- Email: [email protected]
A novel differential expression system for gene modulation in Mycobacteria
Plasmid 61 (2009) 39–46
Contents lists available at ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas
A novel differential expression system for gene modulation in Mycobacteria Xiao-Yong Fan a,b,c, Hui Ma d,e, Jian Guo d, Zhong-Ming Li d, Zhi-Heng Cheng a, Sheng-Qi Guo b, Guo-Ping Zhao a,* a
Department of Microbiology, School of Life Sciences, Fudan University, 220, Handan Road, Shanghai 200433, China Shanghai Institute of Biological Products, Shanghai 200052, China Shanghai Public Health Clinical Center Affiliated to Fudan University, Shanghai 201508, China d Department of Vaccine, Shanghai H&G Biotechnology Inc., Shanghai 201203, China e School of Life Sciences, Soochow University, Suzhou 215006, China b c
a r t i c l e
i n f o
Article history: Received 20 May 2008 Revised 5 August 2008 Available online 25 October 2008 Communicated by Richard Novick Keywords: pfurA Mutant Strong promoter Differential expression Chimeric gene Recombinant BCG (rBCG)
a b s t r a c t Tuberculosis (TB) remains a major global health problem, and successful genetic manipulation of mycobacteria is crucial for developing new approaches to study the mechanism of pathogenesis of Mycobacterium tuberculosis (M.tb) and to combat TB. In this study, a series of M.tb furA gene operator/promoter (pfurA) mutants were generated aiming at optimization of the promoter activities in mycobacterial strains. Measured by the lacZ gene-fusion reporter system, change of the initial codon GTG to the preferred ATG resulted in a double increase of b-galactosidase activity, while a 6-bp substitution in the conserved FurA binding AT-rich region upstream of furA gene led to 4-6 folds increase of the activity. It is significant that combination of both mutations showed about 10 folds of b-galactosidase activity higher than that of the prototype pfurA. Furthermore, all of the furA promoters were expressed continuously in vivo during intracellular growth of Mycobacterium bovis BCG, and were induced early upon infection in macrophages. Employing the series of pfurA-based differential expression vectors, M.tb chimeric antigen Ag856A2 known for its excellent immunogenicity, was shown to be expressed at different levels in the recombinant Mycobacterium smegmatis and BCG strains. These results indicated that this differential expression system is feasible to express any target antigen of interest in a modular fashion for the study of gene regulation in mycobacterial strains, and also for the development of different recombinant BCG vaccine candidates against TB or other infectious diseases, which would be beneficial for elicitation of optimal immune response. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction Tuberculosis (TB) remains a serious health problem in the world. Infection with the causative agent, Mycobacterium tuberculosis (M.tb), is a major clinical burden worldwide with 8 million new cases and approximately 2 million deaths every year (Barnes and Cave, 2003). It has been estimated that 250,000 deaths occurred annually in China, among 6 million active TB patients at present (Fan * Corresponding author. Fax: +86 21 64837495. E-mail addresses: [email protected] (X.-Y. sibs.ac.cn (G.-P. Zhao).
Fan),
gpzhao@
0147-619X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.plasmid.2008.09.002
et al., 2003). The emergence of drug-resistant M.tb strains and the human immunodeficiency virus epidemic have catapulted TB into a global emergency. Therefore, there is an urgent need for TB related basic and applied researches aiming at improvement of diagnosis, treatment and prevention of the disease. The current vaccine against TB, Mycobacterium bovis bacille Calmette-Guérin (BCG), is a live attenuated vaccine that has been widely used since the early 1920s. BCG protects children efficiently against milliary and meningeal TB, but the protective efficiency against adult pulmonary TB ranges from 0% to 80% (Fine, 1989). Despite these unsatisfactory problems of BCG vaccine, its excellent
40
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
immunostimulatory properties and proven safety for human use have led to the concept of recombinant BCG (rBCG)-based vaccines against TB and other infections. It has been reported that various protective candidate antigens could be cloned and expressed in BCG to make the vaccine more potent (Hernandez-Pando et al., 2007). Several studies attempting to improve the efficacy of vaccination against TB, leprosy and Leishmania major infection suggested that different antigens might require different levels of expression to elicit optimal immune response from the host (Rao et al. 2003; Bloom and Fine, 1994; Dhar et al., 2000). During the past two decades, considerable progress had been made to develop systems for molecular genetics study of mycobacteria, yet limitations remain to be overcome. Based on the origin of replication derived from the Mycobacterium fortuitum plasmid pAL5000 (Ranes et al. 1990), several Escherichia coli-mycobacteria shuttle vectors were constructed that enabled the genetic manipulation and expression of genes in mycobacteria (Stover et al., 1991, 1993; DasGupta et al., 1998). Most of these available expression vectors rely on the promoter of the conserved heat shock protein hsp60 gene (Stover et al., 1991, 1993), and thus limits the range of gene expression in these organisms. In addition, there are some doubts about the stability of plasmids carrying phsp60 (Kumar et al., 1998; Haeseleer, 1994; Al-Zarouni and Dale, 2002), various deletions affecting the hsp60 promoter region occurred during or soon after transformation, but not during subsequent growth of the transformants, nor with other promoters, and such deletions were demonstrated to be due to a transient lethal induction of phsp60 associated with electroporation (Al-Zarouni and Dale, 2002). Other promoters used successfully in the early days included those from the Mycobacterium kansasii a antigen (Matsuo et al., 1990), the M.tb 19 kDa antigen (Stover et al., 1993), and the Mycobacterium leprae 18 kDa antigen (Dellagostin et al., 1995), etc. However, lack of sufficient information about the tran-
scriptional regulation mechanisms of mycobacteria has been one of the obstacles for developing versatile expression systems that would permit modulation of gene expression in mycobacteria. For this purpose, pMC210, an E. coli-mycobacteria shuttle promoter probe vector, was constructed to evaluate promoter activities in gene-fusion to the E. coli lacZ reporter. The activities of a set of strong promoters derived from the M.tb furA gene operator/promoter region (pfurAs) were analyzed with the probe vector pMC210, and then used to develop the differential expression vectors, the pMFA series. The M.tb chimeric gene ag856a2, which is a recombinant ag85a gene with 2 copies of esat-6 gene inserted in its Acc I site and showed excellent immunogenicity in the animal experiments we described previously (Li et al., 2006), was constructed into the pMFA vector series and expressed successfully at different levels both in the recombinant Mycobacterium smegmatis and in the rBCG strains. 2. Materials and methods 2.1. Bacterial strains, plasmids and primers The bacterial strains and plasmids used in this study are listed in Table 1. The specific oligonucleotides (Table 2) used for the PCR amplification were synthesized by Shanghai Invitrogen Biotechnology Co., Ltd. 2.2. Culture and growth conditions E. coli DH5a was grown in liquid or solid LB medium. Mycobacterial strains (M. smegmatis mc2155 and M. bovis BCG-Danish) were grown in liquid Middlebrook 7H9 broth or solid Middlebrook 7H11 agar supplemented with 10% OADC enrichment. When required, the antibiotic kanamycin was added at a concentration of 50 or 20 lg/mL for E. coli or mycobacteria, respectively.
Table 1 Bacterial strains and plasmids used in this study Strain and plasmid Strains E. coli DH5a M. smegmatis mc2155 M. bovis BCG-Danish Plasimds pBluesript II KS (+) pMV261 pSV-b-gal HG856A pMC210a pMFA11b pMFA21b pMFA31b pMFA41b a b c
Relevant informationc
Source or reference
F /80dlacZDM15 D(lacZYA-argF) deoR recA1 endA1 hsdR17 phoA supE44 k thi-1 relA1 High-frequency transforming strain Vaccine strain
MBI Fermentas
Cloning vector, Ampr E. coli-mycobacteria shuttle vector, Kanr, pAL5000 origin, phsp60 Control vector with promoterless lacZ, Ampr, SV40 promoter and enhancer DNA vaccine, M.tb chimeric gene ag856a2 inserted in pVAX1 Mycobacterial gene-fused probe vector, Kanr, pAL5000 origin, promoterless lacZ Mycobacterial expression vector, same as pMV261, but phsp60 was replaced by pfurA Same as pMFA11, but pfurAa Same as pMFA11, but pfurAm Same as pMFA11, but pfurAma
MBI Fermentas Stover et al. (1991) Promega Li et al. (2006) This study This study
Novel mycobacterial promoter probe vector, GenBank Accession No. EU682406. Novel mycobacterial differential expression vectors, GenBank Accession Nos. EU682407–EU682410. Ampr, Ampcillin resistance; Kanr, kanamycin-resistance.
Snapper et al. (1990) Shanghai Institute of Biological Products
This study This study This study
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46 Table 2 Oligonucleotides used for construction of plasmids Primers
Sequencea
lacZ0 -F lacZ0 -R pfurA-F pfurA-R1 pfurA-R2
50 -CGCGGATCCGTCGTTTTACAA CGTCGTG-30 50 -CCAAGCTTTCATTATTTTTGACACCAGACCAAC-30 50 -GGTCTAGAGGCGGGCACCGGGACACAC-30 50 -CGCGGATCCGTCCGGTATAGAGGACACACT-30 50 -CGCGGATCCGTCCGGTATAGAGGACACACTAGA CAATATGACTCCCAGGAGAGGAAT C-30 50 -CGCGGATCCGTCCGGTATAGAGGACATACT-30 50 -CGCGGATCCGTCCGGTATAGAGGACATACTAGA CAATATGACTCCCAGGAGAGGAAT C-30 50 -CACTCTAGAGGTGACCACAACGACGCGCC-30 50 -AGTGGATCCCGCAATTGTCTTGGCCATTG-30 50 -ACAGGATCCTTTTCCCGGCCGGGCTTGC-30 50 -TCTGAATTCCTAGGCGCCCTGGGGCGC-30
pfurA-R3 pfurA-R4 phsp60-F phsp60-R 85A-F 85A-R
a Restriction endonucleases sites are underlined, and the mutated bases are in boldface.
2.3. DNA manipulation techniques The isolation and manipulation of recombinant DNA was performed using the standard procedures. All enzymes were available commercially from MBI Fermentas (Hanover, MD). E. coli transformation was performed by the standard protocol (Sambrook and Russell, 2001). M. smegmatis mc2155 and M. bovis BCG-Danish were transformed as described previously (Stover et al., 1993). 2.4. Construction of promoter probe vector pMC210 The truncated E. coli lacZ (lacZ’) gene was PCR amplified from the plasmid pSV-b-gal (Promega, Madison, WI), and the amplified fragment was cloned into pBluescript KS (pKS) to generate pKS-lacZ0 . The plasmid pMV261 was digested with XbaI and HindIII to remove BCG phsp60, and the digested large fragment was then ligated with the same digested lacZ0 fragment from pKS-lacZ0 , the resulting construct was designated pMC210, the lacZ gene-fused promoter probe vector. 2.5. pfurA mutagenesis and construction of the differential expression vectors, pMFA series Complementary oligonucleotides carrying either 6-bp substitutions in the polypurine region or initial codon GTG ? ATG variation were used in combination with the same forward primer to amplify pfurA and its mutants, the resulting fragments were cloned into pKS vector. After verification of the relative mutations by DNA sequencing, the XbaI–BamHI digested pfurAs fragments were cloned into pMC210 to evaluate promoter activities, and then ligated into pMV261 to replace phsp60, which resulted to generate the novel mycobacterial differential expression vectors, pMFA series. 2.6. b-Galactosidase assay in vitro b-Galactosidase activity in vitro was assayed in mycobacteria by the previous method, with some modifications (Miller, 1992). Briefly, the recombinant mycobacterial strains containing the various pfurA-lacZ constructs were
41
grown in complete Middlebrook 7H9 broth until the log phase, the value of OD600 were measured. Ten microliters of cells were added to 990 lL of Z buffer (6 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM bmercaptoethanol) and permeabilized with one drop of 0.1% SDS and two drop of chloroform. The mixtures were vortexed and then incubated for 15 min at room temperature. Two hundred microliters of substrate O-nitrophenylb-D-galactosidase (ONPG, 4 mg/mL in 100 mM KH2PO4, pH 7.0) was added, and the time taken for yellow color development was noted. The reaction was stopped by adding 0.2 mL of 2.5 M Na2CO3. The solutions were centrifuged to remove cell debris, and the optical density at 420 nm was measured. The b-galactosidase activity in modified Miller units was calculated with the following formula: (OD420 1000)/(t v OD600), in which t is the incubation time in minutes, v is the volume of culture used in milliliters, and OD420 or OD600 is the optical density at 420 or 600 nm, respectively. 2.7. Macrophage infection and b-galactosidase assay intracellularly The RAW264.7 mouse macrophage cell line (ATCC TIB71) was plated at 1.0 106 cells per well in 6-well culture plates (Greiner Bio-one, Frickenhausen, Germany) containing DMEM medium (Gibco-BRL, Gaithersburg, MD) supplemented with 10% fetal calf serum (FCS, Sijiqing Biologicals, Hanzhou, China) and penicillin–streptomycin. The macrophages were allowed to adhere for 2 h at 37 °C in 5% CO2 and the nonadjacent cells were washed away with DMEM without antibiotics. The macrophage monolayers were infected with M. bovis BCG or with rBCGs harboring the different pfurA-lacZ fusion at a M.O.I. of 10:1. After 3 h of infection, extracellular bacteria were removed by washing three times with DMEM medium and incubation continued at 37 °C in 5% CO2. At the desired time, the medium was removed and the RAW264.7 cells were resuspended in 1 mL sterile Z buffer. The number of BCG cells in the lysate (CFU/ mL) was estimated in Middlebrook 7H11 plate by the viable counts of serial dilutions, and the b-galactosidase levels were assayed following disruption of the bacteria with SDS and chloroform, as described above. The b-galactosidase activity was expressed as following: (OD420 109)/ (t v CFU/mL). 2.8. Cloning and expression of M.tb chimeric gene in mycobacteria The M.tb chimeric gene ag856a2 was amplified from the plasmid of DNA vaccine HG856A, and the amplified from 1.5 kb fragment was then cloned into the BamHI and EcoRI sites of pMFA series. The resulting construct series were electroporated into M. smegmatis mc2155 and M. bovis BCG-Danish strain, and the recombinant mycobacterial transformants were grown to mid-exponential phase in the complete Middlebrook 7H9 broth. The cells were harvested roughly at the same density, pelleted and resuspended in the same volume of 1 TBS buffer (20 mM Tris, pH 8.0, 150 mM NaCl,), and then sonicated on ice using a probe sonicator. The supernatants of lysates were
42
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Fig. 1. Diagram of gene-fused promoter probe vector pMC210. The 50 truncated E. coli lacZ (lacZ0 ) gene was used as the reporter (A). The multiple cloning sites (MCS) for promoter trapping are shown in detail, and the ninth amino acid residue and termination codon of lacZ gene are marked with Val and STOP, respectively. The BglII and SpeI are marked with a asterisk, as they are not unique (B).
collected, and protein concentrations were estimated by the BCA protein assay kit (Pierce, Rockford, Illinois). Equal amounts of protein were subjected to 12% SDS–PAGE, and then transferred onto the PVDF membrane (Pall-Gelman, Ann Arbor, MI) at 20 V for 30 min using the semi-dry transfer cell (Bio-Rad, Hercules, CA). The blot was blocked with 10% non-fat milk in 1 TBS-T buffer (1 TBS, 0.05% Tween 20) for 1 h, and then incubated with mouse anti-serum to the chimeric protein Ag856A2 (Li et al., 2006) at a dilution of 1:1000 for 1 h. After washing with 1 TBS-T buffer, the blot was incubated with HRP-conjugated goat anti-mouse IgG (Santa Cruz Biotechnology Inc., Santa Cruz, CA) at a dilution of 1:6000 for 45 min. The filter was finally exposed to X-ray film (Eastman Kodak, Rochester, NY) after reaction for 1 min with the chemiluminescent substrate SuperSignal ECL (Pierce). 2.9. Nucleotide sequence Accession Nos. The novel mycobacterial vectors constructed in this study have been deposited in GenBank under Accession Nos. EU682406–EU682410.
Fig. 2. Determination of promoter activities of the M.tb pfurA series in mycobacteria. Mycobacterium smegmatis mc2155 and M. bovis BCGDanish were transformed with recombinant plasmids containing the different pfurAs immediately upstream of the lacZ gene, the BCG phsp60 was used as the positive control, and the b-galactosidase activities were measured in the log phase cultures. All measurements were carried out in duplicates, and data are the averages from three independent isolated recombinants. Error bars represent standard deviations, and the significance of difference between pfurA construct and the other groups was determined by one-way ANOVA. *P < 0.05; **P < 0.01.
3. Results 3.1. Construction of the promoter probe vector pMC210 To construct the promoter probe vector pMC210 for mycobacteria, the promoterless E. coli lacZ gene was chosen as reporter and replaced the BCG phsp60 based on the parent plasmid pMV261 (Stover et al., 1991), thus the M. fortuitum plasmid pAL5000 replicon (Ori M) and the E. coli origin of replication derived from pUC19 (Ori E) were retained to guarantee the vector growing in both mycobacteria and E. coli (Fig. 1A). The Tn903-derived aph gene conferring kanamycin-resistance was used as a selectable marker, and the multi-cloning sites (MCS) from pMV261 and pKS were regulated together (Fig. 1B) to facilitate clon-
ing of various regulator elements immediately upstream of lacZ gene. 3.2. Cloning and evaluation of furA promoter series Direct mutagenesis of the furA operator sequence was performed by the PCR amplification with the mutagenized primers (Table 1). One prototype furA promoter (pfurA) and three different mutants that containing either a 6-bp stretch substitution in the conserved AT-rich sequence (pfurAm), or initial codon GTG ? ATG variation (pfurAa), or both of those (pfurAma), were generated (Fig. 3).
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Fig. 3. Determination of promoter activities of the M.tb pfurAs in RAW264.7. M. bovis BCG-Danish strains transformed with the different pfurAs-lacZ constructs were grown in broth to log phase, and were then used to infect murine macrophage RAW264.7 monolayers at a M.O.I. of approximately 10:1. The b-galactosidase activities were measured at the desired time, and the number of CFU was counted by plating the infectious dose or the macrophages lysates on Middlebrook 7H11 plate at each time point. All measurements were carried out twice, data are averages from the duplicated measurements, and error bars represent standard deviations.
To test the influence of pfurA mutations on the levels of gene expression, all of the fragments were cloned immediately upstream of the promoterless lacZ gene, and the bgalactosidase activities were measured from three isolated recombinants of M. smegmatis mc2155 and M. bovis BCGDanish. The results showed that in both of hosts (Fig. 2),
43
pfurAa resulted in a double increase of the b-galactosidase activity, and roughly 4- to 6-folds increase of the activity by pfurAm. With the combination of both mutations, the b-galactosidase activity increased about 10-fold, which were about twice higher than that of the BCG phsp60, the strong promoter used widely for overexpression of proteins in mycobacteria (Stover et al., 1991, 1993). It is interesting to notice that the pfurA series exhibited higher bgalactosidase activity in the slow-growing M. bovis BCG than in the fast-growing M. smegmatis. To test the expression levels under control of the different furA promoters in vivo, rBCG::lacZ strains transformed with the different pfurAs-lacZ constructs were subsequently infected the murine macrophage RAW264.7 monolayer, the results showed that b-galactosidase activities were upregulated immediately in all of the rBCG::lacZ strains at the early infection, and were then persisted at levels higher than those recorded for rBCG::lacZ before macrophage infection, up to 7 days after infection (Fig. 3). 3.3. Construction of the differential expression vectors, pMFA series As depicted in Fig. 4, the prototype and three mutated pfurAs were used to replace phsp60 of the parent vector pMV261 to generate the differential expression vectors, pMFA series, which allow target genes protein-fused to the first six amino acid residues of FurA, and permit
Fig. 4. Diagram of the mycobacterial differential expression vectors, pMFA series. The expression cassette of pMFA series contains 406-bp of the 50 regulatory region of the M.tb furA gene, including 18-bp encoding for the first six amino acids (in boxes, single-letter aa notation) and 7 unique cloning sites are shown above the plasmid map. The mutated nucleotide of pfurAs are marked with asterisks above the sequence, the 35 and 10 consensus sequences are in boldface, the AT-rich region are in box, and start of transcription was marked with an arrow upstream of initiation codons of pMFA series.
44
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Fig. 5. Western-blotting analysis of the expression of chimeric antigen Ag856A2 in mycobacteria. Equal amounts protein from cell crude extracts of the recombinant M. smegmatis (A) and rBCG (B) transformed with the various pMFA expression vectors were analyzed for expression levels of Ag856A2 by the Western-blotting assay. Lanes 2–5 showed the extracts of recombinant mycobacteria carrying the constructs with pfurA, pfurAm, pfurAa, and pfurAma in the pMFA vectors, respectively. Lane 1 represents the extracts of the host M. smegmatis mc2155 or M. bovis BCG-Danish as negative controls, and lane 6 represents the recombinant mycobacteria carrying the constructs with phsp60 as positive controls.
expression of recombinant protein at different levels under the control of furA promoter series. 3.4. Cloning and expression of M.tb chimeric gene in mycobacteria We previously reported that immunogenicity against M.tb ESAT-6 antigen was improved greatly by the chimeric DNA prime and protein boost strategy (Li et al., 2006). Therefore, the M.tb chimeric gene ag856a2 was chosen as our emphasized target for TB vaccine research. The chimeric gene was amplified from the plasmid of DNA vaccine HG856A and cloned into pMFA vectors, and the expression levels in the recombinant mycobacterial strains were then analyzed by the Western-blotting assay. The results showed that the chimeric antigen Ag856A2 was expressed at varying levels driven by the different furA promoters in the recombinant M. smegmatis and rBCG strains (Fig. 5), pfurAma with double mutations on the initial codon and AT-rich sequence led to the highest level of gene expression, as consistent as observation in the b-galactosidase assay (Figs. 2 and 3).
4. Discussion We constructed a promoter probe vector pMC210 based on the parental plasmid pMV261, which allowed us to evaluate promoter strengths in gene-fusion to the E. coli lacZ reporter. Employing the pMC210 vector, a set of strong promoters (pfurA and its mutants) of M.tb was cloned into the upstream of the promoterless lacZ gene, and their promoter activities in mycobacteria were analyzed by the convenient and sensitive b-galactosidase assay. The M.tb furA gene located immediately upstream of catalase-peroxidase encoding gene katG, is conserved among mycobacteria, and has been demonstrated to be involved in the oxidative stress response together with katG. The presence of an oxidative stress-inducible promoter, pfurA, has been reported previously for M.tb, M. smegmatis, and M. bovis BCG (Zahrt et al., 2001; Sala et al., 2003; Milano et al., 2001). However, pfurA is always repressed
by its own encoded FurA protein under normal growth conditions (Sala et al., 2003). The mutation in polypurine sequence (pfurAm) upstream of furA gene, which is highly conserved in mycobacteria, may prevent the FurA binding and eliminate the repression. This kind of mutation may not reduce the pfurA activity per se, as it exhibited much more luciferase activity than the wild-type promoter when cloned into the upstream of the luxAB reporter (Sala et al., 2003). These were consistent with our observation showing that pfurAm displayed 4- to 6-folds of b-galactosidase activity higher than that of pfurA (Fig. 2). It was well known that when the initial codon GTG is mutated to the preferred ATG, the translation initiation efficiency may increase by 2- to 4-folds (Misra et al., 1996; Martin and Rosner, 2004). This was also observed in our study that the GTG ? ATG variation (pfurAa) led to 2-fold increase of b-galactosidase activity. It is significant that combination of both mutations described above showed the highest b-galactosidase activity, i.e., about 10-folds of b-galactosidase activity higher than that of the prototype pfurA in either M. smegmatis or M. bovis BCG. Since KatG is considered to be important for protection against reactive oxygen and nitrogen intermediates produced by phagocytic cells, and pfurA has been demonstrated to be one of promoters of katG (Master et al., 2001; Zahrt et al., 2001), it is necessary to test the promoter activities of pfurAs intracellularly. We showed that all of the furA promoters were expressed continuously in vivo during intracellular growth of M. bovis BCG, and were induced early upon infection in macrophages. These suggested that pfurA series were seem to be suitable to drive gene expression in mycobacteria and could be used to construct the expression vectors for development of recombinant BCG vaccines. Mutation in the polypurine sequence upstream of the furA gene may abolish its own encoded FurA binding, and thus eliminates the repression on its promoter activity (Sala et al., 2003), while the initial codon GTG ? ATG variation may allow more efficient initiation of translation (Misra et al., 1996; Martin and Rosner, 2004). Therefore, the pfurA series with such mutations, either alone or in combination were expected to exhibit higher promoter
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
activities than the wild-type promoter, and all of the pfurA series were used to construct the differential expression vectors, the pMFA series. Employing such vectors, the chimeric protein Ag856A2 was successfully expressed at various levels both in M. smegmatis and M. bovis BCG under the control of the different furA promoters (Fig. 5), and we also obtain overexpression of M.tb Ag85A, ESAT-6 alone, and CFP-10/ESAT-6 fusion in M. smegmatis by virtue of pMFA vector series (data not shown). These indicated that the pfurAs-based differential expression vector system could make it easy to modulate the expression levels of any target antigen for elicitation of optimal immune response, and the animal experiments immunized with the rBCG strains with the different expression levels of M.tb chimeric antigen are underway to evaluate their anti-TB immune response. Expression of heterologous antigen in recombinant BCG essentially imposes a metabolic burden. The foreign gene expression driven by the phsp60 in BCG is not always feasible. Langermann et al. could only express the truncated N-terminal portion, but not the full-length PspA protein with its natural C-terminal anchor domain, suggesting that expression of the repetitive domain was deleterious to BCG (Langermann et al., 1994). Stover et al. were unable to express HIV-1 gp120 from an episomal vector (Stover et al., 1991), and Bastos et al. could only detect expression of PRRSV G5 protein when 30 N-terminal hydrophobic amino acids were removed (Bastos et al., 2002). Lack of success in these cases may be due to the overexpression lethality or other forms of protein toxicity (Dennehy and Williamson, 2005), and it hinted that the expression from multicopy plasmid vectors was possible if weaker promoters such as pfurA or pfurAa were used. Thus, the availability of the mycobacterial differential expression vector system (such as the pMFA series) will certainly facilitate cloning and expressing any target antigen of interest in a modular fashion for the study of gene regulation in mycobacterial strains, and also for the development of recombinant BCG vaccine candidates against TB or other infectious diseases, which would be beneficial for elicitation of optimal immune response. Acknowledgments We are grateful to Dr. Ying Zhang from Bloomberg School of Public Health, Johns Hopkins University for the provision of plasmid pMV261. We also thank Dr. Hua-Guang Li from Chinese Academic Society for the critical reading of the manuscript. This work was supported partially by The Chinese National ‘‘Eleventh Five” Major Science & Technology Program on Infectious Diseases (grant no.: 2008ZX100 03 011 05). References Al-Zarouni, M., Dale, J.W., 2002. Expression of foreign genes in Mycobacterium bovis BCG strains using different promoters reveals instability of the hsp60 promoter for expression of foreign genes in Mycobacterium bovis BCG strains. Tuberculosis (Edinb) 82, 283–291. Barnes, P.F., Cave, M.D., 2003. Molecular epidemiology of tuberculosis. N. Engl. J. Med. 349, 1149–1156.
45
Bastos, R.G., Dellagostin, O.A., Barletta, R.G., Doster, A.R., Nelson, E., Osorio, F.A., 2002. Construction and immunogenicity of recombinant Mycobacterium bovis BCG expressing GP5 and M protein of porcine reproductive respiratory syndrome virus. Vaccine 21, 21–29. Bloom, B.R., Fine, P.E.M., 1994. BCG and new approaches to vaccines for tuberculosis. In: Bloom, B.R. (Ed.), Tuberculosis: Pathogenesis, Protection and Control. ASM Press, Washington, DC, pp. 531–537. DasGupta, S.K., Jain, S., Kaushal, D., Tyagi, A.K., 1998. Expression systems for study of mycobacterial gene regulation and development of recombinant BCG vaccines. Biochem. Biophys. Res. Commun. 246, 797–804. Dellagostin, O.A., Esposito, G., Eales, L.J., Dale, J.W., McFadden, J., 1995. Activity of mycobacterial promoters during intracellular and extracellular growth. Microbiology 141 (Pt. 8), 1785–1792. Dennehy, M., Williamson, A.L., 2005. Factors influencing the immune response to foreign antigen expressed in recombinant BCG vaccines. Vaccine 23, 1209–1224. Dhar, N., Rao, V., Tyagi, A.K., 2000. Recombinant BCG approach for development of vaccines: cloning and expression of immunodominant antigens of M. Tuberculosis. FEMS Microbiol. Lett. 190, 309–316. Fan, X.Y., Hu, Z.Y., Xu, F.H., Yan, Z.Q., Guo, S.Q., Li, Z.M., 2003. Rapid detection of rpoB gene mutations in rifampin-resistant Mycobacterium tuberculosis isolates in shanghai by using the amplification refractory mutation system. J. Clin. Microbiol. 41, 993–997. Fine, P.E., 1989. The BCG story: lessons from the past and implications for the future. Rev. Infect. Dis. 11 (Suppl. 2), S353–S359. Haeseleer, F., 1994. Structural instability of recombinant plasmids in mycobacteria. Res. Microbiol. 145, 683–687. Hernandez-Pando, R., Castanon, M., Espitia, C., Lopez-Vidal, Y., 2007. Recombinant BCG vaccine candidates. Curr. Mol. Med. 7, 365–372. Kumar, D., Srivastava, B.S., Srivastava, R., 1998. Genetic rearrangements leading to disruption of heterologous gene expression in mycobacteria: an observation with Escherichia coli betagalactosidase in Mycobacterium smegmatis and its implication in vaccine development. Vaccine 16, 1212–1215. Langermann, S., Palaszynski, S.R., Burlein, J.E., Koenig, S., Hanson, M.S., Briles, D.E., Stover, C.K., 1994. Protective humoral response against pneumococcal infection in mice elicited by recombinant bacille Calmette-Guerin vaccines expressing pneumococcal surface protein A. J. Exp. Med. 180, 2277–2286. Li, Z., Song, D., Zhang, H., He, W., Fan, X., Zhang, Y., et al, 2006. Improved humoral immunity against tuberculosis ESAT-6 antigen by chimeric DNA prime and protein boost strategy. DNA Cell Biol. 25, 25–30. Master, S., Zahrt, T.C., Song, J., Deretic, V., 2001. Mapping of Mycobacterium tuberculosis katG promoters and their differential expression in infected macrophages. J. Bacteriol. 183, 4033–4039. Martin, R.G., Rosner, J.L., 2004. Transcriptional and translational regulation of the marRAB multiple antibiotic resistance operon in Escherichia coli. Mol. Microbiol. 53, 183–191. Matsuo, K., Yamaguchi, R., Yamazaki, A., Tasaka, H., Terasaka, K., Totsuka, M., et al, 1990. Establishment of a foreign antigen secretion system in mycobacteria. Infect. Immun. 58, 4049–4054. Milano, A., Forti, F., Sala, C., Riccardi, G., Ghisotti, D., 2001. Transcriptional regulation of furA and katG upon oxidative stress in Mycobacterium smegmatis. J. Bacteriol. 183, 6801–6806. Miller, J.H., 1992. A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Misra, N., Habib, S., Ranjan, A., Hasnain, S.E., Nath, I., 1996. Expression and functional characterisation of the clpC gene of Mycobacterium leprae: ClpC protein elicits human antibody response. Gene 172, 99–104. Ranes, M.G., Rauzier, J., Lagranderie, M., Gheorghiu, M., Gicquel, B., 1990. Functional analysis of pAL5000, a plasmid from Mycobacterium fortuitum: construction of a ‘‘mini” mycobacterium-Escherichia coli shuttle vector. J. Bacteriol. 172, 2793–2797. Rao, V., Dhar, N., Tyagi, A.K., 2003. Modulation of host immune responses by overexpression of immunodominant antigens of Mycobacterium tuberculosis in bacille Calmette-Guerin. Scand. J. Immunol. 58, 449– 461. Sala, C., Forti, F., Di Florio, E., Canneva, F., Milano, A., Riccardi, G., Ghisotti, D., 2003. Mycobacterium tuberculosis FurA autoregulates its own expression. J. Bacteriol. 185, 5357–5362. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
46
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Snapper, S.B., Melton, R.E., Mustafa, S., Kieser, T., Jacobs Jr., W.R., 1990. Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol. Microbiol. 4, 1911– 1919. Stover, C.K., de la Cruz, V.F., Fuerst, T.R., Burlein, J.E., Benson, L.A., Bennett, L.T., et al, 1991. New use of BCG for recombinant vaccines. Nature 351, 456–460.
Stover, C.K., Bansal, G.P., Hanson, M.S., Burlein, J.E., Palaszynski, S.R., Young, J.F., et al, 1993. Protective immunity elicited by recombinant bacille Calmette-Guerin (BCG) expressing outer surface protein A (OspA) lipoprotein: a candidate Lyme disease vaccine. J. Exp. Med. 178, 197–209. Zahrt, T.C., Song, J., Siple, J., Deretic, V., 2001. Mycobacterial FurA is a negative regulator of catalase-peroxidase gene katG. Mol. Microbiol. 39, 1174–1185.
Contents lists available at ScienceDirect
Plasmid journal homepage: www.elsevier.com/locate/yplas
A novel differential expression system for gene modulation in Mycobacteria Xiao-Yong Fan a,b,c, Hui Ma d,e, Jian Guo d, Zhong-Ming Li d, Zhi-Heng Cheng a, Sheng-Qi Guo b, Guo-Ping Zhao a,* a
Department of Microbiology, School of Life Sciences, Fudan University, 220, Handan Road, Shanghai 200433, China Shanghai Institute of Biological Products, Shanghai 200052, China Shanghai Public Health Clinical Center Affiliated to Fudan University, Shanghai 201508, China d Department of Vaccine, Shanghai H&G Biotechnology Inc., Shanghai 201203, China e School of Life Sciences, Soochow University, Suzhou 215006, China b c
a r t i c l e
i n f o
Article history: Received 20 May 2008 Revised 5 August 2008 Available online 25 October 2008 Communicated by Richard Novick Keywords: pfurA Mutant Strong promoter Differential expression Chimeric gene Recombinant BCG (rBCG)
a b s t r a c t Tuberculosis (TB) remains a major global health problem, and successful genetic manipulation of mycobacteria is crucial for developing new approaches to study the mechanism of pathogenesis of Mycobacterium tuberculosis (M.tb) and to combat TB. In this study, a series of M.tb furA gene operator/promoter (pfurA) mutants were generated aiming at optimization of the promoter activities in mycobacterial strains. Measured by the lacZ gene-fusion reporter system, change of the initial codon GTG to the preferred ATG resulted in a double increase of b-galactosidase activity, while a 6-bp substitution in the conserved FurA binding AT-rich region upstream of furA gene led to 4-6 folds increase of the activity. It is significant that combination of both mutations showed about 10 folds of b-galactosidase activity higher than that of the prototype pfurA. Furthermore, all of the furA promoters were expressed continuously in vivo during intracellular growth of Mycobacterium bovis BCG, and were induced early upon infection in macrophages. Employing the series of pfurA-based differential expression vectors, M.tb chimeric antigen Ag856A2 known for its excellent immunogenicity, was shown to be expressed at different levels in the recombinant Mycobacterium smegmatis and BCG strains. These results indicated that this differential expression system is feasible to express any target antigen of interest in a modular fashion for the study of gene regulation in mycobacterial strains, and also for the development of different recombinant BCG vaccine candidates against TB or other infectious diseases, which would be beneficial for elicitation of optimal immune response. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction Tuberculosis (TB) remains a serious health problem in the world. Infection with the causative agent, Mycobacterium tuberculosis (M.tb), is a major clinical burden worldwide with 8 million new cases and approximately 2 million deaths every year (Barnes and Cave, 2003). It has been estimated that 250,000 deaths occurred annually in China, among 6 million active TB patients at present (Fan * Corresponding author. Fax: +86 21 64837495. E-mail addresses: [email protected] (X.-Y. sibs.ac.cn (G.-P. Zhao).
Fan),
gpzhao@
0147-619X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.plasmid.2008.09.002
et al., 2003). The emergence of drug-resistant M.tb strains and the human immunodeficiency virus epidemic have catapulted TB into a global emergency. Therefore, there is an urgent need for TB related basic and applied researches aiming at improvement of diagnosis, treatment and prevention of the disease. The current vaccine against TB, Mycobacterium bovis bacille Calmette-Guérin (BCG), is a live attenuated vaccine that has been widely used since the early 1920s. BCG protects children efficiently against milliary and meningeal TB, but the protective efficiency against adult pulmonary TB ranges from 0% to 80% (Fine, 1989). Despite these unsatisfactory problems of BCG vaccine, its excellent
40
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
immunostimulatory properties and proven safety for human use have led to the concept of recombinant BCG (rBCG)-based vaccines against TB and other infections. It has been reported that various protective candidate antigens could be cloned and expressed in BCG to make the vaccine more potent (Hernandez-Pando et al., 2007). Several studies attempting to improve the efficacy of vaccination against TB, leprosy and Leishmania major infection suggested that different antigens might require different levels of expression to elicit optimal immune response from the host (Rao et al. 2003; Bloom and Fine, 1994; Dhar et al., 2000). During the past two decades, considerable progress had been made to develop systems for molecular genetics study of mycobacteria, yet limitations remain to be overcome. Based on the origin of replication derived from the Mycobacterium fortuitum plasmid pAL5000 (Ranes et al. 1990), several Escherichia coli-mycobacteria shuttle vectors were constructed that enabled the genetic manipulation and expression of genes in mycobacteria (Stover et al., 1991, 1993; DasGupta et al., 1998). Most of these available expression vectors rely on the promoter of the conserved heat shock protein hsp60 gene (Stover et al., 1991, 1993), and thus limits the range of gene expression in these organisms. In addition, there are some doubts about the stability of plasmids carrying phsp60 (Kumar et al., 1998; Haeseleer, 1994; Al-Zarouni and Dale, 2002), various deletions affecting the hsp60 promoter region occurred during or soon after transformation, but not during subsequent growth of the transformants, nor with other promoters, and such deletions were demonstrated to be due to a transient lethal induction of phsp60 associated with electroporation (Al-Zarouni and Dale, 2002). Other promoters used successfully in the early days included those from the Mycobacterium kansasii a antigen (Matsuo et al., 1990), the M.tb 19 kDa antigen (Stover et al., 1993), and the Mycobacterium leprae 18 kDa antigen (Dellagostin et al., 1995), etc. However, lack of sufficient information about the tran-
scriptional regulation mechanisms of mycobacteria has been one of the obstacles for developing versatile expression systems that would permit modulation of gene expression in mycobacteria. For this purpose, pMC210, an E. coli-mycobacteria shuttle promoter probe vector, was constructed to evaluate promoter activities in gene-fusion to the E. coli lacZ reporter. The activities of a set of strong promoters derived from the M.tb furA gene operator/promoter region (pfurAs) were analyzed with the probe vector pMC210, and then used to develop the differential expression vectors, the pMFA series. The M.tb chimeric gene ag856a2, which is a recombinant ag85a gene with 2 copies of esat-6 gene inserted in its Acc I site and showed excellent immunogenicity in the animal experiments we described previously (Li et al., 2006), was constructed into the pMFA vector series and expressed successfully at different levels both in the recombinant Mycobacterium smegmatis and in the rBCG strains. 2. Materials and methods 2.1. Bacterial strains, plasmids and primers The bacterial strains and plasmids used in this study are listed in Table 1. The specific oligonucleotides (Table 2) used for the PCR amplification were synthesized by Shanghai Invitrogen Biotechnology Co., Ltd. 2.2. Culture and growth conditions E. coli DH5a was grown in liquid or solid LB medium. Mycobacterial strains (M. smegmatis mc2155 and M. bovis BCG-Danish) were grown in liquid Middlebrook 7H9 broth or solid Middlebrook 7H11 agar supplemented with 10% OADC enrichment. When required, the antibiotic kanamycin was added at a concentration of 50 or 20 lg/mL for E. coli or mycobacteria, respectively.
Table 1 Bacterial strains and plasmids used in this study Strain and plasmid Strains E. coli DH5a M. smegmatis mc2155 M. bovis BCG-Danish Plasimds pBluesript II KS (+) pMV261 pSV-b-gal HG856A pMC210a pMFA11b pMFA21b pMFA31b pMFA41b a b c
Relevant informationc
Source or reference
F /80dlacZDM15 D(lacZYA-argF) deoR recA1 endA1 hsdR17 phoA supE44 k thi-1 relA1 High-frequency transforming strain Vaccine strain
MBI Fermentas
Cloning vector, Ampr E. coli-mycobacteria shuttle vector, Kanr, pAL5000 origin, phsp60 Control vector with promoterless lacZ, Ampr, SV40 promoter and enhancer DNA vaccine, M.tb chimeric gene ag856a2 inserted in pVAX1 Mycobacterial gene-fused probe vector, Kanr, pAL5000 origin, promoterless lacZ Mycobacterial expression vector, same as pMV261, but phsp60 was replaced by pfurA Same as pMFA11, but pfurAa Same as pMFA11, but pfurAm Same as pMFA11, but pfurAma
MBI Fermentas Stover et al. (1991) Promega Li et al. (2006) This study This study
Novel mycobacterial promoter probe vector, GenBank Accession No. EU682406. Novel mycobacterial differential expression vectors, GenBank Accession Nos. EU682407–EU682410. Ampr, Ampcillin resistance; Kanr, kanamycin-resistance.
Snapper et al. (1990) Shanghai Institute of Biological Products
This study This study This study
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46 Table 2 Oligonucleotides used for construction of plasmids Primers
Sequencea
lacZ0 -F lacZ0 -R pfurA-F pfurA-R1 pfurA-R2
50 -CGCGGATCCGTCGTTTTACAA CGTCGTG-30 50 -CCAAGCTTTCATTATTTTTGACACCAGACCAAC-30 50 -GGTCTAGAGGCGGGCACCGGGACACAC-30 50 -CGCGGATCCGTCCGGTATAGAGGACACACT-30 50 -CGCGGATCCGTCCGGTATAGAGGACACACTAGA CAATATGACTCCCAGGAGAGGAAT C-30 50 -CGCGGATCCGTCCGGTATAGAGGACATACT-30 50 -CGCGGATCCGTCCGGTATAGAGGACATACTAGA CAATATGACTCCCAGGAGAGGAAT C-30 50 -CACTCTAGAGGTGACCACAACGACGCGCC-30 50 -AGTGGATCCCGCAATTGTCTTGGCCATTG-30 50 -ACAGGATCCTTTTCCCGGCCGGGCTTGC-30 50 -TCTGAATTCCTAGGCGCCCTGGGGCGC-30
pfurA-R3 pfurA-R4 phsp60-F phsp60-R 85A-F 85A-R
a Restriction endonucleases sites are underlined, and the mutated bases are in boldface.
2.3. DNA manipulation techniques The isolation and manipulation of recombinant DNA was performed using the standard procedures. All enzymes were available commercially from MBI Fermentas (Hanover, MD). E. coli transformation was performed by the standard protocol (Sambrook and Russell, 2001). M. smegmatis mc2155 and M. bovis BCG-Danish were transformed as described previously (Stover et al., 1993). 2.4. Construction of promoter probe vector pMC210 The truncated E. coli lacZ (lacZ’) gene was PCR amplified from the plasmid pSV-b-gal (Promega, Madison, WI), and the amplified fragment was cloned into pBluescript KS (pKS) to generate pKS-lacZ0 . The plasmid pMV261 was digested with XbaI and HindIII to remove BCG phsp60, and the digested large fragment was then ligated with the same digested lacZ0 fragment from pKS-lacZ0 , the resulting construct was designated pMC210, the lacZ gene-fused promoter probe vector. 2.5. pfurA mutagenesis and construction of the differential expression vectors, pMFA series Complementary oligonucleotides carrying either 6-bp substitutions in the polypurine region or initial codon GTG ? ATG variation were used in combination with the same forward primer to amplify pfurA and its mutants, the resulting fragments were cloned into pKS vector. After verification of the relative mutations by DNA sequencing, the XbaI–BamHI digested pfurAs fragments were cloned into pMC210 to evaluate promoter activities, and then ligated into pMV261 to replace phsp60, which resulted to generate the novel mycobacterial differential expression vectors, pMFA series. 2.6. b-Galactosidase assay in vitro b-Galactosidase activity in vitro was assayed in mycobacteria by the previous method, with some modifications (Miller, 1992). Briefly, the recombinant mycobacterial strains containing the various pfurA-lacZ constructs were
41
grown in complete Middlebrook 7H9 broth until the log phase, the value of OD600 were measured. Ten microliters of cells were added to 990 lL of Z buffer (6 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM bmercaptoethanol) and permeabilized with one drop of 0.1% SDS and two drop of chloroform. The mixtures were vortexed and then incubated for 15 min at room temperature. Two hundred microliters of substrate O-nitrophenylb-D-galactosidase (ONPG, 4 mg/mL in 100 mM KH2PO4, pH 7.0) was added, and the time taken for yellow color development was noted. The reaction was stopped by adding 0.2 mL of 2.5 M Na2CO3. The solutions were centrifuged to remove cell debris, and the optical density at 420 nm was measured. The b-galactosidase activity in modified Miller units was calculated with the following formula: (OD420 1000)/(t v OD600), in which t is the incubation time in minutes, v is the volume of culture used in milliliters, and OD420 or OD600 is the optical density at 420 or 600 nm, respectively. 2.7. Macrophage infection and b-galactosidase assay intracellularly The RAW264.7 mouse macrophage cell line (ATCC TIB71) was plated at 1.0 106 cells per well in 6-well culture plates (Greiner Bio-one, Frickenhausen, Germany) containing DMEM medium (Gibco-BRL, Gaithersburg, MD) supplemented with 10% fetal calf serum (FCS, Sijiqing Biologicals, Hanzhou, China) and penicillin–streptomycin. The macrophages were allowed to adhere for 2 h at 37 °C in 5% CO2 and the nonadjacent cells were washed away with DMEM without antibiotics. The macrophage monolayers were infected with M. bovis BCG or with rBCGs harboring the different pfurA-lacZ fusion at a M.O.I. of 10:1. After 3 h of infection, extracellular bacteria were removed by washing three times with DMEM medium and incubation continued at 37 °C in 5% CO2. At the desired time, the medium was removed and the RAW264.7 cells were resuspended in 1 mL sterile Z buffer. The number of BCG cells in the lysate (CFU/ mL) was estimated in Middlebrook 7H11 plate by the viable counts of serial dilutions, and the b-galactosidase levels were assayed following disruption of the bacteria with SDS and chloroform, as described above. The b-galactosidase activity was expressed as following: (OD420 109)/ (t v CFU/mL). 2.8. Cloning and expression of M.tb chimeric gene in mycobacteria The M.tb chimeric gene ag856a2 was amplified from the plasmid of DNA vaccine HG856A, and the amplified from 1.5 kb fragment was then cloned into the BamHI and EcoRI sites of pMFA series. The resulting construct series were electroporated into M. smegmatis mc2155 and M. bovis BCG-Danish strain, and the recombinant mycobacterial transformants were grown to mid-exponential phase in the complete Middlebrook 7H9 broth. The cells were harvested roughly at the same density, pelleted and resuspended in the same volume of 1 TBS buffer (20 mM Tris, pH 8.0, 150 mM NaCl,), and then sonicated on ice using a probe sonicator. The supernatants of lysates were
42
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Fig. 1. Diagram of gene-fused promoter probe vector pMC210. The 50 truncated E. coli lacZ (lacZ0 ) gene was used as the reporter (A). The multiple cloning sites (MCS) for promoter trapping are shown in detail, and the ninth amino acid residue and termination codon of lacZ gene are marked with Val and STOP, respectively. The BglII and SpeI are marked with a asterisk, as they are not unique (B).
collected, and protein concentrations were estimated by the BCA protein assay kit (Pierce, Rockford, Illinois). Equal amounts of protein were subjected to 12% SDS–PAGE, and then transferred onto the PVDF membrane (Pall-Gelman, Ann Arbor, MI) at 20 V for 30 min using the semi-dry transfer cell (Bio-Rad, Hercules, CA). The blot was blocked with 10% non-fat milk in 1 TBS-T buffer (1 TBS, 0.05% Tween 20) for 1 h, and then incubated with mouse anti-serum to the chimeric protein Ag856A2 (Li et al., 2006) at a dilution of 1:1000 for 1 h. After washing with 1 TBS-T buffer, the blot was incubated with HRP-conjugated goat anti-mouse IgG (Santa Cruz Biotechnology Inc., Santa Cruz, CA) at a dilution of 1:6000 for 45 min. The filter was finally exposed to X-ray film (Eastman Kodak, Rochester, NY) after reaction for 1 min with the chemiluminescent substrate SuperSignal ECL (Pierce). 2.9. Nucleotide sequence Accession Nos. The novel mycobacterial vectors constructed in this study have been deposited in GenBank under Accession Nos. EU682406–EU682410.
Fig. 2. Determination of promoter activities of the M.tb pfurA series in mycobacteria. Mycobacterium smegmatis mc2155 and M. bovis BCGDanish were transformed with recombinant plasmids containing the different pfurAs immediately upstream of the lacZ gene, the BCG phsp60 was used as the positive control, and the b-galactosidase activities were measured in the log phase cultures. All measurements were carried out in duplicates, and data are the averages from three independent isolated recombinants. Error bars represent standard deviations, and the significance of difference between pfurA construct and the other groups was determined by one-way ANOVA. *P < 0.05; **P < 0.01.
3. Results 3.1. Construction of the promoter probe vector pMC210 To construct the promoter probe vector pMC210 for mycobacteria, the promoterless E. coli lacZ gene was chosen as reporter and replaced the BCG phsp60 based on the parent plasmid pMV261 (Stover et al., 1991), thus the M. fortuitum plasmid pAL5000 replicon (Ori M) and the E. coli origin of replication derived from pUC19 (Ori E) were retained to guarantee the vector growing in both mycobacteria and E. coli (Fig. 1A). The Tn903-derived aph gene conferring kanamycin-resistance was used as a selectable marker, and the multi-cloning sites (MCS) from pMV261 and pKS were regulated together (Fig. 1B) to facilitate clon-
ing of various regulator elements immediately upstream of lacZ gene. 3.2. Cloning and evaluation of furA promoter series Direct mutagenesis of the furA operator sequence was performed by the PCR amplification with the mutagenized primers (Table 1). One prototype furA promoter (pfurA) and three different mutants that containing either a 6-bp stretch substitution in the conserved AT-rich sequence (pfurAm), or initial codon GTG ? ATG variation (pfurAa), or both of those (pfurAma), were generated (Fig. 3).
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Fig. 3. Determination of promoter activities of the M.tb pfurAs in RAW264.7. M. bovis BCG-Danish strains transformed with the different pfurAs-lacZ constructs were grown in broth to log phase, and were then used to infect murine macrophage RAW264.7 monolayers at a M.O.I. of approximately 10:1. The b-galactosidase activities were measured at the desired time, and the number of CFU was counted by plating the infectious dose or the macrophages lysates on Middlebrook 7H11 plate at each time point. All measurements were carried out twice, data are averages from the duplicated measurements, and error bars represent standard deviations.
To test the influence of pfurA mutations on the levels of gene expression, all of the fragments were cloned immediately upstream of the promoterless lacZ gene, and the bgalactosidase activities were measured from three isolated recombinants of M. smegmatis mc2155 and M. bovis BCGDanish. The results showed that in both of hosts (Fig. 2),
43
pfurAa resulted in a double increase of the b-galactosidase activity, and roughly 4- to 6-folds increase of the activity by pfurAm. With the combination of both mutations, the b-galactosidase activity increased about 10-fold, which were about twice higher than that of the BCG phsp60, the strong promoter used widely for overexpression of proteins in mycobacteria (Stover et al., 1991, 1993). It is interesting to notice that the pfurA series exhibited higher bgalactosidase activity in the slow-growing M. bovis BCG than in the fast-growing M. smegmatis. To test the expression levels under control of the different furA promoters in vivo, rBCG::lacZ strains transformed with the different pfurAs-lacZ constructs were subsequently infected the murine macrophage RAW264.7 monolayer, the results showed that b-galactosidase activities were upregulated immediately in all of the rBCG::lacZ strains at the early infection, and were then persisted at levels higher than those recorded for rBCG::lacZ before macrophage infection, up to 7 days after infection (Fig. 3). 3.3. Construction of the differential expression vectors, pMFA series As depicted in Fig. 4, the prototype and three mutated pfurAs were used to replace phsp60 of the parent vector pMV261 to generate the differential expression vectors, pMFA series, which allow target genes protein-fused to the first six amino acid residues of FurA, and permit
Fig. 4. Diagram of the mycobacterial differential expression vectors, pMFA series. The expression cassette of pMFA series contains 406-bp of the 50 regulatory region of the M.tb furA gene, including 18-bp encoding for the first six amino acids (in boxes, single-letter aa notation) and 7 unique cloning sites are shown above the plasmid map. The mutated nucleotide of pfurAs are marked with asterisks above the sequence, the 35 and 10 consensus sequences are in boldface, the AT-rich region are in box, and start of transcription was marked with an arrow upstream of initiation codons of pMFA series.
44
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Fig. 5. Western-blotting analysis of the expression of chimeric antigen Ag856A2 in mycobacteria. Equal amounts protein from cell crude extracts of the recombinant M. smegmatis (A) and rBCG (B) transformed with the various pMFA expression vectors were analyzed for expression levels of Ag856A2 by the Western-blotting assay. Lanes 2–5 showed the extracts of recombinant mycobacteria carrying the constructs with pfurA, pfurAm, pfurAa, and pfurAma in the pMFA vectors, respectively. Lane 1 represents the extracts of the host M. smegmatis mc2155 or M. bovis BCG-Danish as negative controls, and lane 6 represents the recombinant mycobacteria carrying the constructs with phsp60 as positive controls.
expression of recombinant protein at different levels under the control of furA promoter series. 3.4. Cloning and expression of M.tb chimeric gene in mycobacteria We previously reported that immunogenicity against M.tb ESAT-6 antigen was improved greatly by the chimeric DNA prime and protein boost strategy (Li et al., 2006). Therefore, the M.tb chimeric gene ag856a2 was chosen as our emphasized target for TB vaccine research. The chimeric gene was amplified from the plasmid of DNA vaccine HG856A and cloned into pMFA vectors, and the expression levels in the recombinant mycobacterial strains were then analyzed by the Western-blotting assay. The results showed that the chimeric antigen Ag856A2 was expressed at varying levels driven by the different furA promoters in the recombinant M. smegmatis and rBCG strains (Fig. 5), pfurAma with double mutations on the initial codon and AT-rich sequence led to the highest level of gene expression, as consistent as observation in the b-galactosidase assay (Figs. 2 and 3).
4. Discussion We constructed a promoter probe vector pMC210 based on the parental plasmid pMV261, which allowed us to evaluate promoter strengths in gene-fusion to the E. coli lacZ reporter. Employing the pMC210 vector, a set of strong promoters (pfurA and its mutants) of M.tb was cloned into the upstream of the promoterless lacZ gene, and their promoter activities in mycobacteria were analyzed by the convenient and sensitive b-galactosidase assay. The M.tb furA gene located immediately upstream of catalase-peroxidase encoding gene katG, is conserved among mycobacteria, and has been demonstrated to be involved in the oxidative stress response together with katG. The presence of an oxidative stress-inducible promoter, pfurA, has been reported previously for M.tb, M. smegmatis, and M. bovis BCG (Zahrt et al., 2001; Sala et al., 2003; Milano et al., 2001). However, pfurA is always repressed
by its own encoded FurA protein under normal growth conditions (Sala et al., 2003). The mutation in polypurine sequence (pfurAm) upstream of furA gene, which is highly conserved in mycobacteria, may prevent the FurA binding and eliminate the repression. This kind of mutation may not reduce the pfurA activity per se, as it exhibited much more luciferase activity than the wild-type promoter when cloned into the upstream of the luxAB reporter (Sala et al., 2003). These were consistent with our observation showing that pfurAm displayed 4- to 6-folds of b-galactosidase activity higher than that of pfurA (Fig. 2). It was well known that when the initial codon GTG is mutated to the preferred ATG, the translation initiation efficiency may increase by 2- to 4-folds (Misra et al., 1996; Martin and Rosner, 2004). This was also observed in our study that the GTG ? ATG variation (pfurAa) led to 2-fold increase of b-galactosidase activity. It is significant that combination of both mutations described above showed the highest b-galactosidase activity, i.e., about 10-folds of b-galactosidase activity higher than that of the prototype pfurA in either M. smegmatis or M. bovis BCG. Since KatG is considered to be important for protection against reactive oxygen and nitrogen intermediates produced by phagocytic cells, and pfurA has been demonstrated to be one of promoters of katG (Master et al., 2001; Zahrt et al., 2001), it is necessary to test the promoter activities of pfurAs intracellularly. We showed that all of the furA promoters were expressed continuously in vivo during intracellular growth of M. bovis BCG, and were induced early upon infection in macrophages. These suggested that pfurA series were seem to be suitable to drive gene expression in mycobacteria and could be used to construct the expression vectors for development of recombinant BCG vaccines. Mutation in the polypurine sequence upstream of the furA gene may abolish its own encoded FurA binding, and thus eliminates the repression on its promoter activity (Sala et al., 2003), while the initial codon GTG ? ATG variation may allow more efficient initiation of translation (Misra et al., 1996; Martin and Rosner, 2004). Therefore, the pfurA series with such mutations, either alone or in combination were expected to exhibit higher promoter
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
activities than the wild-type promoter, and all of the pfurA series were used to construct the differential expression vectors, the pMFA series. Employing such vectors, the chimeric protein Ag856A2 was successfully expressed at various levels both in M. smegmatis and M. bovis BCG under the control of the different furA promoters (Fig. 5), and we also obtain overexpression of M.tb Ag85A, ESAT-6 alone, and CFP-10/ESAT-6 fusion in M. smegmatis by virtue of pMFA vector series (data not shown). These indicated that the pfurAs-based differential expression vector system could make it easy to modulate the expression levels of any target antigen for elicitation of optimal immune response, and the animal experiments immunized with the rBCG strains with the different expression levels of M.tb chimeric antigen are underway to evaluate their anti-TB immune response. Expression of heterologous antigen in recombinant BCG essentially imposes a metabolic burden. The foreign gene expression driven by the phsp60 in BCG is not always feasible. Langermann et al. could only express the truncated N-terminal portion, but not the full-length PspA protein with its natural C-terminal anchor domain, suggesting that expression of the repetitive domain was deleterious to BCG (Langermann et al., 1994). Stover et al. were unable to express HIV-1 gp120 from an episomal vector (Stover et al., 1991), and Bastos et al. could only detect expression of PRRSV G5 protein when 30 N-terminal hydrophobic amino acids were removed (Bastos et al., 2002). Lack of success in these cases may be due to the overexpression lethality or other forms of protein toxicity (Dennehy and Williamson, 2005), and it hinted that the expression from multicopy plasmid vectors was possible if weaker promoters such as pfurA or pfurAa were used. Thus, the availability of the mycobacterial differential expression vector system (such as the pMFA series) will certainly facilitate cloning and expressing any target antigen of interest in a modular fashion for the study of gene regulation in mycobacterial strains, and also for the development of recombinant BCG vaccine candidates against TB or other infectious diseases, which would be beneficial for elicitation of optimal immune response. Acknowledgments We are grateful to Dr. Ying Zhang from Bloomberg School of Public Health, Johns Hopkins University for the provision of plasmid pMV261. We also thank Dr. Hua-Guang Li from Chinese Academic Society for the critical reading of the manuscript. This work was supported partially by The Chinese National ‘‘Eleventh Five” Major Science & Technology Program on Infectious Diseases (grant no.: 2008ZX100 03 011 05). References Al-Zarouni, M., Dale, J.W., 2002. Expression of foreign genes in Mycobacterium bovis BCG strains using different promoters reveals instability of the hsp60 promoter for expression of foreign genes in Mycobacterium bovis BCG strains. Tuberculosis (Edinb) 82, 283–291. Barnes, P.F., Cave, M.D., 2003. Molecular epidemiology of tuberculosis. N. Engl. J. Med. 349, 1149–1156.
45
Bastos, R.G., Dellagostin, O.A., Barletta, R.G., Doster, A.R., Nelson, E., Osorio, F.A., 2002. Construction and immunogenicity of recombinant Mycobacterium bovis BCG expressing GP5 and M protein of porcine reproductive respiratory syndrome virus. Vaccine 21, 21–29. Bloom, B.R., Fine, P.E.M., 1994. BCG and new approaches to vaccines for tuberculosis. In: Bloom, B.R. (Ed.), Tuberculosis: Pathogenesis, Protection and Control. ASM Press, Washington, DC, pp. 531–537. DasGupta, S.K., Jain, S., Kaushal, D., Tyagi, A.K., 1998. Expression systems for study of mycobacterial gene regulation and development of recombinant BCG vaccines. Biochem. Biophys. Res. Commun. 246, 797–804. Dellagostin, O.A., Esposito, G., Eales, L.J., Dale, J.W., McFadden, J., 1995. Activity of mycobacterial promoters during intracellular and extracellular growth. Microbiology 141 (Pt. 8), 1785–1792. Dennehy, M., Williamson, A.L., 2005. Factors influencing the immune response to foreign antigen expressed in recombinant BCG vaccines. Vaccine 23, 1209–1224. Dhar, N., Rao, V., Tyagi, A.K., 2000. Recombinant BCG approach for development of vaccines: cloning and expression of immunodominant antigens of M. Tuberculosis. FEMS Microbiol. Lett. 190, 309–316. Fan, X.Y., Hu, Z.Y., Xu, F.H., Yan, Z.Q., Guo, S.Q., Li, Z.M., 2003. Rapid detection of rpoB gene mutations in rifampin-resistant Mycobacterium tuberculosis isolates in shanghai by using the amplification refractory mutation system. J. Clin. Microbiol. 41, 993–997. Fine, P.E., 1989. The BCG story: lessons from the past and implications for the future. Rev. Infect. Dis. 11 (Suppl. 2), S353–S359. Haeseleer, F., 1994. Structural instability of recombinant plasmids in mycobacteria. Res. Microbiol. 145, 683–687. Hernandez-Pando, R., Castanon, M., Espitia, C., Lopez-Vidal, Y., 2007. Recombinant BCG vaccine candidates. Curr. Mol. Med. 7, 365–372. Kumar, D., Srivastava, B.S., Srivastava, R., 1998. Genetic rearrangements leading to disruption of heterologous gene expression in mycobacteria: an observation with Escherichia coli betagalactosidase in Mycobacterium smegmatis and its implication in vaccine development. Vaccine 16, 1212–1215. Langermann, S., Palaszynski, S.R., Burlein, J.E., Koenig, S., Hanson, M.S., Briles, D.E., Stover, C.K., 1994. Protective humoral response against pneumococcal infection in mice elicited by recombinant bacille Calmette-Guerin vaccines expressing pneumococcal surface protein A. J. Exp. Med. 180, 2277–2286. Li, Z., Song, D., Zhang, H., He, W., Fan, X., Zhang, Y., et al, 2006. Improved humoral immunity against tuberculosis ESAT-6 antigen by chimeric DNA prime and protein boost strategy. DNA Cell Biol. 25, 25–30. Master, S., Zahrt, T.C., Song, J., Deretic, V., 2001. Mapping of Mycobacterium tuberculosis katG promoters and their differential expression in infected macrophages. J. Bacteriol. 183, 4033–4039. Martin, R.G., Rosner, J.L., 2004. Transcriptional and translational regulation of the marRAB multiple antibiotic resistance operon in Escherichia coli. Mol. Microbiol. 53, 183–191. Matsuo, K., Yamaguchi, R., Yamazaki, A., Tasaka, H., Terasaka, K., Totsuka, M., et al, 1990. Establishment of a foreign antigen secretion system in mycobacteria. Infect. Immun. 58, 4049–4054. Milano, A., Forti, F., Sala, C., Riccardi, G., Ghisotti, D., 2001. Transcriptional regulation of furA and katG upon oxidative stress in Mycobacterium smegmatis. J. Bacteriol. 183, 6801–6806. Miller, J.H., 1992. A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Misra, N., Habib, S., Ranjan, A., Hasnain, S.E., Nath, I., 1996. Expression and functional characterisation of the clpC gene of Mycobacterium leprae: ClpC protein elicits human antibody response. Gene 172, 99–104. Ranes, M.G., Rauzier, J., Lagranderie, M., Gheorghiu, M., Gicquel, B., 1990. Functional analysis of pAL5000, a plasmid from Mycobacterium fortuitum: construction of a ‘‘mini” mycobacterium-Escherichia coli shuttle vector. J. Bacteriol. 172, 2793–2797. Rao, V., Dhar, N., Tyagi, A.K., 2003. Modulation of host immune responses by overexpression of immunodominant antigens of Mycobacterium tuberculosis in bacille Calmette-Guerin. Scand. J. Immunol. 58, 449– 461. Sala, C., Forti, F., Di Florio, E., Canneva, F., Milano, A., Riccardi, G., Ghisotti, D., 2003. Mycobacterium tuberculosis FurA autoregulates its own expression. J. Bacteriol. 185, 5357–5362. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
46
X.-Y. Fan et al. / Plasmid 61 (2009) 39–46
Snapper, S.B., Melton, R.E., Mustafa, S., Kieser, T., Jacobs Jr., W.R., 1990. Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol. Microbiol. 4, 1911– 1919. Stover, C.K., de la Cruz, V.F., Fuerst, T.R., Burlein, J.E., Benson, L.A., Bennett, L.T., et al, 1991. New use of BCG for recombinant vaccines. Nature 351, 456–460.
Stover, C.K., Bansal, G.P., Hanson, M.S., Burlein, J.E., Palaszynski, S.R., Young, J.F., et al, 1993. Protective immunity elicited by recombinant bacille Calmette-Guerin (BCG) expressing outer surface protein A (OspA) lipoprotein: a candidate Lyme disease vaccine. J. Exp. Med. 178, 197–209. Zahrt, T.C., Song, J., Siple, J., Deretic, V., 2001. Mycobacterial FurA is a negative regulator of catalase-peroxidase gene katG. Mol. Microbiol. 39, 1174–1185.