A novel CRYAB mutation resulting in multisystemic disease

Available online at www.sciencedirect.com

Neuromuscular Disorders 22 (2012) 66–72 www.elsevier.com/locate/nmd

A novel CRYAB mutation resulting in multisystemic disease Sabrina Sacconi a,⇑, Le´onard Fe´asson b, Jean Christophe Antoine c, Christophe Pe´cheux d, Rafaelle Bernard d, Ana Maria Cobo e, Alberto Casarin f, Leonardo Salviati f, Claude Desnuelle a, Andoni Urtizberea e b

a Centre de Re´fe´rence des Maladies Neuromusculaires, Nice Hospital and UMR CNRS6543, Nice University, Nice, France Centre de Re´fe´rence des Maladies Neuromusculaires Rhoˆne-Alpes, Unit of Myology, CHU of St. Etienne and Exercise Physiology Laboratory – EA4338, St. Etienne, France c Centre de Re´fe´rence des Maladies Neuromusculaires Rhoˆne-Alpes, Department of Neurology, CHU of St. Etienne, France d Laboratoire de Ge´ne´tique Mole´culaire-De´partement de Ge´ne´tique Me´dicale – Hoˆpital d’Enfants de la Timone, Marseille, France e Centre de Re´fe´rence Neuromusculaire GNMH, Hoˆpital Marin, AP-HP, Hendaye, France f University of Padova, Department of Pediatrics, Clinical Genetics Unit, Italy

Received 22 February 2011; received in revised form 30 June 2011; accepted 7 July 2011

Abstract Mutations in the CRYAB gene, encoding alpha-B crystallin, cause distinct clinical phenotypes including isolated posterior polar cataract, myofibrillar myopathy, cardiomyopathy, or a multisystemic disorder combining all these features. Genotype/phenotype correlations are still unclear. To date, multisystemic involvement has been reported only in kindred harboring the R120G substitution. We report a novel CRYAB mutation, D109H, associated with posterior polar cataract, myofibrillar myopathy and cardiomyopathy in a two-generation family with five affected individuals. Age of onset, clinical presentation, and muscle abnormalities were very similar to those described in the R120G family. Alpha-B crystallin may form dimers and acts as a chaperone for a number of proteins. It has been suggested that the phenotypic diversity could be related to the various interactions between target proteins of individual mutant residues. Molecular modeling indicates that residues D109 and R120 interact with each other during dimerization of alpha-B crystallin; interestingly, the two substitutions affecting these residues (D109H and R120G) are associated with the same clinical phenotype, thus suggesting a similar pathogenic mechanism. We propose that impairment of alpha-B crystallin dimerization may also be relevant to the pathogenesis of these disorders. Ó 2011 Elsevier B.V. All rights reserved. Keywords: Myofibrillar myopathy; Multisystemic involvement; Alpha-B-crystallin; CRYAB

1. Introduction Myofibrillar myopathies are a clinically and genetically heterogeneous group of disorders affecting mainly skeletal muscle, and characterized by a common pathological ⇑ Corresponding author. Address: Centre de Re´fe´rence des Maladies Neuromusculaires, Archet1 Hospital, 151 Route de Saint Antoine de Ginestie`re, BP3079, 06202 Nice, France. Tel.: +33 492 035757; fax: +33 492 035891. E-mail address: [email protected] (S. Sacconi).

0960-8966/$ - see front matter Ó 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.nmd.2011.07.004

pattern which includes dissolution of myofibrils, aggregation of degraded myofibrillar products, and ectopic expression of proteins. They can also display remarkably different clinical manifestations and extra-muscular involvement [1]. They are caused by mutations in different genes (DES, CRYAB, ZASP, FLNC, BAG3, and MYOT) with both autosomal dominant and autosomal recessive mode of inheritance. The CRYAB gene (MIM #123590) is composed of three exons and encodes for alpha-B crystallin, a small 175 amino acid protein, with a molecular weight of approximately

S. Sacconi et al. / Neuromuscular Disorders 22 (2012) 66–72

27 kDa, belonging to the small heat shock proteins family [2]. The alpha-B crystallin protein is composed of three domains: a N-terminal tail, the alpha-B crystallin domain (ACD) and a C-terminal extension [3]. Its expression was initially demonstrated in the lens, but this protein is highly expressed also in skeletal and cardiac muscle, where it functions as a chaperone for desmin and actin [4,5]. Alpha-B crystallin contributes to maintain integrity of the cytoskeleton, and plays an important role in several other cellular processes, such as compartment targeting and degradation of proteins (among which MyoD) [6,7]. The cytoprotective function of alpha-B crystallin, may also involve binding to specific components of the apoptosis and autophagy pathways. In fact it was recently demonstrated to be a target of p53 [8]. Since the first description in 1998 of a family with multisystemic involvement associated with a CRYAB mutation (R120G) [9], other 13 mutations have been described in association to a variety of non-syndromic clinical phenotypes including isolated posterior polar cataract, cardiomyopathy, or myofibrillar myopathy [9–21]. Here we report the second family with a CRYAB mutation presenting with a multisystemic clinical presentation sharing similar characteristics to that of the original report. 2. Patients and methods We report a family of North-African origin with five individuals presenting a multisystemic syndrome characterized by myofibrillar myopathy, posterior polar cataracts and cardiomyopathy (Fig. 1). Table 1 summarizes the clinical phenotype of the four examined patients. Information on patient I,1 was deduced from his medical records. Mean age of onset was 40 years (range 35–45). All patients presented distal lower leg weakness, dysphagia, and dysphonia as first complaints. Posterior polar cataracts were detected in the four patients who underwent a comprehensive ophthalmologic evaluation. This finding was crucial to address the diagnosis.

67

Respiratory muscles involvement was never present at the time of the diagnosis but became evident in patients II,2 and II,3, II,8 and II,9 during the follow up. Patients II,2 and II,8 are asymptomatic and with normal blood gas analysis, while patients II,3 and II,9 displayed dyspnea and are on non-invasive ventilation. Two patients (I,1, II,3) had echocardiographic evidence of heart involvement consisting in dilated cardiomyopathy. Molecular analysis of the DES, ZASP, FLNC, BAG3, and MYOT genes was negative. 2.1. Muscle studies Muscle studies were conducted on samples from patient II,3 and II,9. For morphological studies, muscle fragments were immediately frozen after biopsy and processed using standard techniques according to previously described procedures [22]. 10 lm thick cryosections were used. The following morphological features were assessed: internalization of nuclei, fiber splitting, presence of vacuoles and of rimmed vacuoles, fiber necrosis and regeneration, core-like lesions, “rubbed out” fibers, COX-negative fibers, and endomysial collagen. Immunohistochemical studies were conducted on 8 lm thick serial cryosections using antibodies directed against desmin (mouse, Dako, 1/1000), alpha-B crystallin (rabbit, Novocastra, 1/50), Myotilin (mouse, Novocastra, 1/50), dystrophin (mouse, Novocastra, 1/50), and caveolin-3 (mouse, BD Biosciences, 1/500). For electron microscopy, muscle specimens were fixed at rest length and processed for electron microscopy by standard methods [23]. 2.2. Molecular investigations DNA was isolated from patient blood using standard procedures. The three exons of the CRYAB gene were amplified with primers 1F cctgacatcaccattccaga; 1R aggcagggtaggaaaggaaa; 2F tgcagaataagacagcacctg; 2R gcctccaaagctgatagcac; 3F ctgagttctgggcaggtgat; 3R taatttgggcctgcccttag using Roche Taq DNA polymerase. PCR conditions were 94 °C for 3 min followed by 35 cycles of 94 °C 30 s, 55 °C for 30 s, 72 °C for 30 s and a final extension step of 72 °C for 7 min. PCR fragments were sequenced using the ABI-Prism Dye Terminator Ready Reaction Kit and a 310 Automatic Sequencer (Applied Biosystem) as reported elsewhere [24]. 2.3. Molecular modeling and bioinformatics analyses

Fig. 1. Pedigree of the family.

Molecular images were generated as reported previously [25,26], using the reported structure of the human alpha-B crystallin protein (Protein Data Bank codes 2WJ7 and 3L1G). The potential pathogenicity of the mutation was analyzed using different prediction software: Pmut [27], MutPred [28], SNAP [29] and PhD-SNP [30].

68

S. Sacconi et al. / Neuromuscular Disorders 22 (2012) 66–72

Table 1 Clinical features of CRYAB patients.

Sex Age (years) Age of onset Disease duration Cataracts (age of onset) Facial weakness Dysphagia Dysphonia Arm weakness Legs weakness Proximal Distal Respiratory failure Cardiomyopathy EMG CK (U/L)

Patient I,1

Patient II,2

Patient II,3

Patient II,8

Patient II,9

M (Deceased at 65) 45 20 YES (47 years) NO YES YES NK

M 57 43 14 YES (51 years) YES YES YES NON

M 56 37 19 YES (48 years) YES YES YES YES (D)

M 46 35 11 YES (41 years) NO YES YES YES (D)

F 45 40 5 NO NO YES YES

NON YES (NT) NT YES (EF:NT) NT NT

NON YES (A, P) YES (FVC: 61%) NO Myopathic NT

YES (A) YES (A, P) YES (FVC: 51%) YES (EF: 38%) Myopathic 905

YES (A) YES (A) YES (FVC: 70%) NO NT NT

NON YES (A) YES (FVC: 60%) NO Myopathic 280

M: male; F: female; NT: Not tested; D: Distal; A: Anterior; P: Posterior; FVC: Forced vital capacity; EF: Ejection fraction.

3. Results 3.1. Muscle studies Morphological studies showed in Vastus lateralis muscle of patient II,3 an important variation of muscle fibers diameter ranging from 40 to 80 lm. The ATPase reaction showed atrophic fibers of both histochemical types. There was an increased number of internalized nuclei and fiber splitting. Few rimmed vacuoles were evident. Core-like lesions and “rubbed out fibers”, observed on NADH staining, were also frequent. Some of the “rubbed out fibers” contained aggregates visible in HE staining. Immunohistochemical studies showed diffuse or localized enhanced staining with antibodies directed against desmin, alpha-B crystallin and myotilin in both type 1 and type 2 fibers. Electron microscopy showed abnormally expanded electrondense granulofilamentous material of Z-disk density emanating from and replacing Z-disk intermingled with pleiomorphic dappled dense bodies. In some areas the abnormal material surrounded irregularly oriented bundles of thick filaments forming the previously described “sandwich” formations [31]. Rubbed out fibers and “sandwich” formations are typically seen in desminopathy and in alpha-B crystallinopathies. Morphological studies of muscle biopsy from Tibialis anterior of patient II,9 also showed degenerative alterations as important fiber size variation, internally located myonuclei (about 10% of fibers), fiber splitting but few necrosis. In addition, sarcoplasmic protein aggregates, rimmed and non-rimmed vacuoles were observed in HE stains and more especially in modified Gomori trichrome stains. These aggregates and patch-like lesions were immunoreactive for desmin, alpha-B crystallin and myotilin. Rubbed out fibers and COX-negative fibers were frequent. Other immunostaining signs were the labeling of membranous structures within muscle fibers with caveolin-3 and dystrophin

antibodies. At the electron microscopic level, this specimen showed granulofilamentous material accumulated beneath the sarcolemma and between the myofibrils. Z-band streaming and two cytoplasmic bodies were also noted. 3.2. Molecular investigations The suggestive clinical picture combining in most affected members, posterior polar cataracts, and the typical myofibrillar myopathy, oriented the diagnosis towards an alpha-b crystallinopathy. We therefore analyzed the CRYAB gene and detected a heterozygous c.325 G > C (D109H) (Fig. 2A). All affected individuals harbored the mutation, which was absent in two asymptomatic family members and in 50 ethnically matched controls. Four distinct programs (Pmut, MutPred, SNAP, and PhD-SNP) predicted that this is a pathogenic variant, with scores ranging from 70% to 82%. 3.3. Molecular modeling The D109H substitution affects an aspartate residue located on the surface of the molecule, that is conserved in all vertebrates species analyzed (Fig. 2B). Codon 109 is located in exon 3 of the gene and encodes an amino acid involved in the dimerization of the protein. In fact aspartate 109 interacts with arginine 120 on the opposite alpha-B crystallin monomer (Fig. 2D). Interestingly arginine 120 was also found mutated in the another family with a similar phenotype characterized by myofibrillar myopathy, cardiomyopathy, and cataracts [9]. Both these residues are located on the ACD while all other dominant exon 3 mutations affect residues located outside the ACD, within the C-terminal extension (Fig. 2C and E) which is mostly involved in the chaperone function. The only exception is the D140 N substitution. However, even though aspartate 140 is located in the ACD, it is not directly involved in interaction among

S. Sacconi et al. / Neuromuscular Disorders 22 (2012) 66–72

69

Fig. 2. CRYAB mutations: (A) Sequence of the PCR fragment encompassing CRYAB exon 3. The arrow indicates the mutation. (B) Alignment of alpha-B crystallin polypeptides of different vertebrate species. The arrow indicates the mutated aspartate in position 109. (C) Position of the different mutations within the CRYAB gene and related phenotypes. In italics are frameshift or truncating mutations. Note that the G154S mutation may be associated either to isolated cardiomyopathy or to myopathy. (D) Three-dimensional structure of the alpha-B crystallin dimer showing the interaction between aspartate 109 and arginine 120 on the opposite monomer. (E) Structure of alpha-B crystallin including the C-terminal extension with residues 154 and 157 mutated in patients with myopathy or cardiomyopathy, without cataracts. (F) Aspartate 140 is located in the central domain of the alpha-B crystallin protein but is not involved in dimerization. (G) Structure of the alpha-B crystallin ACD when aspartate 140 is substituted with asparagine. In blue the nitrogen atoms, in red the oxygen. The abnormal NH2 group alters the surface charge of the protein but does not affect interaction of the ACD monomers.

different alpha-B crystallin monomers (Fig. 2F). Its substitution with asparagine (Fig. 2G) alters the surface charge of the protein (a negative residue is replaced by a neutral one) but does not affect the interaction of the two ACD. Moreover, the larger steric hindrance of the asparagines residue does not alter the structure of the affected ACD since the terminal nitrogen atom of the side chain is facing the solvent.

4. Discussion Mutations in the CRYAB gene are relatively rare, and although discovered in 1998, only 13 mutations have been reported to date. They cause markedly different clinical features (Table 2): isolated cataracts are the most common presentation (six families), but they can also be associated with cardiomyopathy or myofibrillar myopathy. In one

70

S. Sacconi et al. / Neuromuscular Disorders 22 (2012) 66–72

Table 2 Clinical features associated with already reported CRYAB mutations. Report

Mutation

Inheritance

Cataracts

Distal myopathy

Muscle stiffness

Cardiomyopathy

Respiratory failure

Dysphonia/ dysarthria

Vicart et al. 1998 [9] Berry et al. 2001 [10] Selcen et al. 2003 [11] Selcen et al. 2003 [11] Liu et al. 2006a [12] Liu et al. 2006b [13] Pilotto et al. 2006 [14] Inagaki et al. 2006 [15] Devi et al. 2008 [16] Safieh et al. 2009 [17] Chen et al. 2009 [18] Reilich et al. 2010 [19] Del Bigio et al. 2011 [20] Forrest et al. 2011 [21] This report

R120G

AD

Y

Y

N

Y

N

Y

K150fs_184X

AD

Y

N

N

N

N

N

L155fs_163X

AD

N

Y

N

N

Y

Y

R151X

AD

N

Y

N

N

N

N

P20S

AD

Y

N

N

N

N

N

D140N

AD

Y

N

N

N

N

N

G154S

AD

N

Subclinical

N

Y

N

N

R157H

AD

N

N

N

Y

N

N

A171T

AD

Y

N

N

N

N

N

R56W

AR

Y

N

N

N

N

N

R11H

AD

Y

N

N

N

N

N

G154S

AD

N

Y

N

N

N

Y

S21Afs24X

AR

N

N

Y

N

Y

N

S115fs129X

AR

N

N

Y

N

Y

N

D109H

AD

Y

Y

N

N

Y

Y

AD = Autosomal dominant; AR = Autosomal recessive; Y = Yes; N = No.

family these features were combined to form a complex phenotype similar to what we observed in our family. In a further family affected individuals presented either cardiomyopathy or myopathy [19]. Two novel truncating CRYAB mutation have been associated with an autosomal recessive fatal hypertonic muscular dystrophy characterized by progressive limb and axial muscle stiffness, severe respiratory insufficiency and death in infancy [20,21]. Myopathy was the initial presentation in all our patients. They presented with distal weakness, dysphonia and dysphagia, the classical symptoms present in all CRYAB patients with skeletal muscle involvement. Respiratory muscle involvement was present in all the patients at different extent but no data is available for their father regarding this issue. We also report two symptoms which were not described previously in individuals with CRYAB mutations: patient II,2 had facial weakness, while patient II,3 developed bilateral ptosis. Cataracts were detected in four out the five patients. Cardiomyopathy was detected in the two patients with the longest disease duration (I,1 and II,3). In addition to moderate dystrophic features, subsarcolemmal and sarcoplasmic protein aggregates, few cytoplasmic bodies, rimmed and non-rimmed vacuoles, “rubbed-out fibers” and core-like lesions were observed in the muscle of

these two specimens (data not shown). As previously described, these light and electron microscopic changes are the classical myopathological findings observed in muscle biopsies of CRYAB patients [32,33]. According to four different prediction programs the D109H mutation identified in our family is likely to be the disease causing; moreover, it was absent in controls, it segregates with the phenotype in the family, and it substitutes a conserved acidic aspartate residue with histidine, a basic amino acid. Interestingly, aspartate 109 interacts with arginine 120 which was also associated to alpha-B crystallinopathy with a similar phenotype when mutated [9]. These findings underscore the marked clinical diversity of CRYAB mutations that probably reflects the different functional roles of alpha-B crystallin. However the precise correlation between the CRYAB genotype and the clinical picture of the patients is still incompletely understood. Missense, truncating, and frameshift mutations have been reported (Table 2 and Fig. 2D) and there are apparently no recurrent mutations. Experimental data seem to indicate that in autosomal dominant forms the pathogenic mechanism involves a dominant-negative effect of the mutant polypeptides. In a transgenic mouse model expressing the R120G allele severity of symptoms was related with expression levels of the transgene [5]. However, three

S. Sacconi et al. / Neuromuscular Disorders 22 (2012) 66–72

mutations (R56W, S115fs129X, and S21Afs24X), associated with isolated cataracts [17] or with early onset myopathy [20,21], displayed autosomal recessive inheritance, and heterozygous carriers were asymptomatic. While the mechanism of the mutation associated with cataracts is not clear, it is likely the two truncating mutations cause a classical “loss of function” of the gene product, considering also that ablation of CRYAB in the heart of mice causes increased stiffness of the myocardium [34]. The phenotypic diversity of dominant CRYAB alleles has been related to the different interactions between target proteins with individual mutant residues [35,36]. In fact, despite a certain degree of intrafamiliar variability in the clinical picture, the phenotypes tend to be homogeneous within families. One exception is the G154S mutation, which has been described in three patients from two unrelated families. In one case, it was associated with cardiomyopathy [14] and subclinical myopathy, and in two other individuals from a different family it presented either with isolated myopathy or with isolated cardiomyopathy [19]. It should be noted, however, that many reported patients with tissue-specific involvement are isolated cases, with a relatively short follow up. It is possible that other features may become more evident with time. For example the subclinical muscle involvement reported in the patient with cardiomyopathy and the G154S mutation may evolve to an overt myopathy with time. Similarly, subjects presenting with isolated myopathy may develop cardiomyopathy (or cataracts) later in the course of the disease (as it was the case in two of our patients). The same holds true for cataracts in these patients. There is only a partial correlation between the site (and the type) of autosomal dominant mutations and the phenotype. The three reported mutations in exon 1 are all missense substitutions, and are associated with isolated cataracts. No mutations have been described in exon 2, while mutations in exon 3 may be associated with any of the above mentioned phenotypes. Among exon 3 mutations, the two residues affected by mutations causing the multisystem disorder (D109 and R120) are located within the ACD and interact during dimerization of the alpha-B crystallin protein. The R120G substitution has been shown to alter the dynamics of alpha-B crystallin assembly [3] and D109H is predicted to have similar effects. It is intriguing to speculate that impairment of alpha-B crystallin dimerization may be relevant to the pathogenesis of the multisystemic phenotype. Analysis of the three-dimensional structure of the protein revealed that the only other mutation affecting the ACD associated with a different phenotype, isolated cataracts, affects a residue not involved in dimerization of the protein, suggesting a different pathogenic mechanism for this substitution. Further studies should be aimed at elucidating the different physical and biological proprieties of individual mutant alleles associated with distinct clinical phenotypes in order to gain novel insights on the pathogenesis of these disorders, and to develop targeted therapeutic interventions.

71

Acknowledgment Dr. Salviati is supported by a Grant from Fondazione CARIPARO, Padova. References [1] Selcen D. Myofibrillar myopathies. Current Opinion in Neurology 2008;21:585–9. [2] Iwaki T, Kume-Iwaki A, Liem RK, Goldman JE. Alpha-B crystallin is expressed in non-lenticular tissues and accumulates in Alexander’s disease brain. Cell 1989;57:71–8. [3] Bagneris C, Bateman OA, Naylor CE, et al. Crystal structures of alpha-crystallin domain dimers of alpha-B crystallin and Hsp20. Journal of Molecular Biology 2009;392:1242–52. [4] Wang X, Klevitsky R, Huang W, Glasford J, Li F, Robbins J. AlphaB crystallin modulates protein aggregation of abnormal desmin. Circulation Research 2003;93:998–1005. [5] Wang X, Osinska H, Klevitsky R, et al. Expression of R120G-alpha-B crystallin causes aberrant desmin and alpha-B crystallin aggregation and cardiomyopathy in mice. Circulation Research 2001;89:84–91. [6] Goldfarb LG, Dalakas MC. Tragedy in a heartbeat: malfunctioning desmin causes skeletal and cardiac muscle disease. Journal of Clinical Investigation 2009;119:1806–13. [7] Singh BN, Rao KS, Rao Ch M. Ubiquitin-proteasome-mediated degradation and synthesis of MyoD is modulated by alpha-B crystallin, a small heat shock protein, during muscle differentiation. Biochimica et Biophysica Acta 2010;1803:288–99. [8] Watanabe G, Kato S, Nakata H, Ishida T, Ohuchi N, Ishioka C. Alpha-B crystallin: a novel p53-target gene required for p53-dependent apoptosis. Cancer Science 2009;100:2368–75. [9] Vicart P, Caron A, Guicheney P, et al. A missense mutation in the alpha-B crystallin chaperone gene causes a desmin-related myopathy. Nature Genetics 1998;20:92–5. [10] Berry V, Francis P, Reddy MA, et al. Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital posterior polar cataract in humans. American Journal of Human Genetics 2001;69:1141–5. [11] Selcen D, Engel AG. Myofibrillar myopathy caused by novel dominant negative alpha-B crystallin mutations. Annals of Neurology 2003;54:804–10. [12] Liu M, Ke T, Wang Z, et al. Identification of a CRYAB mutation associated with autosomal dominant posterior polar cataract in a Chinese family. Investigative Ophthalmology and Visual Science 2006;47:3461–6. [13] Liu Y, Zhang X, Luo L, et al. A novel alpha-B crystallin mutation associated with autosomal dominant congenital lamellar cataract. Investigative Ophthalmology and Visual Science 2006;47:1069–75. [14] Pilotto A, Marziliano N, Pasotti M, Grasso M, Costante AM, Arbustini E. Alpha-B crystallin mutation in dilated cardiomyopathies: low prevalence in a consecutive series of 200 unrelated probands. Biochemical and Biophysical Research Communications 2006;346:1115–7. [15] Inagaki N, Hayashi T, Arimura T, et al. Alpha-B crystallin mutation in dilated cardiomyopathy. Biochemical and Biophysical Research Communications 2006;342:379–86. [16] Devi RR, Yao W, Vijayalakshmi P, Sergeev YV, Sundaresan P, Hejtmancik JF. Crystallin gene mutations in Indian families with inherited pediatric cataract. Molecular Vision 2008;14:1157–70. [17] Safieh LA, Khan AO, Alkuraya FS. Identification of a novel CRYAB mutation associated with autosomal recessive juvenile cataract in a Saudi family. Molecular Vision 2009;15:980–4. [18] Chen Q, Ma J, Yan M, Mothobi ME, Liu Y, Zheng F. A novel mutation in CRYAB associated with autosomal dominant congenital nuclear cataract in a Chinese family. Mol Vis. 2009;15:1359–65. [19] Reilich P, Schoser B, Schramm N, et al. The p. G154S mutation of the Alpha-B crystallin gene (CRYAB) causes late-onset distal myopathy. Neuromuscular Disorders 2010;20:255–9.

72

S. Sacconi et al. / Neuromuscular Disorders 22 (2012) 66–72

[20] Forrest KM, Al-Sarraj S, Sewry C, et al. Infantile onset myofibrillar myopathy due to recessive CRYAB mutations. Neuromuscular Disorders 2011;21:37–40. [21] Del Bigio MR, Chudley AE, Sarnat HB, et al. Infantile muscular dystrophy in Canadian aboriginals is an alpha-B crystallinopathy. Annals of Neurology 2011;69:866–71. [22] Claeys KG, van der Ven PF, Behin A, et al. Differential involvement of sarcomeric proteins in myofibrillar myopathies: a morphological and immunohistochemical study. Acta Neuropathologica 2009;117:293–307. [23] Engel AG. The Muscle Biopsy. 2nd ed. New York: McGraw-Hill; 1994. [24] Karadimas CL, Salviati L, Sacconi S, et al. Mitochondrial myopathy and ophthalmoplegia in a sporadic patient with the G12315A mutation in mitochondrial DNA. Neuromuscular Disorders 2002;12:865–8. [25] Trevisson E, Burlina A, Doimo M, et al. Functional complementation in yeast allows molecular characterization of missense argininosuccinate lyase mutations. Journal of Biological Chemistry 2009;284:28926–34. [26] Trevisson E, Salviati L, Baldoin MC, et al. Argininosuccinate lyase deficiency: mutational spectrum in Italian patients and identification of a novel ASL pseudogene. Human Mutation 2007;28:694–702. [27] Ferrer-Costa C, Gelpi JL, Zamakola L, Parraga I, de la Cruz X, Orozco M. PMUT: a web-based tool for the annotation of pathological mutations on proteins. Bioinformatics 2005;21:3176–8. [28] Li B, Krishnan VG, Mort ME, et al. Automated inference of molecular mechanisms of disease from amino acid substitutions. Bioinformatics 2009;25:2744–50.

[29] Bromberg Y, Rost B. SNAP: predict effect of non-synonymous polymorphisms on function. Nucleic Acids Research 2007;35: 3823–35. [30] Capriotti E, Calabrese R, Casadio R. Predicting the insurgence of human genetic diseases associated to single point protein mutations with support vector machines and evolutionary information. Bioinformatics 2006;22:2729–34. [31] Claeys KG, Fardeau M, Schroder R, et al. Electron microscopy in myofibrillar myopathies reveals clues to the mutated gene. Neuromuscular Disorders 2008;18:656–66. [32] Goldfarb LG, Olive M, Vicart P, Goebel HH. Intermediate filament diseases: desminopathy. Advances in Experimental Medicine and Biology 2008;642:131–64. [33] Schroder R, Schoser B. Myofibrillar myopathies: a clinical and myopathological guide. Brain Pathology 2009;19:483–92. [34] Golenhofen N, Redel A, Wawrousek EF, Drenckhahn D. Ischemiainduced increase of stiffness of alpha-B crystallin/HSPB2-deficient myocardium. Pflugers Archiv. European Journal of Physiology 2006;451:518–25. [35] Zhu Y, Bogomolovas J, Labeit S, Granzier H. Single molecule force spectroscopy of the cardiac titin N2B element: effects of the molecular chaperone alpha-B crystallin with disease-causing mutations. Journal of Biological Chemistry 2009;284:13914–23. [36] Gupta R, Srivastava OP. Identification of interaction sites between human betaA3- and alpha-A/alpha-B crystallins by mammalian two-hybrid and fluorescence resonance energy transfer acceptor photobleaching methods. Journal of Biological Chemistry 2009;284: 18481–92.