- Email: [email protected]
A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of cocaine
Author’s Accepted Manuscript A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of cocaine Seyed Mohammad Taghdisi, Noor Mohammad Danesh, Ahmad Sarreshtehdar Emrani, Mohammad Ramezani, Khalil Abnous
PII: DOI: Reference:
www.elsevier.com/locate/bios
S0956-5663(15)30164-0 http://dx.doi.org/10.1016/j.bios.2015.05.065 BIOS7729
To appear in: Biosensors and Bioelectronic Received date: 17 April 2015 Revised date: 24 May 2015 Accepted date: 29 May 2015 Cite this article as: Seyed Mohammad Taghdisi, Noor Mohammad Danesh, Ahmad Sarreshtehdar Emrani, Mohammad Ramezani and Khalil Abnous, A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of c o c a i n e , Biosensors and Bioelectronic, http://dx.doi.org/10.1016/j.bios.2015.05.065 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of cocaine Seyed Mohammad Taghdisi a, Noor Mohammad Daneshb, c, Ahmad Sarreshtehdar Emranid, Mohammad Ramezanib, *, Khalil Abnouse, *
a
Targeted drug delivery Research Center, School of Pharmacy, Mashhad University of Medical Sciences,
Mashhad, Iran. b
Nanotechnology Research Center, School of Pharmacy, Mashhad University of Medical Sciences,
Mashhad, Iran. c
Research Institute of Sciences and New Technology, Mashhad, Iran.
d
Cardiovascular Research Center, Ghaem hospital, Mashhad University of Medical Sciences,
Mashhad, Iran. e
Pharmaceutical Research Center, School of Pharmacy, Mashhad University of Medical Sciences,
Mashhad, Iran.
* Corresponding author: Dr. Khalil Abnous ([email protected]) and Prof. Mohammad Ramezani ([email protected]), Tel.: +98 513 882 3255, Fax.: +98 513 882 3255
Abstract Cocaine is a strong central nervous system stimulant and one of the most commonly abused drugs. In this study, an electrochemical aptasensor was designed for sensitive and selective detection of cocaine, based on single-walled carbon
nanotubes (SWNTs), gold electrode and complimentary strand of aptamer (CS). This electrochemical aptasensor inherits properties of SWNTs and gold such as large surface area and high electrochemical conductivity, as well as high affinity and selectivity of aptamer toward its target and the stronger interaction of SWNTs with single-stranded DNA (ssDNA) than double-stranded DNA (dsDNA). In the absence of cocaine, a little amount of SWNTs bind to Aptamer-CS-modified electrode, so that the electrochemical signal is weak. In the presence of cocaine, aptamer binds to cocaine, leaves the surface of electrode. So that, a large amount of SWNTs bind to CS-modified electrode, generating to a strong electrochemical signal. The designed electrochemical aptasensor showed good selectivity toward cocaine with a limit of detection (LOD) as low as 105 pM. Moreover, the fabricated electrochemical aptasensor was successfully applied to detect cocaine in serum with a LOD as low as 136 pM. Keywords: Aptamer; Gold electrode; Cocaine; SWNTs
1. Introduction Cocaine is a powerful central nervous system stimulant. Abuse of cocaine causes cardiac arrest, organ damage, spread of human immunodeficiency and anxiety (Asturias-Arribas et al. 2014; Cai et al. 2011; Roncancio et al. 2014). Cocaine
addiction is a serious worldwide problem (Wren et al. 2014). So, sensitive and selective detection of cocaine is in great demand for both clinical diagnosis and law enforcement (Mokhtarzadeh et al. 2015; Shi et al. 2013). Various analytical techniques have been developed for detection of cocaine, such as high performance liquid
chromatography
(HPLC),
radioimmunoassay,
enzyme-linked
immunosorbent assay (ELISA) and gas chromatography-mass spectrometry (GCMS). Most of these methods are time-consuming, expensive and need extensive sample preparation (Kang et al. 2011; Nguyen et al. 2012; Roncancio et al. 2014; Wren et al. 2014). Aptamers are short single-stranded DNA (ssDNA) or RNA molecules, selected in vitro by SELEX (systematic evolution of ligands by exponential enrichment) (Tang et al. 2015; Zhao et al. 2015a). Aptamers bind to their pre-selected targets, including small substances, proteins and even whole cells with high specificity and affinity (Wu et al. 2015; Zhao et al. 2015b). Compared to antibodies, aptamers exhibit unique properties such as lack of immunogenicity and toxicity, low cost, excellent thermal stability and ease of synthesis and modification (Eissa et al. 2015; Lian et al. 2015; Luo et al. 2014; Zhao et al. 2015a). Aptamer-based sensors (aptasensors) have received substantial attention because of these properties (Ramezani et al. 2015).
Carbon nanotubes (CNTs), including multi-walled carbon nanotubes (MWNTs) and single-walled carbon nanotubes (SWNTs) are nano-size cylinders of carbon atoms (Foldvari and Bagonluri 2008). CNTs have been considered in different fields, including chemistry, nanosensors, nanoelectronics, and materials science, due to their unique properties, such as large surface area, chemical stability and excellent electrical conductivity (Ajori and Ansari 2015; Miller et al. 2015; Sakharova et al. 2015; Yoo et al. 2015). Gold has been mostly applied for molecular sensing, due to its large surface area, good biocompatibility, and unique electronic and optical properties (Liu et al. 2014; Luo et al. 2015; Wang et al. 2012). Among the different sensing methods, electrochemical aptasensors have unique advantages, including rapid response, simplicity, low cost and high sensitivity (Bai et al. 2013; Khezrian et al. 2013; Zhou et al. 2014). In this study, an electrochemical aptasensor was designed for the first time for detection of cocaine, based on gold electrode, SWNTs and complimentary strand of aptamer. In this work a ssDNA aptamer, which binds to cocaine with high affinity (Ge et al. 2012), was used as targeting agent.
2. Materials and Methods 2.1.
Materials
The
cocaine
aptamer
(Apt),
5'-
CCATAGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC - 3', and
its
complimentary
strand
(CS),
5'-
GGGAGACCCACTTCATTGAAGGATTTATCCTTGTCTCCCTATGG-Thiol3', were purchased from Microsynth (Switzerland). Plasma from rat, cocaine, morphine, chloramphenicol, diazepam, propranolol, 6-mercaptohexanol (MCH), Tris(2-carboxyethyl) phosphine hydrochloride (TCEP), phosphate buffered saline (PBS), ethylenediaminetetraacetic acid (EDTA), potassium chloride (KCl), Sodium
Chloride
(NaCl),
Tris-HCl,
potassium
hexacyanoferrate(III)
(K3[Fe(CN)6]) and Potassium hexacyanoferrate(II) trihydrate (K4[Fe(CN)6].3H2O) were obtained from Sigma (USA). Commercial carboxyl-functionalized SWNTs was purchased from Cheap Tubes Inc. (USA) to make sure CNTs were better soluble in water (Taghdisi et al. 2014). 2.2.
Apparatus
Cyclic voltammetry (CV) and differential pulse voltammetry (DPV) measurements were performed using a µstat 400 portable Biopotentiostat/Galvanostat (DropSens, Spain) with screen-printed gold electrodes (SPGEs). SPGEs were ordered from DropSens (Spain, DRP-220BT) with silver reference electrode. The data were analyzed using DropView8400 software. 2.3. CS (10
Preparation of Apt-CS-modified electrode M final concentration) was pretreated with 10 mM TCEP in
immobilization buffer solution (10 mM Tris-HCl, 1 mM EDTA, 100 mM NaCl,
pH 7.4) for 1 h at room temperature. 8 l CS (10 µM) was added on the surface of SPGE and incubated for 1 h at 100% humidity under room temperature. Next, the left sites of electrode was blocked with 1 mM MCH solution (10 µl). After 2 h, the surface of electrode was rinsed with hybridization buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4). Surface of CS-modified electrode was incubated with 8 µL Apt (10 µM) in the hybridization buffer for 1 h at room temperature. Then, the surface of electrode was rinsed with the hybridization buffer. 2.4.
Preparation of SWNTs
The SWNTs suspension (3 g/L) was sonicated for three 30 min cycles in deionized water. To make a well dispersed solution of SWNTs, the larger SWNTs aggregates were removed by allowing them to precipitate for 30 min between each sonication cycle. For the next experiments, dispersed solution of SWNTs from the third cycle was applied. The concentration of stock solution of SWNTs was measured by its absorbance at 808 nm using a CECIL 9000 spectrophotometer (Cecil, UK). 2.5.
Effect of SWNTs concentration on the electrochemical signal
Increasing concentrations of SWNTs (0-1 mg/mL, 10 µl) were added on the surface of CS-modified electrodes. After incubation for 1 h, the electrode was rinsed with the hybridization buffer. The electrochemical signals were measured using CV. CV measurements were carried out in 2 mM K3[Fe(CN)6] and
K4[Fe(CN)6] (redox probe) solution containing 0.1 M KCl, scanning from -0.5 V to 0.8 V at a scan rate of 50 mV/s. 2.6.
Function study of the designed electrochemical aptasensor
The interaction of cocaine and the fabricated aptasensor was investigated by electrochemical measurement. The Apt-CS-modified electrode was immersed in phosphate buffer saline (10 mM PBS, pH 7.4), containing 10 nM cocaine for 30 min at room temperature. The electrode was rinsed with PBS and incubated with 10 µl SWNTs (0.5 mg/mL). After 1 h incubation at room temperature, the electrode was rinsed with PBS and the electrochemical signals were recorded using CV. 2.7.
Detection of cocaine based on electrochemical measurement
Apt-CS-modified electrodes were immersed in a range of cocaine concentrations (0-50 nM) in 10 mM PBS, pH 7.4. After incubation for 30 min at room temperature, the electrodes were rinsed with PBS and incubated with 10 µl SWNTs (0.5 mg/mL) for 1 h, followed by rinsing with PBS. The electrochemical signals were measured using DPV. DPV measurements were performed by scanning the potential from 0 V to 0.4 V with the pulse potential of 30 mV and pulse time of 25 ms. 2.8.
Selectivity
The selectivity was assessed in the presence of 10 nM morphine, cocaine, diazepam, chloramphenicol and propranolol. 2.9.
Detection of cocaine in serum
To investigate the applicability of the electrochemical aptasensor in serum, increasing concentrations of cocaine (0-50 nM) were spiked to rat serum and cocaine concentrations were measured using DPV.
3. Results and Discussion 3.1.
Sensing scheme
The presented electrochemical aptasensor was designed based on target-induced release of Apt from CS, strong interaction of SWNTs with ssDNA and very weak interaction of SWNTs with dsDNA (Apt-CS conjugate).
As shown in scheme 1, in the absence of cocaine, Apt-CS-modified electrode is stable. Upon the addition of SWNTs, a small amount of SWNTs bind to Apt-CSmodified electrode, leading to a weak electrochemical signal. It has been shown CNTs could efficiently bind to ssDNA, but not to dsDNA (Tian et al. 2012; Yao et al. 2011). Addition of cocaine induces a conformational change, so that Apt leaves the CS and the surface of electrode and Apt/target conjugate forms. It has been demonstrated that aptamers bind to their targets with a greater binding constant compared to aptamers binding to their complimentary strands (Wu et al. 2015; Yang et al. 2014). So, addition of SWNTs on the surface of electrode, leads to the strong binding of SWNTs and CS (as a ssDNA) through π- π interactions (Taghdisi et al. 2011). SPGEs/SWNTs conjugate could enhance the electron transfer between the redox probe and electrode surface, leading to enhancement of the electrochemical signal of electrode. 3.2.
Optimum concentration of SWNTs
To determine the optimum concentration of SWNTs for complete reaction with CS-modified electrode, increasing concentrations of SWNTs were added on the surface of CS-modified electrode. As shown in Fig. 1, the final concentration of 0.5 mg/mL SWNTs could induce the maximum electrochemical signal.
3.3.
Monitoring of the fabrication and function of the designed electrochemical aptasensor
CV measurements were recorded to characterize the formation and function of the aptasensor. As shown in Fig. 2, the bare electrode exhibited the maximum redox peak, due to high capability of electron transfer (black curve). Upon the addition of CS, the electrochemical signal of electrode significantly decreased (gray curve), which confirmed the immobilization of CS onto the surface of electrode. The negatively charged phosphate groups of the capture DNA could make an electrostatic repulsive force to the negatively charged redox probe and severely block the electron transfer of redox probe (Chen et al. 2014; Zhao et al. 2015b). Upon the addition of Apt, the peak current further decreased (red curve), which could be attributed to the formation of Apt-CS (dsDNA) which has more negative phosphate groups. After incubation of the Apt-CS modified electrode with SWNTs, only a little enhancement was observed in the peak current (green curve), which indicated very weak interaction of SWNTs with Apt-CS as a dsDNA. In the presence of cocaine, the electrochemical signal enhanced significantly (pink curve), which confirmed the release of Apt from CS, formation of Apt/target conjugate and strong interaction between SWNTs and CS. 3.4.
Cocaine analysis
Fig. 3 (a) shows the DPV peaks of electrode at different concentrations of cocaine, the DPV peak increased and reached to plateau at concentration of 10 nM cocaine. The designed aptasensor exhibited a well linear range (0.1-10 nM) toward cocaine (Fig. 3 (b)). The limit of detection (LOD), which was defined as 3 times standard deviation of blank/slope by the International Union of Pure and Applied Chemistry (IUPAC), was calculated to be 105 pM (0.035 ng/mL). Reported detection limits of cocaine in other studies were as following: 190 nM for label-free fluorescence aptamer-based sensor (Qiu et al. 2013), 3 ng/mL for HPLC/MS (Johansen and Bhatia 2007), 0.5 pM for Aptamer-based microfluidic beads array sensor (Zhang et al. 2014), 300 nM for Label-free electrochemical cocaine aptasensor (Hua et al. 2010), 1 ng/mL for reversed-phase HPLC (Tagliaro et al. 1994), 5 µM for label-free DNA hairpin biosensor for colorimetric detection (Nie et al. 2013), 10 pM for microfluidic affinity sensor (Hilton et al. 2011), 0.1 μM for Solid-state probe based electrochemical aptasensor (Du et al. 2010), 0.48 nM for chemiluminescence aptasensor based on double-functionalized gold nanoprobes and functionalized magnetic microbeads (Li et al. 2011) and down to 20 nM for electrochemical aptasensor based on enzyme linked aptamer assay (Zhang et al. 2012). In comparison with the designed electrochemical aptasensor most of these methods are expensive, time-consuming and have higher LODs.
Selectivity is an important performance factor for a practical sensor. The DPV current responses of the modified electrode toward cocaine and morphine were significantly higher than chloramphenicol, propranolol and diazepam (Fig. 3 (c)). These results showed good selectivity of the electrochemical aptasensor toward cocaine and morphine, which have identical groups for the recognition by Apt. 3.5.
Measurement of cocaine in rat serum
The designed electrochemical aptasensor was applied to measure cocaine in rat serum, which is a complicated biological liquid containing a mixture of proteins and other interfering materials. Increasing concentrations of cocaine were spiked into serum and LOD was determined to be 136 pM (Fig. 4). The results indicated the fabricated electrochemical aptasensor could successfully be used for detection of cocaine in serum.
4. Conclusion In summary, we designed an electrochemical aptasensor for ultrasensitive detection of cocaine, based on SWNTs, gold electrode, and complimentary strand of aptamer. The limit of detection for cocaine was calculated as low as 105 pM.
Furthermore, the designed electrochemical aptasensor was useful and applicable for detection of cocaine in serum with a limit of detection as low as 136 pM.
Conflict of interest There is no conflict of interest about this article.
Acknowledgment Financial support of this study was provided by Mashhad University of Medical Sciences. References Ajori, S., Ansari, R., 2015. Vibrational characteristics of diethyltoluenediamines (DETDA) functionalized carbon nanotubes using molecular dynamics simulations. Physica B: Condensed Matter 459, 58-61. Asturias-Arribas, L., Alonso-Lomillo, M.A., Domínguez-Renedo, O., Arcos-Martínez, M.J., 2014. Sensitive and selective cocaine electrochemical detection using disposable sensors. Analytica Chimica Acta. Bai, H.Y., Campo, F.J., Tsai, Y.C., 2013. Sensitive electrochemical thrombin aptasensor based on gold disk microelectrode arrays. Biosensors and Bioelectronics 42(1), 17-22. Cai, Q., Chen, L., Luo, F., Qiu, B., Lin, Z., Chen, G., 2011. Determination of cocaine on banknotes through an aptamer-based electrochemiluminescence biosensor. Analytical and Bioanalytical Chemistry 400(1), 289-294. Chen, D., Yao, D., Xie, C., Liu, D., 2014. Development of an aptasensor for electrochemical detection of tetracycline. Food Control 42, 109-115. Du, Y., Chen, C., Yin, J., Li, B., Zhou, M., Dong, S., Wang, E., 2010. Solid-state probe based electrochemical aptasensor for cocaine: A potentially convenient, sensitive, repeatable, and integrated sensing platform for drugs. Analytical Chemistry 82(4), 1556-1563. Eissa, S., Siaj, M., Zourob, M., 2015. Aptamer-based competitive electrochemical biosensor for brevetoxin-2. Biosensors and Bioelectronics 69, 148-154.
Foldvari, M., Bagonluri, M., 2008. Carbon nanotubes as functional excipients for nanomedicines: II. Drug delivery and biocompatibility issues. Nanomedicine: Nanotechnology, Biology, and Medicine 4(3), 183-200. Ge, J., Liu, Z., Zhao, X.S., 2012. Cocaine detection in blood serum using aptamer biosensor on gold nanoparticles and progressive dilution. Chinese Journal of Chemistry 30(9), 2023-2028. Johansen, S.S., Bhatia, H.M., 2007. Quantitative analysis of cocaine and its metabolites in whole blood and urine by high-performance liquid chromatography coupled with tandem mass spectrometry. Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences 852(1-2), 338-344. Hilton, J.P., Nguyen, T.H., Pei, R., Stojanovic, M., Lin, Q., 2011. A microfluidic affinity sensor for the detection of cocaine. Sensors and Actuators, A: Physical 166(2), 241-246. Hua, M., Tao, M., Wang, P., Zhang, Y., Wu, Z., Chang, Y., Yang, Y., 2010. Label-free electrochemical cocaine aptasensor based on a target-inducing aptamer switching conformation. Analytical Sciences 26(12), 1265-1270. Kang, K., Sachan, A., Nilsen-Hamilton, M., Shrotriya, P., 2011. Aptamer functionalized microcantilever sensors for cocaine detection. Langmuir : the ACS journal of surfaces and colloids 27(23), 14696-14702. Khezrian, S., Salimi, A., Teymourian, H., Hallaj, R., 2013. Label-free electrochemical IgE aptasensor based on covalent attachment of aptamer onto multiwalled carbon nanotubes/ionic liquid/chitosan nanocomposite modified electrode. Biosensors and Bioelectronics 43(1), 218225. Li, Y., Ji, X., Liu, B., 2011. Chemiluminescence aptasensor for cocaine based on doublefunctionalized gold nanoprobes and functionalized magnetic microbeads. Analytical and Bioanalytical Chemistry 401(1), 213-219. Lian, Y., He, F., Wang, H., Tong, F., 2015. A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus. Biosensors and Bioelectronics 65, 314-319. Liu, J., Guan, Z., Lv, Z., Jiang, X., Yang, S., Chen, A., 2014. Improving sensitivity of gold nanoparticle based fluorescence quenching and colorimetric aptasensor by using water resuspended gold nanoparticle. Biosensors & bioelectronics 52, 265-270. Luo, P., Liu, Y., Xia, Y., Xu, H., Xie, G., 2014. Aptamer biosensor for sensitive detection of toxin A of Clostridium difficile using gold nanoparticles synthesized by Bacillus stearothermophilus. Biosensors and Bioelectronics 54, 217-221. Luo, Y., Xu, J., Li, Y., Gao, H., Guo, J., Shen, F., Sun, C., 2015. A novel colorimetric aptasensor using cysteamine-stabilized gold nanoparticles as probe for rapid and specific detection of tetracycline in raw milk. Food Control 54, 7-15. Miller, T.S., Sansuk, S., E, S.P., Lai, S.C.S., Macpherson, J.V., Unwin, P.R., 2015. Pt nanoparticle modified single walled carbon nanotube network electrodes for electrocatalysis: Control of the specific surface area over three orders of magnitude. Catalysis Today 244, 136145. Mokhtarzadeh, A., Ezzati Nazhad Dolatabadi, J., Abnous, K., de la Guardia, M., Ramezani, M., 2015. Nanomaterial-based cocaine aptasensors. Biosensors and Bioelectronics 68, 95-106. Nguyen, T.H., Hardwick, S.A., Sun, T., Grattan, K.T.V., 2012. Intrinsic fluorescence-based optical fiber sensor for cocaine using a molecularly imprinted polymer as the recognition element. IEEE Sensors Journal 12(1), 255-260.
Nie, J., Zhang, D.W., Tie, C., Zhou, Y.L., Zhang, X.X., 2013. A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners. Biosensors and Bioelectronics 49, 236-242. Qiu, L., Zhou, H., Zhu, W., Jiang, J., Shen, G., Yu, R., 2013. A novel label-free fluorescence aptamer-based sensor method for cocaine detection based on isothermal circular stranddisplacement amplification and graphene oxide absorption. New Journal of Chemistry 37(12), 3998-4003. Ramezani, M., Mohammad Danesh, N., Lavaee, P., Abnous, K., Mohammad Taghdisi, S., 2015. A novel colorimetric triple-helix molecular switch aptasensor for ultrasensitive detection of tetracycline. Biosensors and Bioelectronics 70, 181-187. Roncancio, D., Yu, H., Xu, X., Wu, S., Liu, R., Debord, J., Lou, X., Xiao, Y., 2014. A label-free aptamer-fluorophore assembly for rapid and specific detection of cocaine in biofluids. Analytical Chemistry 86(22), 11100-11106. Sakharova, N.A., Pereira, A.F.G., Antunes, J.M., Brett, C.M.A., Fernandes, J.V., 2015. Mechanical characterization of single-walled carbon nanotubes: Numerical simulation study. Composites Part B: Engineering 75, 73-85. Shi, Y., Dai, H., Sun, Y., Hu, J., Ni, P., Li, Z., 2013. Fluorescent sensing of cocaine based on a structure switching aptamer, gold nanoparticles and graphene oxide. Analyst 138(23), 71527156. Taghdisi, S.M., Emrani, S.S., Tabrizian, K., Ramezani, M., Abnous, K., Emrani, A.S., 2014. Ultrasensitive detection of lead (II) based on fluorescent aptamer-functionalized carbon nanotubes. Environmental toxicology and pharmacology 37(3), 1236-1242. Taghdisi, S.M., Lavaee, P., Ramezani, M., Abnous, K., 2011. Reversible targeting and controlled release delivery of daunorubicin to cancer cells by aptamer-wrapped carbon nanotubes. European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V 77(2), 200-206. Tagliaro, F., Antonioli, C., De Battisti, Z., Ghielmi, S., Marigo, M., 1994. Reversed-phase highperformance liquid chromatographic determination of cocaine in plasma and human hair with direct fluorimetric detection. Journal of Chromatography A 674(1-2), 207-215. Tang, X., Wang, Y.S., Xue, J.H., Zhou, B., Cao, J.X., Chen, S.H., Li, M.H., Wang, X.F., Zhu, Y.F., Huang, Y.Q., 2015. A novel strategy for dual-channel detection of metallothioneins and mercury based on the conformational switching of functional chimera aptamer. Journal of Pharmaceutical and Biomedical Analysis 107, 258-264. Tian, J., Zhao, H., Liu, M., Chen, Y., Quan, X., 2012. Detection of influenza A virus based on fluorescence resonance energy transfer from quantum dots to carbon nanotubes. Analytica Chimica Acta 723, 83-87. Wang, S., Chen, W., Liu, A.L., Hong, L., Deng, H.H., Lin, X.H., 2012. Comparison of the peroxidase-like activity of unmodified, amino-modified, and citrate-capped gold nanoparticles. ChemPhysChem 13(5), 1199-1204. Wren, S.P., Nguyen, T.H., Gascoine, P., Lacey, R., Sun, T., Grattan, K.T.V., 2014. Preparation of novel optical fibre-based Cocaine sensors using a molecular imprinted polymer approach. Sensors and Actuators, B: Chemical 193, 35-41. Wu, S., Zhang, H., Shi, Z., Duan, N., Fang, C., Dai, S., Wang, Z., 2015. Aptamer-based fluorescence biosensor for chloramphenicol determination using upconversion nanoparticles. Food Control 50, 597-604.
Yang, C., Wang, Q., Xiang, Y., Yuan, R., Chai, Y., 2014. Target-induced strand release and thionine-decorated gold nanoparticle amplification labels for sensitive electrochemical aptamerbased sensing of small molecules. Sensors and Actuators, B: Chemical 197, 149-154. Yao, J., Li, J., Owens, J., Zhong, W., 2011. Combing DNAzyme with single-walled carbon nanotubes for detection of Pb(ii) in water. Analyst 136(4), 764-768. Yoo, R., Kim, J., Song, M.J., Lee, W., Noh, J.S., 2015. Nano-composite sensors composed of single-walled carbon nanotubes and polyaniline for the detection of a nerve agent simulant gas. Sensors and Actuators, B: Chemical 209, 444-448. Zhang, D.W., Sun, C.J., Zhang, F.T., Xu, L., Zhou, Y.L., Zhang, X.X., 2012. An electrochemical aptasensor based on enzyme linked aptamer assay. Biosensors and Bioelectronics 31(1), 363368. Zhang, H., Hu, X., Fu, X., 2014. Aptamer-based microfluidic beads array sensor for simultaneous detection of multiple analytes employing multienzyme-linked nanoparticle amplification and quantum dots labels. Biosensors and Bioelectronics 57, 22-29. Zhao, B., Wu, P., Zhang, H., Cai, C., 2015a. Designing activatable aptamer probes for simultaneous detection of multiple tumor-related proteins in living cancer cells. Biosensors and Bioelectronics 68, 763-770. Zhao, F., Xie, Q., Xu, M., Wang, S., Zhou, J., Liu, F., 2015b. RNA aptamer based electrochemical biosensor for sensitive and selective detection of cAMP. Biosensors and Bioelectronics 66, 238-243. Zhou, L., Wang, J., Li, D., Li, Y., 2014. An electrochemical aptasensor based on gold nanoparticles dotted graphene modified glassy carbon electrode for label-free detection of bisphenol A in milk samples. Food Chemistry 162, 34-40.
SH
SH
SH
SH
SH SH
SH
SH
SPGE
Complimentary strand
Aptamer
Target
SWNTs
MCH
Scheme 1. Schematic description of cocaine detection based on electrochemical aptasensor. In the absence of cocaine, Apt-CS-modified electrode is intact and the SWNTs could not bind to Apt-Cs well, resulting in a weak electrochemical signal (b). In the presence of target, aptamer binds to its target, leaves the CS and the SWNTs could bind to CS well, leading to enhancement of the electrochemical signal (a).
Fig. 1. CV responses of CS-modified electrode in the presence of various concentrations of SWNTs (from bottom to top 0, 0.025, 0.05, 0.1, 0.2, 0.5, 1 mg/mL).
Fig. 2. CV responses of bare electrode (black curve), CS-modified electrode (gray curve), Apt-CS-modified electrode (red curve), Apt-CS-modified electrode + SWNTs (green curve), Apt-CS-modified electrode + Target + SWNTs (pink curve), CS-modified electrode + SWNTs (blue curve).
40
a)
Current (µA)
30
20
10
0 0
0.1
0.2
Potential (v)
b)
0.3
0.4
40
30
Current (µA)
c) 20
10
0
0
0.1
0.2
0.3
0.4
Potential (v)
Fig. 3. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in PBS (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in PBS. (c) DPV peaks of the modified electrode in the presence of cocaine (green), morphine (red), propranolol (yellow), diazepam (blue) and chloramphenicol (orange). 40
30
t (µA)
a)
20
b)
Fig. 4. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in serum (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in serum.
Scheme 1. Schematic description of cocaine detection based on electrochemical aptasensor. In the absence of cocaine, Apt-CS-modified electrode is intact and the SWNTs could not bind to Apt-Cs well, resulting in a weak electrochemical signal (b). In the presence of target, aptamer binds to its target, leaves the CS and the SWNTs could bind to CS well, leading to enhancement of the electrochemical signal (a). Fig. 1. CV responses of CS-modified electrode in the presence of various concentrations of SWNTs (from bottom to top 0, 0.025, 0.05, 0.1, 0.2, 0.5, 1 mg/mL). Fig. 2. CV responses of bare electrode (black curve), CS-modified electrode (gray curve), Apt-CS-modified electrode (red curve), Apt-CS-modified electrode + SWNTs (green curve), Apt-CS-modified electrode + Target + SWNTs (pink curve), CS-modified electrode + SWNTs (blue curve). Fig. 3. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in PBS (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in PBS. (c) DPV peaks of the modified electrode in the presence of cocaine (green), morphine (red), propranolol (yellow), diazepam (blue) and chloramphenicol (orange). Fig. 4. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in serum (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in serum.
highlights * Cocaine is a powerful central nervous system stimulant. * Abuse of cocaine causes cardiac arrest, organ damage, spread of human immunodeficiency and anxiety and its addiction is a serious worldwide problem. *In this study, we designed a novel electrochemical aptasensor based on singlewalled carbon nanotubes (SWNTs), gold electrode and complimentary strand of aptamer (CS) for ultrasensitive detection of cocaine.
* This electrochemical aptasensor inherits properties of SWNTs and gold such as large surface area and high electrochemical conductivity, as well as high affinity and selectivity of aptamer toward its target and property of CS to improve the sensitivity of designed sensor. * The designed electrochemical aptasensor showed good selectivity toward cocaine with a limit of detection (LOD) as low as 105 pM. * Moreover, the fabricated electrochemical aptasensor was successfully applied to detect cocaine in serum with a LOD as low as 136 pM.
PII: DOI: Reference:
www.elsevier.com/locate/bios
S0956-5663(15)30164-0 http://dx.doi.org/10.1016/j.bios.2015.05.065 BIOS7729
To appear in: Biosensors and Bioelectronic Received date: 17 April 2015 Revised date: 24 May 2015 Accepted date: 29 May 2015 Cite this article as: Seyed Mohammad Taghdisi, Noor Mohammad Danesh, Ahmad Sarreshtehdar Emrani, Mohammad Ramezani and Khalil Abnous, A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of c o c a i n e , Biosensors and Bioelectronic, http://dx.doi.org/10.1016/j.bios.2015.05.065 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of cocaine Seyed Mohammad Taghdisi a, Noor Mohammad Daneshb, c, Ahmad Sarreshtehdar Emranid, Mohammad Ramezanib, *, Khalil Abnouse, *
a
Targeted drug delivery Research Center, School of Pharmacy, Mashhad University of Medical Sciences,
Mashhad, Iran. b
Nanotechnology Research Center, School of Pharmacy, Mashhad University of Medical Sciences,
Mashhad, Iran. c
Research Institute of Sciences and New Technology, Mashhad, Iran.
d
Cardiovascular Research Center, Ghaem hospital, Mashhad University of Medical Sciences,
Mashhad, Iran. e
Pharmaceutical Research Center, School of Pharmacy, Mashhad University of Medical Sciences,
Mashhad, Iran.
* Corresponding author: Dr. Khalil Abnous ([email protected]) and Prof. Mohammad Ramezani ([email protected]), Tel.: +98 513 882 3255, Fax.: +98 513 882 3255
Abstract Cocaine is a strong central nervous system stimulant and one of the most commonly abused drugs. In this study, an electrochemical aptasensor was designed for sensitive and selective detection of cocaine, based on single-walled carbon
nanotubes (SWNTs), gold electrode and complimentary strand of aptamer (CS). This electrochemical aptasensor inherits properties of SWNTs and gold such as large surface area and high electrochemical conductivity, as well as high affinity and selectivity of aptamer toward its target and the stronger interaction of SWNTs with single-stranded DNA (ssDNA) than double-stranded DNA (dsDNA). In the absence of cocaine, a little amount of SWNTs bind to Aptamer-CS-modified electrode, so that the electrochemical signal is weak. In the presence of cocaine, aptamer binds to cocaine, leaves the surface of electrode. So that, a large amount of SWNTs bind to CS-modified electrode, generating to a strong electrochemical signal. The designed electrochemical aptasensor showed good selectivity toward cocaine with a limit of detection (LOD) as low as 105 pM. Moreover, the fabricated electrochemical aptasensor was successfully applied to detect cocaine in serum with a LOD as low as 136 pM. Keywords: Aptamer; Gold electrode; Cocaine; SWNTs
1. Introduction Cocaine is a powerful central nervous system stimulant. Abuse of cocaine causes cardiac arrest, organ damage, spread of human immunodeficiency and anxiety (Asturias-Arribas et al. 2014; Cai et al. 2011; Roncancio et al. 2014). Cocaine
addiction is a serious worldwide problem (Wren et al. 2014). So, sensitive and selective detection of cocaine is in great demand for both clinical diagnosis and law enforcement (Mokhtarzadeh et al. 2015; Shi et al. 2013). Various analytical techniques have been developed for detection of cocaine, such as high performance liquid
chromatography
(HPLC),
radioimmunoassay,
enzyme-linked
immunosorbent assay (ELISA) and gas chromatography-mass spectrometry (GCMS). Most of these methods are time-consuming, expensive and need extensive sample preparation (Kang et al. 2011; Nguyen et al. 2012; Roncancio et al. 2014; Wren et al. 2014). Aptamers are short single-stranded DNA (ssDNA) or RNA molecules, selected in vitro by SELEX (systematic evolution of ligands by exponential enrichment) (Tang et al. 2015; Zhao et al. 2015a). Aptamers bind to their pre-selected targets, including small substances, proteins and even whole cells with high specificity and affinity (Wu et al. 2015; Zhao et al. 2015b). Compared to antibodies, aptamers exhibit unique properties such as lack of immunogenicity and toxicity, low cost, excellent thermal stability and ease of synthesis and modification (Eissa et al. 2015; Lian et al. 2015; Luo et al. 2014; Zhao et al. 2015a). Aptamer-based sensors (aptasensors) have received substantial attention because of these properties (Ramezani et al. 2015).
Carbon nanotubes (CNTs), including multi-walled carbon nanotubes (MWNTs) and single-walled carbon nanotubes (SWNTs) are nano-size cylinders of carbon atoms (Foldvari and Bagonluri 2008). CNTs have been considered in different fields, including chemistry, nanosensors, nanoelectronics, and materials science, due to their unique properties, such as large surface area, chemical stability and excellent electrical conductivity (Ajori and Ansari 2015; Miller et al. 2015; Sakharova et al. 2015; Yoo et al. 2015). Gold has been mostly applied for molecular sensing, due to its large surface area, good biocompatibility, and unique electronic and optical properties (Liu et al. 2014; Luo et al. 2015; Wang et al. 2012). Among the different sensing methods, electrochemical aptasensors have unique advantages, including rapid response, simplicity, low cost and high sensitivity (Bai et al. 2013; Khezrian et al. 2013; Zhou et al. 2014). In this study, an electrochemical aptasensor was designed for the first time for detection of cocaine, based on gold electrode, SWNTs and complimentary strand of aptamer. In this work a ssDNA aptamer, which binds to cocaine with high affinity (Ge et al. 2012), was used as targeting agent.
2. Materials and Methods 2.1.
Materials
The
cocaine
aptamer
(Apt),
5'-
CCATAGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC - 3', and
its
complimentary
strand
(CS),
5'-
GGGAGACCCACTTCATTGAAGGATTTATCCTTGTCTCCCTATGG-Thiol3', were purchased from Microsynth (Switzerland). Plasma from rat, cocaine, morphine, chloramphenicol, diazepam, propranolol, 6-mercaptohexanol (MCH), Tris(2-carboxyethyl) phosphine hydrochloride (TCEP), phosphate buffered saline (PBS), ethylenediaminetetraacetic acid (EDTA), potassium chloride (KCl), Sodium
Chloride
(NaCl),
Tris-HCl,
potassium
hexacyanoferrate(III)
(K3[Fe(CN)6]) and Potassium hexacyanoferrate(II) trihydrate (K4[Fe(CN)6].3H2O) were obtained from Sigma (USA). Commercial carboxyl-functionalized SWNTs was purchased from Cheap Tubes Inc. (USA) to make sure CNTs were better soluble in water (Taghdisi et al. 2014). 2.2.
Apparatus
Cyclic voltammetry (CV) and differential pulse voltammetry (DPV) measurements were performed using a µstat 400 portable Biopotentiostat/Galvanostat (DropSens, Spain) with screen-printed gold electrodes (SPGEs). SPGEs were ordered from DropSens (Spain, DRP-220BT) with silver reference electrode. The data were analyzed using DropView8400 software. 2.3. CS (10
Preparation of Apt-CS-modified electrode M final concentration) was pretreated with 10 mM TCEP in
immobilization buffer solution (10 mM Tris-HCl, 1 mM EDTA, 100 mM NaCl,
pH 7.4) for 1 h at room temperature. 8 l CS (10 µM) was added on the surface of SPGE and incubated for 1 h at 100% humidity under room temperature. Next, the left sites of electrode was blocked with 1 mM MCH solution (10 µl). After 2 h, the surface of electrode was rinsed with hybridization buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4). Surface of CS-modified electrode was incubated with 8 µL Apt (10 µM) in the hybridization buffer for 1 h at room temperature. Then, the surface of electrode was rinsed with the hybridization buffer. 2.4.
Preparation of SWNTs
The SWNTs suspension (3 g/L) was sonicated for three 30 min cycles in deionized water. To make a well dispersed solution of SWNTs, the larger SWNTs aggregates were removed by allowing them to precipitate for 30 min between each sonication cycle. For the next experiments, dispersed solution of SWNTs from the third cycle was applied. The concentration of stock solution of SWNTs was measured by its absorbance at 808 nm using a CECIL 9000 spectrophotometer (Cecil, UK). 2.5.
Effect of SWNTs concentration on the electrochemical signal
Increasing concentrations of SWNTs (0-1 mg/mL, 10 µl) were added on the surface of CS-modified electrodes. After incubation for 1 h, the electrode was rinsed with the hybridization buffer. The electrochemical signals were measured using CV. CV measurements were carried out in 2 mM K3[Fe(CN)6] and
K4[Fe(CN)6] (redox probe) solution containing 0.1 M KCl, scanning from -0.5 V to 0.8 V at a scan rate of 50 mV/s. 2.6.
Function study of the designed electrochemical aptasensor
The interaction of cocaine and the fabricated aptasensor was investigated by electrochemical measurement. The Apt-CS-modified electrode was immersed in phosphate buffer saline (10 mM PBS, pH 7.4), containing 10 nM cocaine for 30 min at room temperature. The electrode was rinsed with PBS and incubated with 10 µl SWNTs (0.5 mg/mL). After 1 h incubation at room temperature, the electrode was rinsed with PBS and the electrochemical signals were recorded using CV. 2.7.
Detection of cocaine based on electrochemical measurement
Apt-CS-modified electrodes were immersed in a range of cocaine concentrations (0-50 nM) in 10 mM PBS, pH 7.4. After incubation for 30 min at room temperature, the electrodes were rinsed with PBS and incubated with 10 µl SWNTs (0.5 mg/mL) for 1 h, followed by rinsing with PBS. The electrochemical signals were measured using DPV. DPV measurements were performed by scanning the potential from 0 V to 0.4 V with the pulse potential of 30 mV and pulse time of 25 ms. 2.8.
Selectivity
The selectivity was assessed in the presence of 10 nM morphine, cocaine, diazepam, chloramphenicol and propranolol. 2.9.
Detection of cocaine in serum
To investigate the applicability of the electrochemical aptasensor in serum, increasing concentrations of cocaine (0-50 nM) were spiked to rat serum and cocaine concentrations were measured using DPV.
3. Results and Discussion 3.1.
Sensing scheme
The presented electrochemical aptasensor was designed based on target-induced release of Apt from CS, strong interaction of SWNTs with ssDNA and very weak interaction of SWNTs with dsDNA (Apt-CS conjugate).
As shown in scheme 1, in the absence of cocaine, Apt-CS-modified electrode is stable. Upon the addition of SWNTs, a small amount of SWNTs bind to Apt-CSmodified electrode, leading to a weak electrochemical signal. It has been shown CNTs could efficiently bind to ssDNA, but not to dsDNA (Tian et al. 2012; Yao et al. 2011). Addition of cocaine induces a conformational change, so that Apt leaves the CS and the surface of electrode and Apt/target conjugate forms. It has been demonstrated that aptamers bind to their targets with a greater binding constant compared to aptamers binding to their complimentary strands (Wu et al. 2015; Yang et al. 2014). So, addition of SWNTs on the surface of electrode, leads to the strong binding of SWNTs and CS (as a ssDNA) through π- π interactions (Taghdisi et al. 2011). SPGEs/SWNTs conjugate could enhance the electron transfer between the redox probe and electrode surface, leading to enhancement of the electrochemical signal of electrode. 3.2.
Optimum concentration of SWNTs
To determine the optimum concentration of SWNTs for complete reaction with CS-modified electrode, increasing concentrations of SWNTs were added on the surface of CS-modified electrode. As shown in Fig. 1, the final concentration of 0.5 mg/mL SWNTs could induce the maximum electrochemical signal.
3.3.
Monitoring of the fabrication and function of the designed electrochemical aptasensor
CV measurements were recorded to characterize the formation and function of the aptasensor. As shown in Fig. 2, the bare electrode exhibited the maximum redox peak, due to high capability of electron transfer (black curve). Upon the addition of CS, the electrochemical signal of electrode significantly decreased (gray curve), which confirmed the immobilization of CS onto the surface of electrode. The negatively charged phosphate groups of the capture DNA could make an electrostatic repulsive force to the negatively charged redox probe and severely block the electron transfer of redox probe (Chen et al. 2014; Zhao et al. 2015b). Upon the addition of Apt, the peak current further decreased (red curve), which could be attributed to the formation of Apt-CS (dsDNA) which has more negative phosphate groups. After incubation of the Apt-CS modified electrode with SWNTs, only a little enhancement was observed in the peak current (green curve), which indicated very weak interaction of SWNTs with Apt-CS as a dsDNA. In the presence of cocaine, the electrochemical signal enhanced significantly (pink curve), which confirmed the release of Apt from CS, formation of Apt/target conjugate and strong interaction between SWNTs and CS. 3.4.
Cocaine analysis
Fig. 3 (a) shows the DPV peaks of electrode at different concentrations of cocaine, the DPV peak increased and reached to plateau at concentration of 10 nM cocaine. The designed aptasensor exhibited a well linear range (0.1-10 nM) toward cocaine (Fig. 3 (b)). The limit of detection (LOD), which was defined as 3 times standard deviation of blank/slope by the International Union of Pure and Applied Chemistry (IUPAC), was calculated to be 105 pM (0.035 ng/mL). Reported detection limits of cocaine in other studies were as following: 190 nM for label-free fluorescence aptamer-based sensor (Qiu et al. 2013), 3 ng/mL for HPLC/MS (Johansen and Bhatia 2007), 0.5 pM for Aptamer-based microfluidic beads array sensor (Zhang et al. 2014), 300 nM for Label-free electrochemical cocaine aptasensor (Hua et al. 2010), 1 ng/mL for reversed-phase HPLC (Tagliaro et al. 1994), 5 µM for label-free DNA hairpin biosensor for colorimetric detection (Nie et al. 2013), 10 pM for microfluidic affinity sensor (Hilton et al. 2011), 0.1 μM for Solid-state probe based electrochemical aptasensor (Du et al. 2010), 0.48 nM for chemiluminescence aptasensor based on double-functionalized gold nanoprobes and functionalized magnetic microbeads (Li et al. 2011) and down to 20 nM for electrochemical aptasensor based on enzyme linked aptamer assay (Zhang et al. 2012). In comparison with the designed electrochemical aptasensor most of these methods are expensive, time-consuming and have higher LODs.
Selectivity is an important performance factor for a practical sensor. The DPV current responses of the modified electrode toward cocaine and morphine were significantly higher than chloramphenicol, propranolol and diazepam (Fig. 3 (c)). These results showed good selectivity of the electrochemical aptasensor toward cocaine and morphine, which have identical groups for the recognition by Apt. 3.5.
Measurement of cocaine in rat serum
The designed electrochemical aptasensor was applied to measure cocaine in rat serum, which is a complicated biological liquid containing a mixture of proteins and other interfering materials. Increasing concentrations of cocaine were spiked into serum and LOD was determined to be 136 pM (Fig. 4). The results indicated the fabricated electrochemical aptasensor could successfully be used for detection of cocaine in serum.
4. Conclusion In summary, we designed an electrochemical aptasensor for ultrasensitive detection of cocaine, based on SWNTs, gold electrode, and complimentary strand of aptamer. The limit of detection for cocaine was calculated as low as 105 pM.
Furthermore, the designed electrochemical aptasensor was useful and applicable for detection of cocaine in serum with a limit of detection as low as 136 pM.
Conflict of interest There is no conflict of interest about this article.
Acknowledgment Financial support of this study was provided by Mashhad University of Medical Sciences. References Ajori, S., Ansari, R., 2015. Vibrational characteristics of diethyltoluenediamines (DETDA) functionalized carbon nanotubes using molecular dynamics simulations. Physica B: Condensed Matter 459, 58-61. Asturias-Arribas, L., Alonso-Lomillo, M.A., Domínguez-Renedo, O., Arcos-Martínez, M.J., 2014. Sensitive and selective cocaine electrochemical detection using disposable sensors. Analytica Chimica Acta. Bai, H.Y., Campo, F.J., Tsai, Y.C., 2013. Sensitive electrochemical thrombin aptasensor based on gold disk microelectrode arrays. Biosensors and Bioelectronics 42(1), 17-22. Cai, Q., Chen, L., Luo, F., Qiu, B., Lin, Z., Chen, G., 2011. Determination of cocaine on banknotes through an aptamer-based electrochemiluminescence biosensor. Analytical and Bioanalytical Chemistry 400(1), 289-294. Chen, D., Yao, D., Xie, C., Liu, D., 2014. Development of an aptasensor for electrochemical detection of tetracycline. Food Control 42, 109-115. Du, Y., Chen, C., Yin, J., Li, B., Zhou, M., Dong, S., Wang, E., 2010. Solid-state probe based electrochemical aptasensor for cocaine: A potentially convenient, sensitive, repeatable, and integrated sensing platform for drugs. Analytical Chemistry 82(4), 1556-1563. Eissa, S., Siaj, M., Zourob, M., 2015. Aptamer-based competitive electrochemical biosensor for brevetoxin-2. Biosensors and Bioelectronics 69, 148-154.
Foldvari, M., Bagonluri, M., 2008. Carbon nanotubes as functional excipients for nanomedicines: II. Drug delivery and biocompatibility issues. Nanomedicine: Nanotechnology, Biology, and Medicine 4(3), 183-200. Ge, J., Liu, Z., Zhao, X.S., 2012. Cocaine detection in blood serum using aptamer biosensor on gold nanoparticles and progressive dilution. Chinese Journal of Chemistry 30(9), 2023-2028. Johansen, S.S., Bhatia, H.M., 2007. Quantitative analysis of cocaine and its metabolites in whole blood and urine by high-performance liquid chromatography coupled with tandem mass spectrometry. Journal of Chromatography B: Analytical Technologies in the Biomedical and Life Sciences 852(1-2), 338-344. Hilton, J.P., Nguyen, T.H., Pei, R., Stojanovic, M., Lin, Q., 2011. A microfluidic affinity sensor for the detection of cocaine. Sensors and Actuators, A: Physical 166(2), 241-246. Hua, M., Tao, M., Wang, P., Zhang, Y., Wu, Z., Chang, Y., Yang, Y., 2010. Label-free electrochemical cocaine aptasensor based on a target-inducing aptamer switching conformation. Analytical Sciences 26(12), 1265-1270. Kang, K., Sachan, A., Nilsen-Hamilton, M., Shrotriya, P., 2011. Aptamer functionalized microcantilever sensors for cocaine detection. Langmuir : the ACS journal of surfaces and colloids 27(23), 14696-14702. Khezrian, S., Salimi, A., Teymourian, H., Hallaj, R., 2013. Label-free electrochemical IgE aptasensor based on covalent attachment of aptamer onto multiwalled carbon nanotubes/ionic liquid/chitosan nanocomposite modified electrode. Biosensors and Bioelectronics 43(1), 218225. Li, Y., Ji, X., Liu, B., 2011. Chemiluminescence aptasensor for cocaine based on doublefunctionalized gold nanoprobes and functionalized magnetic microbeads. Analytical and Bioanalytical Chemistry 401(1), 213-219. Lian, Y., He, F., Wang, H., Tong, F., 2015. A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus. Biosensors and Bioelectronics 65, 314-319. Liu, J., Guan, Z., Lv, Z., Jiang, X., Yang, S., Chen, A., 2014. Improving sensitivity of gold nanoparticle based fluorescence quenching and colorimetric aptasensor by using water resuspended gold nanoparticle. Biosensors & bioelectronics 52, 265-270. Luo, P., Liu, Y., Xia, Y., Xu, H., Xie, G., 2014. Aptamer biosensor for sensitive detection of toxin A of Clostridium difficile using gold nanoparticles synthesized by Bacillus stearothermophilus. Biosensors and Bioelectronics 54, 217-221. Luo, Y., Xu, J., Li, Y., Gao, H., Guo, J., Shen, F., Sun, C., 2015. A novel colorimetric aptasensor using cysteamine-stabilized gold nanoparticles as probe for rapid and specific detection of tetracycline in raw milk. Food Control 54, 7-15. Miller, T.S., Sansuk, S., E, S.P., Lai, S.C.S., Macpherson, J.V., Unwin, P.R., 2015. Pt nanoparticle modified single walled carbon nanotube network electrodes for electrocatalysis: Control of the specific surface area over three orders of magnitude. Catalysis Today 244, 136145. Mokhtarzadeh, A., Ezzati Nazhad Dolatabadi, J., Abnous, K., de la Guardia, M., Ramezani, M., 2015. Nanomaterial-based cocaine aptasensors. Biosensors and Bioelectronics 68, 95-106. Nguyen, T.H., Hardwick, S.A., Sun, T., Grattan, K.T.V., 2012. Intrinsic fluorescence-based optical fiber sensor for cocaine using a molecularly imprinted polymer as the recognition element. IEEE Sensors Journal 12(1), 255-260.
Nie, J., Zhang, D.W., Tie, C., Zhou, Y.L., Zhang, X.X., 2013. A label-free DNA hairpin biosensor for colorimetric detection of target with suitable functional DNA partners. Biosensors and Bioelectronics 49, 236-242. Qiu, L., Zhou, H., Zhu, W., Jiang, J., Shen, G., Yu, R., 2013. A novel label-free fluorescence aptamer-based sensor method for cocaine detection based on isothermal circular stranddisplacement amplification and graphene oxide absorption. New Journal of Chemistry 37(12), 3998-4003. Ramezani, M., Mohammad Danesh, N., Lavaee, P., Abnous, K., Mohammad Taghdisi, S., 2015. A novel colorimetric triple-helix molecular switch aptasensor for ultrasensitive detection of tetracycline. Biosensors and Bioelectronics 70, 181-187. Roncancio, D., Yu, H., Xu, X., Wu, S., Liu, R., Debord, J., Lou, X., Xiao, Y., 2014. A label-free aptamer-fluorophore assembly for rapid and specific detection of cocaine in biofluids. Analytical Chemistry 86(22), 11100-11106. Sakharova, N.A., Pereira, A.F.G., Antunes, J.M., Brett, C.M.A., Fernandes, J.V., 2015. Mechanical characterization of single-walled carbon nanotubes: Numerical simulation study. Composites Part B: Engineering 75, 73-85. Shi, Y., Dai, H., Sun, Y., Hu, J., Ni, P., Li, Z., 2013. Fluorescent sensing of cocaine based on a structure switching aptamer, gold nanoparticles and graphene oxide. Analyst 138(23), 71527156. Taghdisi, S.M., Emrani, S.S., Tabrizian, K., Ramezani, M., Abnous, K., Emrani, A.S., 2014. Ultrasensitive detection of lead (II) based on fluorescent aptamer-functionalized carbon nanotubes. Environmental toxicology and pharmacology 37(3), 1236-1242. Taghdisi, S.M., Lavaee, P., Ramezani, M., Abnous, K., 2011. Reversible targeting and controlled release delivery of daunorubicin to cancer cells by aptamer-wrapped carbon nanotubes. European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V 77(2), 200-206. Tagliaro, F., Antonioli, C., De Battisti, Z., Ghielmi, S., Marigo, M., 1994. Reversed-phase highperformance liquid chromatographic determination of cocaine in plasma and human hair with direct fluorimetric detection. Journal of Chromatography A 674(1-2), 207-215. Tang, X., Wang, Y.S., Xue, J.H., Zhou, B., Cao, J.X., Chen, S.H., Li, M.H., Wang, X.F., Zhu, Y.F., Huang, Y.Q., 2015. A novel strategy for dual-channel detection of metallothioneins and mercury based on the conformational switching of functional chimera aptamer. Journal of Pharmaceutical and Biomedical Analysis 107, 258-264. Tian, J., Zhao, H., Liu, M., Chen, Y., Quan, X., 2012. Detection of influenza A virus based on fluorescence resonance energy transfer from quantum dots to carbon nanotubes. Analytica Chimica Acta 723, 83-87. Wang, S., Chen, W., Liu, A.L., Hong, L., Deng, H.H., Lin, X.H., 2012. Comparison of the peroxidase-like activity of unmodified, amino-modified, and citrate-capped gold nanoparticles. ChemPhysChem 13(5), 1199-1204. Wren, S.P., Nguyen, T.H., Gascoine, P., Lacey, R., Sun, T., Grattan, K.T.V., 2014. Preparation of novel optical fibre-based Cocaine sensors using a molecular imprinted polymer approach. Sensors and Actuators, B: Chemical 193, 35-41. Wu, S., Zhang, H., Shi, Z., Duan, N., Fang, C., Dai, S., Wang, Z., 2015. Aptamer-based fluorescence biosensor for chloramphenicol determination using upconversion nanoparticles. Food Control 50, 597-604.
Yang, C., Wang, Q., Xiang, Y., Yuan, R., Chai, Y., 2014. Target-induced strand release and thionine-decorated gold nanoparticle amplification labels for sensitive electrochemical aptamerbased sensing of small molecules. Sensors and Actuators, B: Chemical 197, 149-154. Yao, J., Li, J., Owens, J., Zhong, W., 2011. Combing DNAzyme with single-walled carbon nanotubes for detection of Pb(ii) in water. Analyst 136(4), 764-768. Yoo, R., Kim, J., Song, M.J., Lee, W., Noh, J.S., 2015. Nano-composite sensors composed of single-walled carbon nanotubes and polyaniline for the detection of a nerve agent simulant gas. Sensors and Actuators, B: Chemical 209, 444-448. Zhang, D.W., Sun, C.J., Zhang, F.T., Xu, L., Zhou, Y.L., Zhang, X.X., 2012. An electrochemical aptasensor based on enzyme linked aptamer assay. Biosensors and Bioelectronics 31(1), 363368. Zhang, H., Hu, X., Fu, X., 2014. Aptamer-based microfluidic beads array sensor for simultaneous detection of multiple analytes employing multienzyme-linked nanoparticle amplification and quantum dots labels. Biosensors and Bioelectronics 57, 22-29. Zhao, B., Wu, P., Zhang, H., Cai, C., 2015a. Designing activatable aptamer probes for simultaneous detection of multiple tumor-related proteins in living cancer cells. Biosensors and Bioelectronics 68, 763-770. Zhao, F., Xie, Q., Xu, M., Wang, S., Zhou, J., Liu, F., 2015b. RNA aptamer based electrochemical biosensor for sensitive and selective detection of cAMP. Biosensors and Bioelectronics 66, 238-243. Zhou, L., Wang, J., Li, D., Li, Y., 2014. An electrochemical aptasensor based on gold nanoparticles dotted graphene modified glassy carbon electrode for label-free detection of bisphenol A in milk samples. Food Chemistry 162, 34-40.
SH
SH
SH
SH
SH SH
SH
SH
SPGE
Complimentary strand
Aptamer
Target
SWNTs
MCH
Scheme 1. Schematic description of cocaine detection based on electrochemical aptasensor. In the absence of cocaine, Apt-CS-modified electrode is intact and the SWNTs could not bind to Apt-Cs well, resulting in a weak electrochemical signal (b). In the presence of target, aptamer binds to its target, leaves the CS and the SWNTs could bind to CS well, leading to enhancement of the electrochemical signal (a).
Fig. 1. CV responses of CS-modified electrode in the presence of various concentrations of SWNTs (from bottom to top 0, 0.025, 0.05, 0.1, 0.2, 0.5, 1 mg/mL).
Fig. 2. CV responses of bare electrode (black curve), CS-modified electrode (gray curve), Apt-CS-modified electrode (red curve), Apt-CS-modified electrode + SWNTs (green curve), Apt-CS-modified electrode + Target + SWNTs (pink curve), CS-modified electrode + SWNTs (blue curve).
40
a)
Current (µA)
30
20
10
0 0
0.1
0.2
Potential (v)
b)
0.3
0.4
40
30
Current (µA)
c) 20
10
0
0
0.1
0.2
0.3
0.4
Potential (v)
Fig. 3. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in PBS (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in PBS. (c) DPV peaks of the modified electrode in the presence of cocaine (green), morphine (red), propranolol (yellow), diazepam (blue) and chloramphenicol (orange). 40
30
t (µA)
a)
20
b)
Fig. 4. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in serum (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in serum.
Scheme 1. Schematic description of cocaine detection based on electrochemical aptasensor. In the absence of cocaine, Apt-CS-modified electrode is intact and the SWNTs could not bind to Apt-Cs well, resulting in a weak electrochemical signal (b). In the presence of target, aptamer binds to its target, leaves the CS and the SWNTs could bind to CS well, leading to enhancement of the electrochemical signal (a). Fig. 1. CV responses of CS-modified electrode in the presence of various concentrations of SWNTs (from bottom to top 0, 0.025, 0.05, 0.1, 0.2, 0.5, 1 mg/mL). Fig. 2. CV responses of bare electrode (black curve), CS-modified electrode (gray curve), Apt-CS-modified electrode (red curve), Apt-CS-modified electrode + SWNTs (green curve), Apt-CS-modified electrode + Target + SWNTs (pink curve), CS-modified electrode + SWNTs (blue curve). Fig. 3. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in PBS (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in PBS. (c) DPV peaks of the modified electrode in the presence of cocaine (green), morphine (red), propranolol (yellow), diazepam (blue) and chloramphenicol (orange). Fig. 4. (a) DPV peaks of the modified electrode in the presence of various concentrations of cocaine in serum (from bottom to top 0, 0.1, 0.3, 0.8, 2, 5, 10, 25, 50 nM). (b) Cocaine standard curve in serum.
highlights * Cocaine is a powerful central nervous system stimulant. * Abuse of cocaine causes cardiac arrest, organ damage, spread of human immunodeficiency and anxiety and its addiction is a serious worldwide problem. *In this study, we designed a novel electrochemical aptasensor based on singlewalled carbon nanotubes (SWNTs), gold electrode and complimentary strand of aptamer (CS) for ultrasensitive detection of cocaine.
* This electrochemical aptasensor inherits properties of SWNTs and gold such as large surface area and high electrochemical conductivity, as well as high affinity and selectivity of aptamer toward its target and property of CS to improve the sensitivity of designed sensor. * The designed electrochemical aptasensor showed good selectivity toward cocaine with a limit of detection (LOD) as low as 105 pM. * Moreover, the fabricated electrochemical aptasensor was successfully applied to detect cocaine in serum with a LOD as low as 136 pM.