means ± SEM were shown. Asterisks indicate significant differences between two groups (* P < 0.05, ** P < 0.01).

AC C

Figure 3. Validation of the protective effects of SF in seven FnBPA isotypes. BALB/c mice (n=10/group) were immunised with antigens plus AlPO 4 adjuvant. The mice were intravenously infected with S. aureus, and the injection dose were supplied in Supplement Table S1. Survival rates were monitored for 12 days. Compared with animals receiving the AlPO 4 , the significance of the protective immunity generated by the various antigens was measured with a log rank test. The asterisks represent a statistically significant difference (* P < 0.05, ** P < 0.01, *** P < 0.001). Figure 4. Passive immunisation and opsonophagocytic assays. (A) Survival rates of passive immunisation are shown. Rabbits (n=6) were immunised with SF plus AlPO 4 as well as AlPO 4 alone as control. On day 28, the serum was harvested. Antibody-specific IgG in the rabbit serum was purified. One day before infection, BALB/c mice (n=10) were passively immunised i.p. with 5 mg of the IgG fraction containing antibodies specific for SF and AlPO 4 . Mice were challenged with a lethal dose of MRSA 252 (1×109 CFUs), and survival rates were monitored for 12

ACCEPTED MANUSCRIPT

RI

PT

days. The significance of the protective immunity generated by the various antigens was measured with a log rank test compared with the AlPO 4 group. The asterisks represent a statistically significant difference (* P < 0.05, ** P < 0.01, *** P < 0.001). (B) The results of opsonophagocytic assays are shown. Rabbit serum, foetal rabbit complement, HL60 cells, and MRSA 252 were incubated in round bottom 96-well plates with shaking and plated on tryptic soy broth to measure bacterial survival, counted by CFUs, from which the average percent of killing was calculated. α means serum diluted 3-fold without S. aureus specific antibodies: 100 µL rabbit serum incubated with MRSA 252 (1×108 CFUs in 200 µL OBB) shaken for 30 min at room temperature and then centrifuged at 10,000 rpm for 2 min to remove the bacteria. This eliminated the S. aureus specific antibodies in the serum.

ED

MA

NU

SC

Figure 5. Analysis of splenocyte proliferation and cytokine responses. One week following the last booster, the splenocytes from vaccinated mice (n=6) were incubated with their corresponding antigen proteins (10 μg/mL) for 72 h. Proliferation was measured using the bromodeoxyuridine (BrdU) labelling method (A). For detection of cytokine responses, the splenocytes from vaccinated mice (n=6) were incubated with corresponding antigen proteins (10 μg/mL) for 5 days. The supernatants were harvested, and the cytokine levels of IFN-γ (B), IL-5 (C) and IL-17A (D) were determined. The means ± SEM are shown. Empty boxes represent splenocytes without stimulation, and black boxes representative splenocytes stimulated with their corresponding proteins. Asterisks indicate significant differences. (* P < 0.05, ** P < 0.01, *** P < 0.001).

AC C

EP T

Figure 6. Immunisation with SF can effectively reduce lung damage in a S. aureus pneumonia model. C57 mice (n=10) were immunised with SF on days 0, 14 and 21, and the control group was immunised with AlPO 4 . Mice were inoculated with 4×108 CFUs of a MRSA252 suspension in the naris on day 28. Weight changes were monitored for 12 days (A). The bacterial burdens in blood (B) and lung (C) were calculated 1, 3 and 7 days post- infection. (D) The representative HE-stained lung tissues (e, magnification=400×) 1 day post- infection are shown. (E) The histological scores of pneumonia were monitored and presented as scatter plots. The data are presented as the means derived from 3 independent experiments. Figure 7. Protective effects of SF in a S. aureus skin abscess model. C57 mice (n=10) were immunised as described previously. Mice were subcutaneously infected with 3×107 CFUs of a MRSA252 suspension in the shaved right flank on day 28. (A)Weight changes were measured 2 days post infection. (B)The bacterial burdens in abscesses were calculated 4 days post-infection. (C) The areas of skin abscess were monitored at 2-day intervals for 14 days. (D) The representative HE-stained skin abscess tissues (e, magnification=400×) from 4 day post-infection are shown.

ED

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

AC C

EP T

Fig. 1

SC

RI

PT

ACCEPTED MANUSCRIPT

AC C

EP T

ED

MA

NU

Fig. 2

SC

RI

PT

ACCEPTED MANUSCRIPT

AC C

EP T

ED

MA

NU

Fig. 3

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

AC C

EP T

ED

Fig. 4

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

AC C

EP T

ED

MA

Fig. 5

PT

ACCEPTED MANUSCRIPT

AC C

EP T

ED

MA

NU

SC

RI

Fig. 6

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

AC C

EP T

ED

MA

Fig. 7

ACCEPTED MANUSCRIPT Highlights  A novel bivalent fusion protein SF yields high protective effects in three murine infectious



Vaccination with SF elicited strong Th1/Th17 polarized cellular responses.

AC C

EP T

ED

MA

NU

SC

RI

PT



models. Vaccination with SF elicited strong humoral responses, and the functional antibodies were demonstrated by OPA and passive immunisation experiments.