- Email: [email protected]
A novel c.592-4_c.592-3delTT mutation in DGUOK gene causes exon skipping
Mitochondrion 10 (2010) 188–191
Contents lists available at ScienceDirect
Mitochondrion journal homepage: www.elsevier.com/locate/mito
Short communication
A novel c.592-4_c.592-3delTT mutation in DGUOK gene causes exon skipping Jack Q. Ji a,1, David Dimmock b,1, Lin-Ya Tang a, Maria Descartes c, Roberto Gomez d, S. Lane Rutledge c, Eric S. Schmitt a, Lee-Jun Wong a,* a
Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA Department of Pediatrics, Division of Genetics, Medical College of Wisconsin, Milwaukee, WI, USA c Department of Genetics, University of Alabama at Birmingham, Birmingham, AL, USA d Department of Pediatrics, Division of Gastroenterology, University of Alabama at Birmingham, Birmingham, AL, USA b
a r t i c l e
i n f o
Article history: Received 23 July 2009 Received in revised form 29 October 2009 Accepted 3 November 2009 Available online 10 November 2009 Keywords: Mitochondrial DNA depletion DGUOK mutation Splicing site mutation Hepatocerebral mtDNA depletion Exon skipping
a b s t r a c t Deoxyguanosine kinase (DGUOK) catalyzes the first step of the mitochondrial deoxypurine salvage pathway, the phosphorylation of purine deoxyribonucleosides. Mutations in the DGUOK gene have been linked to inherited mtDNA depletion syndromes, neonatal liver failure, nystagmus, and hypotonia. Previously, we reported the first case of a heterozygous unclassified c.592-4_c.592-3delTT alteration in a patient with DGUOK deficiency without the demonstration of its pathogenicity (Dimmock et al., 2008). This alteration was predicted to cause aberrant splicing based upon two computer algorithms. We now report a homozygous c.592-4_c.592-3delTT mutation found in two affected siblings of asymptomatic consanguineous parents. The proband presented with symptoms of idiopathic hepatitis, liver dysfunction, nystagmus, and retinal blindness. This individual died at 6 months of age due to liver failure. This individual’s affected sibling presented similarly and has remarkable elevations of tyrosine, methionine, and alanine. Many organic acids were elevated in urine, including lactic acid, Krebs cycle intermediates, and para-hydroxy compounds; ketone bodies were also present. RNA studies support aberrant splicing. Sequencing of cDNA detected exon 5 skipping in the two affected siblings, but not in the normal control. These results indicate that the homozygous c.592-4_c.592-3delTT is deleterious and responsible for the DGUOK deficiency. The parents were subsequently confirmed to be carriers of this mutation. In summary, we have demonstrated that c.592-4_c.592-3delTT is a pathogenic splice acceptor site mutation leading to DGUOK deficiency. Ó 2009 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
1. Introduction In the mitochondrial matrix, deoxyguanosine kinase (DGUOK, MIM601465) is responsible for the phosphorylation of purine deoxyribonucleosides. It catalyses the first step of the mitochondrial deoxypurine salvage pathway. Mutations in DGUOK have been linked to inherited mtDNA depletion syndromes, neonatal liver failure, nystagmus, and hypotonia (Dimmock et al., 2008; Lee et al., 2009; Mandel et al., 2001; Saada et al., 2001, 1991; Salviati et al., 2002; Wong et al., 2007). More than 80 affected patients from approximately 50 families with DGUOK mutations have previously been reported (Dimmock et al., 2008; Freisinger et al., 2006; Labarthe et al., 2005; Lee et al., 2009; Mancuso et al., 2005, 2003; Mandel et al., 2001; Mousson de Camaret et al., 2007; Rabinowitz et al., 2004; Salviati et al., 2002; Sarzi * Corresponding author. Address: Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, NAB 2015, Houston, TX 77030, USA. Tel.: +1 713 798 1940; fax: +1 713 798 8937. E-mail address: [email protected] (L.-J. Wong). 1 First two authors contributed equally to this work.
et al., 2007; Slama et al., 2005; Taanman et al., 2002; Tadiboyina et al., 2005; Wang et al., 2005). The typical phenotype of DGUOK deficiency is with neonatal onset progressive liver disease, usually associated with neurological dysfunction (hypotonia, nystagmus and psychomotor retardation) by the age of 3 months. Peripheral neuropathy and renal tubulopathy have been reported in occasional patients (Rahman and Poulton, 2009). In most cases, there is rapidly progressive liver disease and neurological deterioration, with death occurring by the age of 12 months or shortly after. We previously reported the first case of a c.5924_c.592-3delTT in a DGUOK deficient patient (Dimmock et al., 2008). Although computer-based software predicted c.5924_c.592-3delTT to cause aberrant splicing, no further clinical confirmatory test was available at that time. We now extend our understanding of this mutation through the analysis of a family with two affected individuals who were found to be homozygous for the intronic c.592-4_c.592-3delTT deletion in the DGUOK gene. DGUOK exon specific RT-PCR and cDNA sequencing have been developed as confirmatory tests in addition to routine DGUOK gene sequencing.
1567-7249/$ - see front matter Ó 2009 Elsevier B.V. and Mitochondria Research Society. All rights reserved. doi:10.1016/j.mito.2009.11.002
189
J.Q. Ji et al. / Mitochondrion 10 (2010) 188–191
2. Materials and methods Four members in a family with c.592-4_c.592-3delTT mutation in DGUOK were recruited according to IRB approved research protocols. DNA was extracted from blood using the Puregene DNA Purification Kit according to the manufacturer’s protocol (Gentra Systems Inc., Minneapolis, MN) as previously described (Dimmock et al., 2008). Total RNA was isolated from blood using RiboPureBlood (Applied Biosystem, Foster City, CA) and cDNA were made with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) primed with random hexamers following by the manufacturer’s protocol. Sequencing analysis of the DGUOK gene was performed as previously described (Dimmock et al., 2008). The primers used for DGUOK RT-PCR and cDNA sequencing were DGUOK-E3-4F: 50 -TACAGTGACAGGTATATCTTTG-30 and DGUOKE7R: 50 -AGATTCTTTACAAAGGTGTTTAC-30 . 3. Clinical presentation The proband was a 4 month old female born to asymptomatic parents. The proband’s grandparents were from a small Mexican
A
Exon 4
178 bp c.256
B
398 bp
E3-4F Exon 3
village; one maternal and one paternal grandparent were first cousins. The proband presented with symptoms of idiopathic hepatitis, liver dysfunction, nystagmus, and retinal blindness. The patient was being evaluated for possible liver transplant when sequence analysis of the DGUOK gene was requested. The proband died at age of 6 months due to liver failure. The current patient is the second child in this family. He developed similar clinical features as his deceased sister. No complications, maternal illnesses or exposures were reported during his gestation. This individual was born at term by spontaneous vaginal delivery; birth weight was 3 kg. At age 6 weeks, this infant was noted to have poor weight gain, lethargy, and jaundice. He was also noted to have poor eye contact and irritability. He had hypotonia, periodic nystagmus (intermittent conjugate, jerky eye movements, horizontal, vertical, and rotational nystagmus), and failure to thrive. The liver was palpable and enlarged. Laboratory investigation revealed hyperbilirubinemia, increased thrombin, prothrombin, mild elevations of transaminases, and elevation of GGT. Total bilirubin was 9.5 mg/dL (0.0–1.0) and direct was 5.8 mg/dL (0.0– 0.6). ALT was 59 U/L (5–45); AST 132 U/L (20–60); alkaline phosphatase was 892 U/L (91–375). Plasma amino acids showed
Exon 5
148 bp
c.443 c.444
116 bp
c.591
E7R Exon 6
100 bp
c.592 c.707 c.708
Exon 7
242 bp
c.807 c.808 c.1059
C
DGUOK (E3-4/E7R)
bp
normal
850
bp
500
398 282
proband
300 100
1
D
2
3
4
father Exon 6
Exon 4 GCTCCACTTTGAGGCTCTGATGAACATTCC GGCTTCATCTACCTCCAGGCTTCTCCCCAGGTTTGTTTG
Exon 5
Fig. 1. RT-PCR and cDNA sequencing results showing exon 5 skipping. (A) Primers for RT-PCR and cDNA sequencing. Positions of DGUOK primers are referred to U41668.1. (B) PCR products of cDNA. Lane 1: normal control, lane 2: affected sibling, lane 3: carrier father, lane 4: markers. The 398 bp band represents the normal size PCR product of E3-4F and E7R. The 282 bp band represents the PCR product with the absence of exon 5. (C) Sequencing results of genomic DNA showing c.592-4_c.592-3delTT mutation in the proband and the father. (D) Sequencing of the cDNA from the affected sibling showing exon 5 skipping.
190
J.Q. Ji et al. / Mitochondrion 10 (2010) 188–191
marked elevations of tyrosine, methionine, and alanine. Urine organic acids revealed multiple organic acid elevations including: lactic acid, ketone bodies, Krebs cycle intermediates, and para-hydroxy compounds. Unremarkable laboratory results include negative hepatitis panel, negative EBV panel, negative rapid HIV, and negative CMV IgM with positive CMV IgG. Head CT scan was normal. HIDA scan showed no evidence of intrahepatic or bowel activity. Cholangiogram under fluoroscopy showed quick and easy passage of the contrast medium into the bowel as well as up the hepatic duct. Abdominal ultrasound revealed a hyperechoic liver. 4. Results Sequencing analysis identified a homozygous c.592-4_c.5923delTT mutation in the proband and the affected sibling. Both parents were carriers for the heterozygous c.592-4_c.592-3delTT mutation. Due to the proximity of the c.592-4_c.592-3delTT mutation to the splice acceptor site of intron 4, two computer-based splicing site prediction programs of NetGene2 (www.cbs.dtu.d) and BDGP (www.fruitfly.org) were used to evaluate possible splicing effects. Both programs predict that the c.592-4_c.592-3delTT will abolish the splicing acceptor site. Based on these splicing predictions, DGUOK exon specific RT-PCR primers were designed to detect exon skipping (Fig. 1A). Using E3-4F and E7R primers for PCR of the cDNA derived from the affected sibling, a 282 bp PCR product was detected with the absence of the normal sized band (398 bp) (Fig. 1B, lane 2), consistent with the skipping of the 166 bp exon 5. The father’s cDNA produced both 398 bp and the 282 bp bands, representing his carrier status (Fig. 1B, lane 3). Sequencing analysis of the junction fragment from the proband and the father confirmed the skipping of exon 5 (Fig. 1C). The exon 5 skipping in the DGUOK gene results in an in-frame deletion of 39 amino acids from residues 198–236 of the protein. It lacks the a7 helix, LID region, and a8 helix of the DGUOK kinase domain, thus, losing the Glu211 (forming hydrogen bonds with the ribose O3’atom of ATP), as well as Arg 206 and Arg 208 in the LID region of the DGUOK kinase, forming salt bridges with the 50 phosphate groups of the ATP molecule (Johansson et al., 2001). These results suggest that the homozygous c.592-4_c.592-3delTT mutation is responsible for the DGUOK deficiency and the disease of the two affected children. In addition to the DGUOK gene and cDNA sequence analyses, the family members were also evaluated for mtDNA content (Table 1). The mtDNA copy number analysis shows that the two affected children have reduced mtDNA content in blood when compared to tissue and age matched pooled controls (n = 20) (Bai et al., 2004). Parental mtDNA content was within normal range. The skin fibroblast culture, however, does not show mtDNA reduction, and is not a reliable source for the evaluation of mtDNA depletion syndrome (unpublished observation, manuscript submitted). 5. Discussion The major supply of deoxynucleotides for mitochondrial DNA biosynthesis depends on salvage pathways for dNTP generation.
Table 1 mtDNA content in the family.
a
Patient
Age Tissue (y)
Proband Proband Proband’s brother Father Mother
0.2 0.2 0.2 20 20
mtDNA Age matched Control content controla (%)
Skin fibroblast cell 600 Blood 203 Blood 153 Blood 224 Blood 194
447 340 340 250 250
Pooled of 20 tissue and age matched control samples.
134 60 45 90 78
DGUOK is responsible for the rate-limiting first step of the salvage biosynthesis of purine deoxynucleotides that is necessary for the maintenance of mitochondrial deoxynucleotide pools. The hepatocerebral form of mitochondrial DNA depletion syndrome (MIM251880) caused by DGUOK deficiency is usually characterized by onset at less than 6 months of age, early progressive liver failure, muscle hypotonia, hyperreflexia, and irritability; most patients die before 12 months of age from liver failure. Our study shows that the c.592-4_c.592-3delTT in DGUOK is an autosomal recessive mutation that is responsible for the liver failure observed in the two affected children. The heterozygous parents are asymptomatic. Computer algorithms are frequently utilized to assist in determining the significance of unclassified variants. However, molecular corroboration is needed since large scale application of bioinformatic algorithms has lead to significant false positive predictions (Arnold et al., 2009; Vreeswijk et al., 2009). The c.5924_c.592-3delTT mutation changes the sequence and the length of the pyrimidine track of the splice acceptor site from ‘‘ACTGTCTTttAG” to ‘‘GGACTGTCTTAG”. Using published computer algorithm (http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html), this alteration was predicted to result in the loss of the splice acceptor site (Zhang, 1998). The results show that c.592-4_c.592-3delTT changes the splice site score from 6.1 to 0.2 (the mean score of the 30 splice acceptor site in constitutive exons is 7.9). Thus, this analysis predicts the loss of the acceptor site, consistent with the cDNA sequence analysis. Although nonsense mediated decay can limit the utility of cDNA analysis, in this study, blood cDNA analysis demonstrates that the c.592-4_c.592-3delTT mutation causes aberrant splicing, resulting in a 39 amino acid in-frame deletion.
Acknowledgment We thank the members of the evaluated family for their cooperation in this study.
References Arnold, S., Buchanan, D.D., Barker, M., Jaskowski, L., Walsh, M.D., Birney, G., Woods, M.O., Hopper, J.L., Jenkins, M.A., Brown, M.A., Tavtigian, S.V., Goldgar, D.E., Young, J.P., Spurdle, A.B., 2009. Classifying MLH1 and MSH2 variants using bioinformatic prediction, splicing assays, segregation, and tumor characteristics. Hum. Mutat. 30, 757–770. Bai, R.K., Perng, C.L., Hsu, C.H., Wong, L.J., 2004. Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease. Ann. NY Acad. Sci. 1011, 304–309. Dimmock, D.P., Zhang, Q., Dionisi-Vici, C., Carrozzo, R., Shieh, J., Tang, L.Y., Truong, C., Schmitt, E., Sifry-Platt, M., Lucioli, S., Santorelli, F.M., Ficicioglu, C.H., Rodriguez, M., Wierenga, K., Enns, G.M., Longo, N., Lipson, M.H., Vallance, H., Craigen, W.J., Scaglia, F., Wong, L.J., 2008. Clinical and molecular features of mitochondrial DNA depletion due to mutations in deoxyguanosine kinase. Hum. Mutat. 29, 330–331. Freisinger, P., Futterer, N., Lankes, E., Gempel, K., Berger, T.M., Spalinger, J., Hoerbe, A., Schwantes, C., Lindner, M., Santer, R., Burdelski, M., Schaefer, H., Setzer, B., Walker, U.A., Horvath, R., 2006. Hepatocerebral mitochondrial DNA depletion syndrome caused by deoxyguanosine kinase (DGUOK) mutations. Arch. Neurol. 63, 1129–1134. Johansson, K., Ramaswamy, S., Ljungcrantz, C., Knecht, W., Piskur, J., MunchPetersen, B., Eriksson, S., Eklund, H., 2001. Structural basis for substrate specificities of cellular deoxyribonucleoside kinases. Nat. Struct. Biol. 8, 616– 620. Labarthe, F., Dobbelaere, D., Devisme, L., De Muret, A., Jardel, C., Taanman, J.W., Gottrand, F., Lombes, A., 2005. Clinical, biochemical and morphological features of hepatocerebral syndrome with mitochondrial DNA depletion due to deoxyguanosine kinase deficiency. J. Hepatol. 43, 333–341. Lee, N.C., Dimmock, D., Hwu, W.L., Tang, L.Y., Huang, W.C., Chinault, A.C., Wong, L.J., 2009. Simultaneous detection of mitochondrial DNA depletion and single-exon deletion in the deoxyguanosine gene using array-based comparative genomic hybridisation. Arch. Dis. Child. 94, 55–58. Mancuso, M., Filosto, M., Tsujino, S., Lamperti, C., Shanske, S., Coquet, M., Desnuelle, C., DiMauro, S., 2003. Muscle glycogenosis and mitochondrial hepatopathy in an infant with mutations in both the myophosphorylase and deoxyguanosine kinase genes. Arch. Neurol. 60, 1445–1447.
J.Q. Ji et al. / Mitochondrion 10 (2010) 188–191 Mancuso, M., Ferraris, S., Pancrudo, J., Feigenbaum, A., Raiman, J., Christodoulou, J., Thorburn, D.R., DiMauro, S., 2005. New DGK gene mutations in the hepatocerebral form of mitochondrial DNA depletion syndrome. Arch. Neurol. 62, 745–747. Mandel, H., Szargel, R., Labay, V., Elpeleg, O., Saada, A., Shalata, A., Anbinder, Y., Berkowitz, D., Hartman, C., Barak, M., Eriksson, S., Cohen, N., 2001. The deoxyguanosine kinase gene is mutated in individuals with depleted hepatocerebral mitochondrial DNA. Nat. Genet. 29, 337–341. Mousson de Camaret, B., Taanman, J.W., Padet, S., Chassagne, M., Mayencon, M., Clerc-Renaud, P., Mandon, G., Zabot, M.T., Lachaux, A., Bozon, D., 2007. Kinetic properties of mutant deoxyguanosine kinase in a case of reversible hepatic mtDNA depletion. Biochem. J. 402, 377–385. Rabinowitz, S.S., Gelfond, D., Chen, C.K., Gloster, E.S., Whitington, P.F., Sacconi, S., Salviati, L., DiMauro, S., 2004. Hepatocerebral mitochondrial DNA depletion syndrome: clinical and morphologic features of a nuclear gene mutation. J. Pediatr. Gastroenterol. Nutr. 38, 216–220. Rahman, S., Poulton, J., 2009. Diagnosis of mitochondrial DNA depletion syndromes. Arch. Dis. Child 94, 3–5. Saada, A.B., Terespolski, Y., Adoni, A., Kahane, I., 1991. Adherence of ureaplasma urealyticum to human erythrocytes. Infect. Immun. 59, 467–469. Saada, A., Shaag, A., Mandel, H., Nevo, Y., Eriksson, S., Elpeleg, O., 2001. Mutant mitochondrial thymidine kinase in mitochondrial DNA depletion myopathy. Nat. Genet. 29, 342–344. Salviati, L., Sacconi, S., Mancuso, M., Otaegui, D., Camano, P., Marina, A., Rabinowitz, S., Shiffman, R., Thompson, K., Wilson, C.M., Feigenbaum, A., Naini, A.B., Hirano, M., Bonilla, E., DiMauro, S., Vu, T.H., 2002. Mitochondrial DNA depletion and dGK gene mutations. Ann. Neurol. 52, 311–317. Sarzi, E., Bourdon, A., Chretien, D., Zarhrate, M., Corcos, J., Slama, A., Cormier-Daire, V., de Lonlay, P., Munnich, A., Rotig, A., 2007. Mitochondrial DNA depletion is a
191
prevalent cause of multiple respiratory chain deficiency in childhood. J. Pediatr. 150, 531–534. 534 e531–536. Slama, A., Giurgea, I., Debrey, D., Bridoux, D., de Lonlay, P., Levy, P., Chretien, D., Brivet, M., Legrand, A., Rustin, P., Munnich, A., Rotig, A., 2005. Deoxyguanosine kinase mutations and combined deficiencies of the mitochondrial respiratory chain in patients with hepatic involvement. Mol. Genet. Metab. 86, 462–465. Taanman, J.W., Kateeb, I., Muntau, A.C., Jaksch, M., Cohen, N., Mandel, H., 2002. A novel mutation in the deoxyguanosine kinase gene causing depletion of mitochondrial DNA. Ann. Neurol. 52, 237–239. Tadiboyina, V.T., Rupar, A., Atkison, P., Feigenbaum, A., Kronick, J., Wang, J., Hegele, R.A., 2005. Novel mutation in DGUOK in hepatocerebral mitochondrial DNA depletion syndrome associated with cystathioninuria. Am. J. Med. Genet. A 135, 289–291. Vreeswijk, M.P., Kraan, J.N., van der Klift, H.M., Vink, G.R., Cornelisse, C.J., Wijnen, J.T., Bakker, E., van Asperen, C.J., Devilee, P., 2009. Intronic variants in BRCA1 and BRCA2 that affect RNA splicing can be reliably selected by splice-site prediction programs. Hum. Mutat. 30, 107–114. Wang, L., Limongelli, A., Vila, M.R., Carrara, F., Zeviani, M., Eriksson, S., 2005. Molecular insight into mitochondrial DNA depletion syndrome in two patients with novel mutations in the deoxyguanosine kinase and thymidine kinase 2 genes. Mol. Genet. Metab. 84, 75–82. Wong, L.J., Brunetti-Pierri, N., Zhang, Q., Yazigi, N., Bove, K.E., Dahms, B.B., Puchowicz, M.A., Gonzalez-Gomez, I., Schmitt, E.S., Truong, C.K., Hoppel, C.L., Chou, P.C., Wang, J., Baldwin, E.E., Adams, D., Leslie, N., Boles, R.G., Kerr, D.S., Craigen, W.J., 2007. Mutations in the MPV17 gene are responsible for rapidly progressive liver failure in infancy. Hepatology 46, 1218–1227. Zhang, M.Q., 1998. Statistical features of human exons and their flanking regions. Hum. Mol. Genet. 7, 919–932.
Contents lists available at ScienceDirect
Mitochondrion journal homepage: www.elsevier.com/locate/mito
Short communication
A novel c.592-4_c.592-3delTT mutation in DGUOK gene causes exon skipping Jack Q. Ji a,1, David Dimmock b,1, Lin-Ya Tang a, Maria Descartes c, Roberto Gomez d, S. Lane Rutledge c, Eric S. Schmitt a, Lee-Jun Wong a,* a
Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA Department of Pediatrics, Division of Genetics, Medical College of Wisconsin, Milwaukee, WI, USA c Department of Genetics, University of Alabama at Birmingham, Birmingham, AL, USA d Department of Pediatrics, Division of Gastroenterology, University of Alabama at Birmingham, Birmingham, AL, USA b
a r t i c l e
i n f o
Article history: Received 23 July 2009 Received in revised form 29 October 2009 Accepted 3 November 2009 Available online 10 November 2009 Keywords: Mitochondrial DNA depletion DGUOK mutation Splicing site mutation Hepatocerebral mtDNA depletion Exon skipping
a b s t r a c t Deoxyguanosine kinase (DGUOK) catalyzes the first step of the mitochondrial deoxypurine salvage pathway, the phosphorylation of purine deoxyribonucleosides. Mutations in the DGUOK gene have been linked to inherited mtDNA depletion syndromes, neonatal liver failure, nystagmus, and hypotonia. Previously, we reported the first case of a heterozygous unclassified c.592-4_c.592-3delTT alteration in a patient with DGUOK deficiency without the demonstration of its pathogenicity (Dimmock et al., 2008). This alteration was predicted to cause aberrant splicing based upon two computer algorithms. We now report a homozygous c.592-4_c.592-3delTT mutation found in two affected siblings of asymptomatic consanguineous parents. The proband presented with symptoms of idiopathic hepatitis, liver dysfunction, nystagmus, and retinal blindness. This individual died at 6 months of age due to liver failure. This individual’s affected sibling presented similarly and has remarkable elevations of tyrosine, methionine, and alanine. Many organic acids were elevated in urine, including lactic acid, Krebs cycle intermediates, and para-hydroxy compounds; ketone bodies were also present. RNA studies support aberrant splicing. Sequencing of cDNA detected exon 5 skipping in the two affected siblings, but not in the normal control. These results indicate that the homozygous c.592-4_c.592-3delTT is deleterious and responsible for the DGUOK deficiency. The parents were subsequently confirmed to be carriers of this mutation. In summary, we have demonstrated that c.592-4_c.592-3delTT is a pathogenic splice acceptor site mutation leading to DGUOK deficiency. Ó 2009 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
1. Introduction In the mitochondrial matrix, deoxyguanosine kinase (DGUOK, MIM601465) is responsible for the phosphorylation of purine deoxyribonucleosides. It catalyses the first step of the mitochondrial deoxypurine salvage pathway. Mutations in DGUOK have been linked to inherited mtDNA depletion syndromes, neonatal liver failure, nystagmus, and hypotonia (Dimmock et al., 2008; Lee et al., 2009; Mandel et al., 2001; Saada et al., 2001, 1991; Salviati et al., 2002; Wong et al., 2007). More than 80 affected patients from approximately 50 families with DGUOK mutations have previously been reported (Dimmock et al., 2008; Freisinger et al., 2006; Labarthe et al., 2005; Lee et al., 2009; Mancuso et al., 2005, 2003; Mandel et al., 2001; Mousson de Camaret et al., 2007; Rabinowitz et al., 2004; Salviati et al., 2002; Sarzi * Corresponding author. Address: Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, NAB 2015, Houston, TX 77030, USA. Tel.: +1 713 798 1940; fax: +1 713 798 8937. E-mail address: [email protected] (L.-J. Wong). 1 First two authors contributed equally to this work.
et al., 2007; Slama et al., 2005; Taanman et al., 2002; Tadiboyina et al., 2005; Wang et al., 2005). The typical phenotype of DGUOK deficiency is with neonatal onset progressive liver disease, usually associated with neurological dysfunction (hypotonia, nystagmus and psychomotor retardation) by the age of 3 months. Peripheral neuropathy and renal tubulopathy have been reported in occasional patients (Rahman and Poulton, 2009). In most cases, there is rapidly progressive liver disease and neurological deterioration, with death occurring by the age of 12 months or shortly after. We previously reported the first case of a c.5924_c.592-3delTT in a DGUOK deficient patient (Dimmock et al., 2008). Although computer-based software predicted c.5924_c.592-3delTT to cause aberrant splicing, no further clinical confirmatory test was available at that time. We now extend our understanding of this mutation through the analysis of a family with two affected individuals who were found to be homozygous for the intronic c.592-4_c.592-3delTT deletion in the DGUOK gene. DGUOK exon specific RT-PCR and cDNA sequencing have been developed as confirmatory tests in addition to routine DGUOK gene sequencing.
1567-7249/$ - see front matter Ó 2009 Elsevier B.V. and Mitochondria Research Society. All rights reserved. doi:10.1016/j.mito.2009.11.002
189
J.Q. Ji et al. / Mitochondrion 10 (2010) 188–191
2. Materials and methods Four members in a family with c.592-4_c.592-3delTT mutation in DGUOK were recruited according to IRB approved research protocols. DNA was extracted from blood using the Puregene DNA Purification Kit according to the manufacturer’s protocol (Gentra Systems Inc., Minneapolis, MN) as previously described (Dimmock et al., 2008). Total RNA was isolated from blood using RiboPureBlood (Applied Biosystem, Foster City, CA) and cDNA were made with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) primed with random hexamers following by the manufacturer’s protocol. Sequencing analysis of the DGUOK gene was performed as previously described (Dimmock et al., 2008). The primers used for DGUOK RT-PCR and cDNA sequencing were DGUOK-E3-4F: 50 -TACAGTGACAGGTATATCTTTG-30 and DGUOKE7R: 50 -AGATTCTTTACAAAGGTGTTTAC-30 . 3. Clinical presentation The proband was a 4 month old female born to asymptomatic parents. The proband’s grandparents were from a small Mexican
A
Exon 4
178 bp c.256
B
398 bp
E3-4F Exon 3
village; one maternal and one paternal grandparent were first cousins. The proband presented with symptoms of idiopathic hepatitis, liver dysfunction, nystagmus, and retinal blindness. The patient was being evaluated for possible liver transplant when sequence analysis of the DGUOK gene was requested. The proband died at age of 6 months due to liver failure. The current patient is the second child in this family. He developed similar clinical features as his deceased sister. No complications, maternal illnesses or exposures were reported during his gestation. This individual was born at term by spontaneous vaginal delivery; birth weight was 3 kg. At age 6 weeks, this infant was noted to have poor weight gain, lethargy, and jaundice. He was also noted to have poor eye contact and irritability. He had hypotonia, periodic nystagmus (intermittent conjugate, jerky eye movements, horizontal, vertical, and rotational nystagmus), and failure to thrive. The liver was palpable and enlarged. Laboratory investigation revealed hyperbilirubinemia, increased thrombin, prothrombin, mild elevations of transaminases, and elevation of GGT. Total bilirubin was 9.5 mg/dL (0.0–1.0) and direct was 5.8 mg/dL (0.0– 0.6). ALT was 59 U/L (5–45); AST 132 U/L (20–60); alkaline phosphatase was 892 U/L (91–375). Plasma amino acids showed
Exon 5
148 bp
c.443 c.444
116 bp
c.591
E7R Exon 6
100 bp
c.592 c.707 c.708
Exon 7
242 bp
c.807 c.808 c.1059
C
DGUOK (E3-4/E7R)
bp
normal
850
bp
500
398 282
proband
300 100
1
D
2
3
4
father Exon 6
Exon 4 GCTCCACTTTGAGGCTCTGATGAACATTCC GGCTTCATCTACCTCCAGGCTTCTCCCCAGGTTTGTTTG
Exon 5
Fig. 1. RT-PCR and cDNA sequencing results showing exon 5 skipping. (A) Primers for RT-PCR and cDNA sequencing. Positions of DGUOK primers are referred to U41668.1. (B) PCR products of cDNA. Lane 1: normal control, lane 2: affected sibling, lane 3: carrier father, lane 4: markers. The 398 bp band represents the normal size PCR product of E3-4F and E7R. The 282 bp band represents the PCR product with the absence of exon 5. (C) Sequencing results of genomic DNA showing c.592-4_c.592-3delTT mutation in the proband and the father. (D) Sequencing of the cDNA from the affected sibling showing exon 5 skipping.
190
J.Q. Ji et al. / Mitochondrion 10 (2010) 188–191
marked elevations of tyrosine, methionine, and alanine. Urine organic acids revealed multiple organic acid elevations including: lactic acid, ketone bodies, Krebs cycle intermediates, and para-hydroxy compounds. Unremarkable laboratory results include negative hepatitis panel, negative EBV panel, negative rapid HIV, and negative CMV IgM with positive CMV IgG. Head CT scan was normal. HIDA scan showed no evidence of intrahepatic or bowel activity. Cholangiogram under fluoroscopy showed quick and easy passage of the contrast medium into the bowel as well as up the hepatic duct. Abdominal ultrasound revealed a hyperechoic liver. 4. Results Sequencing analysis identified a homozygous c.592-4_c.5923delTT mutation in the proband and the affected sibling. Both parents were carriers for the heterozygous c.592-4_c.592-3delTT mutation. Due to the proximity of the c.592-4_c.592-3delTT mutation to the splice acceptor site of intron 4, two computer-based splicing site prediction programs of NetGene2 (www.cbs.dtu.d) and BDGP (www.fruitfly.org) were used to evaluate possible splicing effects. Both programs predict that the c.592-4_c.592-3delTT will abolish the splicing acceptor site. Based on these splicing predictions, DGUOK exon specific RT-PCR primers were designed to detect exon skipping (Fig. 1A). Using E3-4F and E7R primers for PCR of the cDNA derived from the affected sibling, a 282 bp PCR product was detected with the absence of the normal sized band (398 bp) (Fig. 1B, lane 2), consistent with the skipping of the 166 bp exon 5. The father’s cDNA produced both 398 bp and the 282 bp bands, representing his carrier status (Fig. 1B, lane 3). Sequencing analysis of the junction fragment from the proband and the father confirmed the skipping of exon 5 (Fig. 1C). The exon 5 skipping in the DGUOK gene results in an in-frame deletion of 39 amino acids from residues 198–236 of the protein. It lacks the a7 helix, LID region, and a8 helix of the DGUOK kinase domain, thus, losing the Glu211 (forming hydrogen bonds with the ribose O3’atom of ATP), as well as Arg 206 and Arg 208 in the LID region of the DGUOK kinase, forming salt bridges with the 50 phosphate groups of the ATP molecule (Johansson et al., 2001). These results suggest that the homozygous c.592-4_c.592-3delTT mutation is responsible for the DGUOK deficiency and the disease of the two affected children. In addition to the DGUOK gene and cDNA sequence analyses, the family members were also evaluated for mtDNA content (Table 1). The mtDNA copy number analysis shows that the two affected children have reduced mtDNA content in blood when compared to tissue and age matched pooled controls (n = 20) (Bai et al., 2004). Parental mtDNA content was within normal range. The skin fibroblast culture, however, does not show mtDNA reduction, and is not a reliable source for the evaluation of mtDNA depletion syndrome (unpublished observation, manuscript submitted). 5. Discussion The major supply of deoxynucleotides for mitochondrial DNA biosynthesis depends on salvage pathways for dNTP generation.
Table 1 mtDNA content in the family.
a
Patient
Age Tissue (y)
Proband Proband Proband’s brother Father Mother
0.2 0.2 0.2 20 20
mtDNA Age matched Control content controla (%)
Skin fibroblast cell 600 Blood 203 Blood 153 Blood 224 Blood 194
447 340 340 250 250
Pooled of 20 tissue and age matched control samples.
134 60 45 90 78
DGUOK is responsible for the rate-limiting first step of the salvage biosynthesis of purine deoxynucleotides that is necessary for the maintenance of mitochondrial deoxynucleotide pools. The hepatocerebral form of mitochondrial DNA depletion syndrome (MIM251880) caused by DGUOK deficiency is usually characterized by onset at less than 6 months of age, early progressive liver failure, muscle hypotonia, hyperreflexia, and irritability; most patients die before 12 months of age from liver failure. Our study shows that the c.592-4_c.592-3delTT in DGUOK is an autosomal recessive mutation that is responsible for the liver failure observed in the two affected children. The heterozygous parents are asymptomatic. Computer algorithms are frequently utilized to assist in determining the significance of unclassified variants. However, molecular corroboration is needed since large scale application of bioinformatic algorithms has lead to significant false positive predictions (Arnold et al., 2009; Vreeswijk et al., 2009). The c.5924_c.592-3delTT mutation changes the sequence and the length of the pyrimidine track of the splice acceptor site from ‘‘ACTGTCTTttAG” to ‘‘GGACTGTCTTAG”. Using published computer algorithm (http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html), this alteration was predicted to result in the loss of the splice acceptor site (Zhang, 1998). The results show that c.592-4_c.592-3delTT changes the splice site score from 6.1 to 0.2 (the mean score of the 30 splice acceptor site in constitutive exons is 7.9). Thus, this analysis predicts the loss of the acceptor site, consistent with the cDNA sequence analysis. Although nonsense mediated decay can limit the utility of cDNA analysis, in this study, blood cDNA analysis demonstrates that the c.592-4_c.592-3delTT mutation causes aberrant splicing, resulting in a 39 amino acid in-frame deletion.
Acknowledgment We thank the members of the evaluated family for their cooperation in this study.
References Arnold, S., Buchanan, D.D., Barker, M., Jaskowski, L., Walsh, M.D., Birney, G., Woods, M.O., Hopper, J.L., Jenkins, M.A., Brown, M.A., Tavtigian, S.V., Goldgar, D.E., Young, J.P., Spurdle, A.B., 2009. Classifying MLH1 and MSH2 variants using bioinformatic prediction, splicing assays, segregation, and tumor characteristics. Hum. Mutat. 30, 757–770. Bai, R.K., Perng, C.L., Hsu, C.H., Wong, L.J., 2004. Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease. Ann. NY Acad. Sci. 1011, 304–309. Dimmock, D.P., Zhang, Q., Dionisi-Vici, C., Carrozzo, R., Shieh, J., Tang, L.Y., Truong, C., Schmitt, E., Sifry-Platt, M., Lucioli, S., Santorelli, F.M., Ficicioglu, C.H., Rodriguez, M., Wierenga, K., Enns, G.M., Longo, N., Lipson, M.H., Vallance, H., Craigen, W.J., Scaglia, F., Wong, L.J., 2008. Clinical and molecular features of mitochondrial DNA depletion due to mutations in deoxyguanosine kinase. Hum. Mutat. 29, 330–331. Freisinger, P., Futterer, N., Lankes, E., Gempel, K., Berger, T.M., Spalinger, J., Hoerbe, A., Schwantes, C., Lindner, M., Santer, R., Burdelski, M., Schaefer, H., Setzer, B., Walker, U.A., Horvath, R., 2006. Hepatocerebral mitochondrial DNA depletion syndrome caused by deoxyguanosine kinase (DGUOK) mutations. Arch. Neurol. 63, 1129–1134. Johansson, K., Ramaswamy, S., Ljungcrantz, C., Knecht, W., Piskur, J., MunchPetersen, B., Eriksson, S., Eklund, H., 2001. Structural basis for substrate specificities of cellular deoxyribonucleoside kinases. Nat. Struct. Biol. 8, 616– 620. Labarthe, F., Dobbelaere, D., Devisme, L., De Muret, A., Jardel, C., Taanman, J.W., Gottrand, F., Lombes, A., 2005. Clinical, biochemical and morphological features of hepatocerebral syndrome with mitochondrial DNA depletion due to deoxyguanosine kinase deficiency. J. Hepatol. 43, 333–341. Lee, N.C., Dimmock, D., Hwu, W.L., Tang, L.Y., Huang, W.C., Chinault, A.C., Wong, L.J., 2009. Simultaneous detection of mitochondrial DNA depletion and single-exon deletion in the deoxyguanosine gene using array-based comparative genomic hybridisation. Arch. Dis. Child. 94, 55–58. Mancuso, M., Filosto, M., Tsujino, S., Lamperti, C., Shanske, S., Coquet, M., Desnuelle, C., DiMauro, S., 2003. Muscle glycogenosis and mitochondrial hepatopathy in an infant with mutations in both the myophosphorylase and deoxyguanosine kinase genes. Arch. Neurol. 60, 1445–1447.
J.Q. Ji et al. / Mitochondrion 10 (2010) 188–191 Mancuso, M., Ferraris, S., Pancrudo, J., Feigenbaum, A., Raiman, J., Christodoulou, J., Thorburn, D.R., DiMauro, S., 2005. New DGK gene mutations in the hepatocerebral form of mitochondrial DNA depletion syndrome. Arch. Neurol. 62, 745–747. Mandel, H., Szargel, R., Labay, V., Elpeleg, O., Saada, A., Shalata, A., Anbinder, Y., Berkowitz, D., Hartman, C., Barak, M., Eriksson, S., Cohen, N., 2001. The deoxyguanosine kinase gene is mutated in individuals with depleted hepatocerebral mitochondrial DNA. Nat. Genet. 29, 337–341. Mousson de Camaret, B., Taanman, J.W., Padet, S., Chassagne, M., Mayencon, M., Clerc-Renaud, P., Mandon, G., Zabot, M.T., Lachaux, A., Bozon, D., 2007. Kinetic properties of mutant deoxyguanosine kinase in a case of reversible hepatic mtDNA depletion. Biochem. J. 402, 377–385. Rabinowitz, S.S., Gelfond, D., Chen, C.K., Gloster, E.S., Whitington, P.F., Sacconi, S., Salviati, L., DiMauro, S., 2004. Hepatocerebral mitochondrial DNA depletion syndrome: clinical and morphologic features of a nuclear gene mutation. J. Pediatr. Gastroenterol. Nutr. 38, 216–220. Rahman, S., Poulton, J., 2009. Diagnosis of mitochondrial DNA depletion syndromes. Arch. Dis. Child 94, 3–5. Saada, A.B., Terespolski, Y., Adoni, A., Kahane, I., 1991. Adherence of ureaplasma urealyticum to human erythrocytes. Infect. Immun. 59, 467–469. Saada, A., Shaag, A., Mandel, H., Nevo, Y., Eriksson, S., Elpeleg, O., 2001. Mutant mitochondrial thymidine kinase in mitochondrial DNA depletion myopathy. Nat. Genet. 29, 342–344. Salviati, L., Sacconi, S., Mancuso, M., Otaegui, D., Camano, P., Marina, A., Rabinowitz, S., Shiffman, R., Thompson, K., Wilson, C.M., Feigenbaum, A., Naini, A.B., Hirano, M., Bonilla, E., DiMauro, S., Vu, T.H., 2002. Mitochondrial DNA depletion and dGK gene mutations. Ann. Neurol. 52, 311–317. Sarzi, E., Bourdon, A., Chretien, D., Zarhrate, M., Corcos, J., Slama, A., Cormier-Daire, V., de Lonlay, P., Munnich, A., Rotig, A., 2007. Mitochondrial DNA depletion is a
191
prevalent cause of multiple respiratory chain deficiency in childhood. J. Pediatr. 150, 531–534. 534 e531–536. Slama, A., Giurgea, I., Debrey, D., Bridoux, D., de Lonlay, P., Levy, P., Chretien, D., Brivet, M., Legrand, A., Rustin, P., Munnich, A., Rotig, A., 2005. Deoxyguanosine kinase mutations and combined deficiencies of the mitochondrial respiratory chain in patients with hepatic involvement. Mol. Genet. Metab. 86, 462–465. Taanman, J.W., Kateeb, I., Muntau, A.C., Jaksch, M., Cohen, N., Mandel, H., 2002. A novel mutation in the deoxyguanosine kinase gene causing depletion of mitochondrial DNA. Ann. Neurol. 52, 237–239. Tadiboyina, V.T., Rupar, A., Atkison, P., Feigenbaum, A., Kronick, J., Wang, J., Hegele, R.A., 2005. Novel mutation in DGUOK in hepatocerebral mitochondrial DNA depletion syndrome associated with cystathioninuria. Am. J. Med. Genet. A 135, 289–291. Vreeswijk, M.P., Kraan, J.N., van der Klift, H.M., Vink, G.R., Cornelisse, C.J., Wijnen, J.T., Bakker, E., van Asperen, C.J., Devilee, P., 2009. Intronic variants in BRCA1 and BRCA2 that affect RNA splicing can be reliably selected by splice-site prediction programs. Hum. Mutat. 30, 107–114. Wang, L., Limongelli, A., Vila, M.R., Carrara, F., Zeviani, M., Eriksson, S., 2005. Molecular insight into mitochondrial DNA depletion syndrome in two patients with novel mutations in the deoxyguanosine kinase and thymidine kinase 2 genes. Mol. Genet. Metab. 84, 75–82. Wong, L.J., Brunetti-Pierri, N., Zhang, Q., Yazigi, N., Bove, K.E., Dahms, B.B., Puchowicz, M.A., Gonzalez-Gomez, I., Schmitt, E.S., Truong, C.K., Hoppel, C.L., Chou, P.C., Wang, J., Baldwin, E.E., Adams, D., Leslie, N., Boles, R.G., Kerr, D.S., Craigen, W.J., 2007. Mutations in the MPV17 gene are responsible for rapidly progressive liver failure in infancy. Hepatology 46, 1218–1227. Zhang, M.Q., 1998. Statistical features of human exons and their flanking regions. Hum. Mol. Genet. 7, 919–932.