- Email: [email protected]
A novel high-resolution melting analysis-based method for Salmonella genotyping
Journal of Microbiological Methods 172 (2020) 105806
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
A novel high-resolution melting analysis-based method for Salmonella genotyping Miaomiao Hua,1, Dong Yangc,1, Xiaoli Wub, Meng Luoa, Feng Xua,
T
⁎
a
Jiangxi-OAI Joint Research Institute, Nanchang University, 235 Nanjing East Road, Nanchang 330047, China College of Basic Medicine, Jiangxi University of Traditional Chinese Medicine, Nanchang 330004, China c Tongji School of Pharmacy, Huazhong University of Science and Technology, Wuhan 430030, China b
ARTICLE INFO
ABSTRACT
Keywords: High-resolution melting curve Genotyping Salmonella DNA denaturants Melting temperature
To establish a simple and rapid high-resolution melting curve (HRM) method, 5 different strains of Salmonella were identified by adding DNA denaturants at different concentrations into the HRM system to change the characteristics of DNA melting and to obtain different Tm (dissolving temperature) values of DNA from different target bacteria. When the concentration of n-butanol was 7% (v/v), the Tm value of the melting curve of the 5 strains changed from 89 °C to 80.5 °C, 81.5 °C, 79.5 °C, 81.0 °C and 82.5 °C, respectively. The sensitivity and specificity of the proposed method were both over 90% in the detection of 270 spiked milk powder samples. In summary, the proposed method in this study has potential for application to food safety and epidemiological research on Salmonella infection.
1. Introduction Salmonella is a member of the family Enterobacteriaceae, which is widely found in meat, eggs, poultry, seafood, dairy products, vegetables, etc. Salmonella infection may increase the risk of damage to mucosal and skin surface commonly, destroying the immune barrier and may even cause hematogenous invasive infections leading to death in severe cases (Pashazadeh et al., 2017; Aaydha et al., 2019). Accordingly, there is a need to trace Salmonella contamination rapidly and accurately, to effectively prevent and control the spread of Salmonella. As a traditional typing method, serotyping is always used in Salmonella typing, with over 2500 serotypes currently identified (Bratchikov and Mauricas, 2011). However, the proposed method has many disadvantages, such as complex operation, prolonged duration of detection and low accuracy in result determination, which makes fast tracing far from satisfactory (Giovannacci et al., 2001). Therefore, it is particularly important to choose a molecular typing method with high speed, simplicity, high resolution, and good reproducibility. With the rapid development of modern molecular biology technology, molecular typing is being widely used in food pollution source tracing and epidemiological investigation, such as ribosome typing (Roberto et al., 2017), restriction fragment length polymorphism (Sharma and Changotra, 2017), amplified fragment length polymorphism (Torpdahl and Ahrens, 2010), multilocus sequence typing
(Liu et al., 2011), pulsed-field gel electrophoresis (Thompson et al., 2007) and genome-wide sequencing (Leekitcharoenphon et al., 2014). In the high-resolution melting curve (HRM) method, melting temperature (Tm) is used to analyze differences in a single nucleotide of a DNA sequence. Moreover, it has the advantages of low cost, high throughput, high speed, accurate results and no limitation in detection site, resulting in the achievement of real closed-tube operation and avoiding cross-contamination common in the processes of other molecular typing methods (Liew et al., 2004; Ravansalar et al., 2016). Meanwhile, HRM analysis has a major part to play in single nucleotide polymorphism analysis (Reed and Wittwer, 2004), methylation analysis (Wojdacz et al., 2008) and genotyping (Merkouropoulos et al., 2016). In the genotyping of Salmonella, the Tm values of many Salmonella species are basically the same due to the small genetic differences between species and strains of the same genus, leading to a failure to distinguish using conventional HRM. In order to expand the application of HRM in Salmonella genotyping, it is proposed to modify HRM by screening different DNA denaturants and increase Tm value differences to obtain a simple method to distinguish Salmonella. This study is of great significance for the effective prevention and control of Salmonella infection, and also provides a more rapid and convenient detection method for related epidemiological studies.
Corresponding author. E-mail addresses: [email protected], [email protected] (F. Xu). 1 Joint corresponding author. ⁎
https://doi.org/10.1016/j.mimet.2019.105806 Received 7 October 2019; Received in revised form 4 December 2019; Accepted 10 December 2019 Available online 11 December 2019 0167-7012/ © 2019 Elsevier B.V. All rights reserved.
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 1. PCR amplification of DNA from target bacteria: (A) Specific PCR amplification of Salmonella (size of amplicon, 250 bp): No 1: Salmonella Typhimurium ATCC 13311, No 2: Salmonella Choleraesuis ATCC 10708, No 3: Salmonella Heidelberg ATCC 8326, No 4: Salmonella Enteritidis ATCC 13076, No 5: Salmonella Paratyphi A ATCC 9150, No C: negative control, No marker: DL2000 DNA marker, the minimum gradient of 100 bp (Takela, China), (B) the results of base sequence comparison of PCR amplification products of the 5 strains.
2. Materials and methods
Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150.
2.1. materials and reagents
2.2. 2.2 DNA template extraction
Five Salmonella strains were obtained from Jiangxi Center for Disease Control to develop this method, including strain Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708,
The above five strains were cultured in liquid LB medium for 24 h at 37 °C. Then, 1 mL of bacterial solution was taken and DNA was 2
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. Novel HRM genotyping of five different Salmonella strains. (A) melting curve of the 5 Salmonella strains without n-butanol in the HRM system, (B) melting peak of the 5 Salmonella strains without n-butanol in the HRM system, (C) melting curve of the 5 Salmonella strains with 1% (v/v) n-butanol in the HRM system, (D) melting peak of the 5 Salmonella strains with 1% (v/v) n-butanol in the HRM system, (E) melting curve of the 5 Salmonella strains with 2.5% (v/v) n-butanol in the HRM system, (F) melting peak of the 5 Salmonella strains with 2.5% (v/v) n-butanol in the HRM system, (G) melting curve of the 5 Salmonella strains with 5% (v/v) nbutanol in the HRM system, (H) melting peak of the 5 Salmonella strains with 5% (v/v) n-butanol in the HRM system, (I) melting curve of the 5 Salmonella strains with 7% (v/v) n-butanol in the HRM system， (J) melting peak of the 5 Salmonella strains with 7% (v/v) n-butanol in the HRM system. 3
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. (continued)
extracted according to the Bacterial Genomic DNA Extraction Kit (Solarbio, China) instructions, and DNA was extracted and stored as a reaction template at −20 °C for use.
2.3. Primer design The sequences of all target genes were downloaded from the 4
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. (continued)
5
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. (continued)
National Center for Biotechnology Information (https://www.ncbi.nlm. nih.gov/). Premier 5 software was used for sequence blast of 5 Salmonella strains. Primer sequences were designed based on mutation sites and related conserved fragments in 16 s rRNA gene (F: 5 ‘–CGAA GAACCTTACCTGGTCTTG – 3′, R: 5 ‘–GCCATGATGACTTGACGTCA– 3′) from the 5 strains (in section 2.1). The designed primers were subjected to Blast alignment on the National Center for Biotechnology Information to verify the conservation of the primers. All primers and probes were synthesized by Sangon Biotech (Shanghai, China).
3. Results 3.1. PCR amplification of DNA from target bacteria As illustrated in Fig. 1A, the molecular weight of the amplified DNA fragments of Salmonella was about 250 bp, which was in line with the amplification fragment size using the 16S primers described in Section 2.3, highlighting their potential to be used in subsequent HRM analysis. Furthermore, 97.72% amplified fragments of the 5 strains were identical (Fig. 1 B), yet with differences in individual base pairs.
2.4. PCR
3.2. Modified HRM genotyping of 5 Salmonella strains
PCR reactants (50 μL) included 25 μL 2 × Taq mixture, 1 μL target DNA template, and 2.5 μL 200-nM primer, with reaction volume adjusted to 50 μL using sterile water. The PCR procedure was as follows: 30 cycles of predenaturation at 95 °C for 10 min, denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, and additional extension at 72 °C for 10 min.
The experiment was carried out in 5 Salmonella strains with different genotypes. By adding cyclophosphamide, formamide, urea, and n-butanol at different concentrations to the HRM system, the Tm values of cyclophosphamide, formamide, and urea changed at different concentrations (Supplemental Fig. 1–3). However, no differences were found in Tm values among different Salmonella stains, leading to the overlap of corresponding melting curves and failure in Salmonella genotyping. However, n-butanol showed a unique role shown in Fig. 2 melting curves following the addition of 0% (v/v), 1% (v/v), 2.5% (v/ v), 5% (v/v) and 7% (v/v) n-butanol in the reaction system. Without nbutanol, the Tm values of the 5 strains were all 89 °C (Fig. 2 A, 2 B). With the addition of 1% (v/v), 2.5% (v/v) and 5% (v/v) n-butanol into the reaction system, the Tm values of the 5 strains decreased, without significant differences (Fig. 2 CeH). With 7% (v/v) n-butanol (Fig. 2 I, 2 J), the differences in the Tm values of the melting curves were 80.5 °C, 81.5 °C, 79.5 °C, 81.0 °C and 82.5 °C respectively for Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708, Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150, which could be used to distinguish different Salmonella strains.
2.5. Analysis of denaturants in the HRM system Modified HRM analysis was performed by adding denaturants into PCR products. The denaturants included formamide, urea, cyclophosphamide, and n-butanol (Tianjin Yongda, China). The system contained 10 μL PCR products, denaturants at different dosages and 2 μL LC Green (Sigma, America) dye, with a final volume of 20 μL filled with water. Then, the melting curves ranging from 50 °C to 95 °C with, resolution of 0.1 °C were analyzed using fluorescence quantitative PCR (Applied Biosystems, America). 2.6. Verification with standardized samples For the verification of the potential applicability and efficiency of the proposed method, double-blind detection of artificially contaminated milk was carried out in 250 samples artificially contaminated by 105 CFU/mL Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708, Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150, with 50 copies of each stain added. Additionally, 20 milk samples without any bacteria were used as negative samples. All spiked samples were analyzed by modified HRM.
Table 1 Detection of spiked samples. Strain Salmonella Salmonella Salmonella Salmonella Salmonella
6
Typhimurium ATCC 13311 Choleraesuis ATCC 10708 Heidelberg ATCC 8326 Enteritidis ATCC 13076 Paratyphi A ATCC 9150
Number of checkouts
Positive rate
49 48 48 49 47
98% 96% 96% 98% 94%
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
3.3. Verification of modified HRM in standardized samples
Author statement
For evaluating the sensitivity of the modified HRM in detecting Salmonella in food, Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708, Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150 was added artificially to the samples to be analyzed by the modified HRM. A total of 20 milk samples were identified by modified HRM [n-butanol accounting for 7% of the reaction system (v/v)]. As shown in Table 1, the detection rates of ATCC 13311, ATCC 10708, ATCC 8326, ATCC 13076 and ATCC 9150 were 98%, 96%, 96%, 98% and 94%, respectively. The detection rate of negative samples was 100%. It suggested that the modified HRM has high reliability and potential applicability.
I have made substantial contributions to the conception or design of the work; or the acquisition, analysis, or interpretation of data for the work. I have drafted the work or revised it critically for important intellectual content; AND I have approved the final version to be published. I agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All persons who have made substantial contributions to the work reported in the manuscript, including those who provided editing and writing assistance but who are not authors, are named in the Acknowledgments section of the manuscript and have given their written permission to be named. If the manuscript does not include Acknowledgments, it is because the authors have not received substantial contributions from nonauthors.
4. Discussion
Declaration of Competing Interest
During HRM analysis, there is a need to select specific sequences and design different primers to obtain different Tm values in some cases (Bratchikov and Mauricas, 2011; Souza and Falcão, 2012), and specific software was used to further optimize HRM analysis in other cases (Ganopoulos et al., 2018). However, these HRM methods do not yet possess the capability to distinguish samples with the same Tm value. The present study was carried out without the need to target specific genes or use new analysis software. Rapid identification of different Salmonella strains with the same Tm value was achieved by expanding the 16S region and simply adding n-butanol. The hydrogen bond between purines and pyrimidines in DNA molecules is one of the main factors affecting the Tm value (Šponer et al., 2001). Dannenberg has found that hydrogen bonds are mainly characterized by electrostatic interaction and polarization (Dannenberg et al., 1999). N-butanol in aqueous solution can form negative ions by losing hydrogen ions to exert strong electrostatic interaction with hydrogen bonds, thus interfering with the structure of hydrogen bonds (Di Michele et al., 2004; Silva et al., 2014; Stone, 2017). In this experiment, the hydrogen bond of nucleic acids was changed by adding n-butanol to change the characteristics of DNA melting. Consequently, n-butanol resulted in significant differences in Tm values for nucleic acid molecules with different sequences. In addition, the addition of guanidine hydrochloride produced slight upregulation of the Tm value, which was contrary to other reagents, but led to a rapid decline in the response value of HRM. Therefore, the use of guanidine hydrochloride alone is not suitable for HRM analysis. It expected to explore the mixing ratio of guanidine hydrochloride and nbutanol in the future to further increase the difference in Tm value. Moreover, DNA modifiers, such as determinants, hydroxylates and alkylators, are planned to be added in future experiments to modify different DNA by differential methylation, so as to change the molecular structure of DNA and further increase the Tm differences among strains. Due to the limited species of Salmonella strains preserved in the laboratory, this study failed to perform large-scale typing for different serotypes of Salmonella. It is expected that more strains will be obtained in the future to verify the application of the proposed method. In conclusion, this study established a method of Salmonella genotyping by the Tm value of HRM analysis, which displayed differential melting curves of different Salmonella rapidly and sensitively. The detection rates of the spiked samples were over 90%, highlighting the stability and reliability of the obtained results in this study.
No conflict of interest declared. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mimet.2019.105806. References Aaydha, C.V., Tien, A.N., Krishna, K., Pia, E., Vivek, P.D., Mohammad-Ali, S., Anders, W., Dang, D.B., 2019. Biosens. Bioelectron. 129, 224–230. Bratchikov, M., Mauricas, M., 2011. Development of a multiple-run high-resolution melting assay for Salmonella spp. genotyping hrm application for salmonella spp. subtyping. Diagn. Microbiol. Infect. Dis. 71, 192–200. Dannenberg, J.J., Haskamp, L., Masunov, A., 1999. Are hydrogen bonds covalent or electrostatic? A molecular orbital comparison of molecules in electric fields and hbonding environments. J. Phys. Chem. A 103, 7083–7086. Di Michele, A., Freda, M., Onori, G., Santucci, A., 2004. Hydrogen bonding of water in aqueous solutions of trimethylamine-N-oxide and tert-butyl alcohol: a near-infrared spectroscopy study. J. Phys. Chem. A 108, 6145–6150. Ganopoulos, I., Mylona, P., Mellidou, I., Kalivas, A., Bosmali, I., Kontzidou, S., Osathanunkul, M., Madesis, Panagiotis, 2018. Microsatellite genotyping and molecular screening of pea (Pisum sativum L.) germplasm with high-resolution melting analysis for resistance to powdery mildew. Plant Gene. 15, 1–5. Giovannacci, I., Queguiner, S., Ragimbeau, C., Salvat, G., Vendeuvre, J.L., Carlier, V., Ermel, G., 2001. Tracing of salmonella spp. in two pork slaughter and cutting plants using serotyping and macrorestriction genotyping. J. Appl. Microbiol. 90, 17–21. Leekitcharoenphon, P., Nielsen, E.M., Kaas, R.S., Lund, O., Aarestrup, F.M., 2014. Evaluation of whole genome sequencing for outbreak detection of salmonella enterica. PLoS One 9, 87991–87998. Liew, M., Pryor, R., Palais, R., Meadows, C., Erali, M., Lyon, E., Wittwer, C., 2004. Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clin. Chem. 50, 1156–1164. Liu, W.B., Liu, B., Zhu, X.N., Yu, S.J., Shi, X.M., 2011. Diversity of salmonella isolates using serotyping and multilocus sequence typing. Food Microbiol. 28, 1182–1189. Merkouropoulos, G., Ganopoulos, I., Tsaftaris, A., Papadopoulos, I., Drogoudi, P., 2016. Combination of high resolution melting (HRM) analysis and ssr molecular markers speeds up plum genotyping: case study genotyping the greek plum genebank collection. Plant Genetic Resour. 15, 366–375. Pashazadeh, P., Mokhtarzadeh, A., Hasanzadeh, M., Hejazi, M., Hashemi, M., De, lG M., 2017. Nano-materials for use in sensing of salmonella infections: recent advances. Biosens. Bioelectron. 87, 1050–1064. Ravansalar, H., Tadayon, K., Ghazvini, K., 2016. Molecular typing methods used in studies of mycobacterium tuberculosis in Iran: a systematic review. Iran. J. Microbiol. 8, 338–346. Reed, G.H., Wittwer, C.T., 2004. Sensitivity and specificity of single-nucleotide polymorphism scanning by high-resolution melting analysis. Clin. Chem. 50, 1748–1754. Roberto, V., Lee, M.K., Barry, N.K., Mark, A., Federico, P., Dror, M., Dubert, M.G., Keith, S.K., Latania, K.L., Maria, V.V., Robert, A.B., 2017. A comparison of molecular typing methods applied to enterobacter cloacae complex: hsp60 sequencing, rep-PCR, and MLST. Pathog. Immun. 2, 2469–2964. Sharma, A., Changotra, H., 2017. Novel artificial restriction fragment length polymorphism methods for genotyping immunity-related GTPase M promoter polymorphisms. Inflamm. Bowel Dis. 23, E52–E53. Silva, J.A.B.D., Moreira, F.G.B., Santos, V.M.L.D., Longo, R.L., 2014. Topological analyses and small-world patterns of hydrogen bond networks in water + t-butanol, water + n-butanol and water + ammonia mixtures. Phys. Chem. Chem. Phys. 16, 19479–19491. Souza, R.A., Falcão, J.P., 2012. A novel high-resolution melting analysis-based method for
Acknowledgments This work was supported by National Natural Science Foundation (31260363, 31000048, 31260263), and Hundred People Overseas Training Project of Jiangxi Association for Acience and Technology (2016). 7
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al. yersinia pseudotuberculosis genotyping. J. Microbiol. Methods 91, 329–335. Šponer, J., Leszczynski, J., Hobza, P., 2001. Hydrogen bonding, stacking and cation binding of DNA bases. J. Mol. Struct. Theochem. 573, 43–53. Stone, A.J., 2017. Natural bond orbitals and the nature of the hydrogen bond. J. Phys. Chem. A 122, 1531–1534. Thompson, C.J., Mckean, J.D., O’Connor, A.M., 2007. Pulse-field-gel-electrophoresis
development for salmonella species using PaeR7 I. enzyme. 6, 496–497. Torpdahl, M., Ahrens, P., 2010. Population structure of salmonella investigated by amplified fragment length polymorphism. J. Appl. Microbiol. 97, 566–573. Wojdacz, T.K., Dobrovic, A., Hansen, L.L., 2008. Methylation-sensitive high-resolution melting. Nat. Protoc. 3, 1903–1908.
8
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
A novel high-resolution melting analysis-based method for Salmonella genotyping Miaomiao Hua,1, Dong Yangc,1, Xiaoli Wub, Meng Luoa, Feng Xua,
T
⁎
a
Jiangxi-OAI Joint Research Institute, Nanchang University, 235 Nanjing East Road, Nanchang 330047, China College of Basic Medicine, Jiangxi University of Traditional Chinese Medicine, Nanchang 330004, China c Tongji School of Pharmacy, Huazhong University of Science and Technology, Wuhan 430030, China b
ARTICLE INFO
ABSTRACT
Keywords: High-resolution melting curve Genotyping Salmonella DNA denaturants Melting temperature
To establish a simple and rapid high-resolution melting curve (HRM) method, 5 different strains of Salmonella were identified by adding DNA denaturants at different concentrations into the HRM system to change the characteristics of DNA melting and to obtain different Tm (dissolving temperature) values of DNA from different target bacteria. When the concentration of n-butanol was 7% (v/v), the Tm value of the melting curve of the 5 strains changed from 89 °C to 80.5 °C, 81.5 °C, 79.5 °C, 81.0 °C and 82.5 °C, respectively. The sensitivity and specificity of the proposed method were both over 90% in the detection of 270 spiked milk powder samples. In summary, the proposed method in this study has potential for application to food safety and epidemiological research on Salmonella infection.
1. Introduction Salmonella is a member of the family Enterobacteriaceae, which is widely found in meat, eggs, poultry, seafood, dairy products, vegetables, etc. Salmonella infection may increase the risk of damage to mucosal and skin surface commonly, destroying the immune barrier and may even cause hematogenous invasive infections leading to death in severe cases (Pashazadeh et al., 2017; Aaydha et al., 2019). Accordingly, there is a need to trace Salmonella contamination rapidly and accurately, to effectively prevent and control the spread of Salmonella. As a traditional typing method, serotyping is always used in Salmonella typing, with over 2500 serotypes currently identified (Bratchikov and Mauricas, 2011). However, the proposed method has many disadvantages, such as complex operation, prolonged duration of detection and low accuracy in result determination, which makes fast tracing far from satisfactory (Giovannacci et al., 2001). Therefore, it is particularly important to choose a molecular typing method with high speed, simplicity, high resolution, and good reproducibility. With the rapid development of modern molecular biology technology, molecular typing is being widely used in food pollution source tracing and epidemiological investigation, such as ribosome typing (Roberto et al., 2017), restriction fragment length polymorphism (Sharma and Changotra, 2017), amplified fragment length polymorphism (Torpdahl and Ahrens, 2010), multilocus sequence typing
(Liu et al., 2011), pulsed-field gel electrophoresis (Thompson et al., 2007) and genome-wide sequencing (Leekitcharoenphon et al., 2014). In the high-resolution melting curve (HRM) method, melting temperature (Tm) is used to analyze differences in a single nucleotide of a DNA sequence. Moreover, it has the advantages of low cost, high throughput, high speed, accurate results and no limitation in detection site, resulting in the achievement of real closed-tube operation and avoiding cross-contamination common in the processes of other molecular typing methods (Liew et al., 2004; Ravansalar et al., 2016). Meanwhile, HRM analysis has a major part to play in single nucleotide polymorphism analysis (Reed and Wittwer, 2004), methylation analysis (Wojdacz et al., 2008) and genotyping (Merkouropoulos et al., 2016). In the genotyping of Salmonella, the Tm values of many Salmonella species are basically the same due to the small genetic differences between species and strains of the same genus, leading to a failure to distinguish using conventional HRM. In order to expand the application of HRM in Salmonella genotyping, it is proposed to modify HRM by screening different DNA denaturants and increase Tm value differences to obtain a simple method to distinguish Salmonella. This study is of great significance for the effective prevention and control of Salmonella infection, and also provides a more rapid and convenient detection method for related epidemiological studies.
Corresponding author. E-mail addresses: [email protected], [email protected] (F. Xu). 1 Joint corresponding author. ⁎
https://doi.org/10.1016/j.mimet.2019.105806 Received 7 October 2019; Received in revised form 4 December 2019; Accepted 10 December 2019 Available online 11 December 2019 0167-7012/ © 2019 Elsevier B.V. All rights reserved.
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 1. PCR amplification of DNA from target bacteria: (A) Specific PCR amplification of Salmonella (size of amplicon, 250 bp): No 1: Salmonella Typhimurium ATCC 13311, No 2: Salmonella Choleraesuis ATCC 10708, No 3: Salmonella Heidelberg ATCC 8326, No 4: Salmonella Enteritidis ATCC 13076, No 5: Salmonella Paratyphi A ATCC 9150, No C: negative control, No marker: DL2000 DNA marker, the minimum gradient of 100 bp (Takela, China), (B) the results of base sequence comparison of PCR amplification products of the 5 strains.
2. Materials and methods
Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150.
2.1. materials and reagents
2.2. 2.2 DNA template extraction
Five Salmonella strains were obtained from Jiangxi Center for Disease Control to develop this method, including strain Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708,
The above five strains were cultured in liquid LB medium for 24 h at 37 °C. Then, 1 mL of bacterial solution was taken and DNA was 2
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. Novel HRM genotyping of five different Salmonella strains. (A) melting curve of the 5 Salmonella strains without n-butanol in the HRM system, (B) melting peak of the 5 Salmonella strains without n-butanol in the HRM system, (C) melting curve of the 5 Salmonella strains with 1% (v/v) n-butanol in the HRM system, (D) melting peak of the 5 Salmonella strains with 1% (v/v) n-butanol in the HRM system, (E) melting curve of the 5 Salmonella strains with 2.5% (v/v) n-butanol in the HRM system, (F) melting peak of the 5 Salmonella strains with 2.5% (v/v) n-butanol in the HRM system, (G) melting curve of the 5 Salmonella strains with 5% (v/v) nbutanol in the HRM system, (H) melting peak of the 5 Salmonella strains with 5% (v/v) n-butanol in the HRM system, (I) melting curve of the 5 Salmonella strains with 7% (v/v) n-butanol in the HRM system， (J) melting peak of the 5 Salmonella strains with 7% (v/v) n-butanol in the HRM system. 3
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. (continued)
extracted according to the Bacterial Genomic DNA Extraction Kit (Solarbio, China) instructions, and DNA was extracted and stored as a reaction template at −20 °C for use.
2.3. Primer design The sequences of all target genes were downloaded from the 4
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. (continued)
5
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
Fig. 2. (continued)
National Center for Biotechnology Information (https://www.ncbi.nlm. nih.gov/). Premier 5 software was used for sequence blast of 5 Salmonella strains. Primer sequences were designed based on mutation sites and related conserved fragments in 16 s rRNA gene (F: 5 ‘–CGAA GAACCTTACCTGGTCTTG – 3′, R: 5 ‘–GCCATGATGACTTGACGTCA– 3′) from the 5 strains (in section 2.1). The designed primers were subjected to Blast alignment on the National Center for Biotechnology Information to verify the conservation of the primers. All primers and probes were synthesized by Sangon Biotech (Shanghai, China).
3. Results 3.1. PCR amplification of DNA from target bacteria As illustrated in Fig. 1A, the molecular weight of the amplified DNA fragments of Salmonella was about 250 bp, which was in line with the amplification fragment size using the 16S primers described in Section 2.3, highlighting their potential to be used in subsequent HRM analysis. Furthermore, 97.72% amplified fragments of the 5 strains were identical (Fig. 1 B), yet with differences in individual base pairs.
2.4. PCR
3.2. Modified HRM genotyping of 5 Salmonella strains
PCR reactants (50 μL) included 25 μL 2 × Taq mixture, 1 μL target DNA template, and 2.5 μL 200-nM primer, with reaction volume adjusted to 50 μL using sterile water. The PCR procedure was as follows: 30 cycles of predenaturation at 95 °C for 10 min, denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, and additional extension at 72 °C for 10 min.
The experiment was carried out in 5 Salmonella strains with different genotypes. By adding cyclophosphamide, formamide, urea, and n-butanol at different concentrations to the HRM system, the Tm values of cyclophosphamide, formamide, and urea changed at different concentrations (Supplemental Fig. 1–3). However, no differences were found in Tm values among different Salmonella stains, leading to the overlap of corresponding melting curves and failure in Salmonella genotyping. However, n-butanol showed a unique role shown in Fig. 2 melting curves following the addition of 0% (v/v), 1% (v/v), 2.5% (v/ v), 5% (v/v) and 7% (v/v) n-butanol in the reaction system. Without nbutanol, the Tm values of the 5 strains were all 89 °C (Fig. 2 A, 2 B). With the addition of 1% (v/v), 2.5% (v/v) and 5% (v/v) n-butanol into the reaction system, the Tm values of the 5 strains decreased, without significant differences (Fig. 2 CeH). With 7% (v/v) n-butanol (Fig. 2 I, 2 J), the differences in the Tm values of the melting curves were 80.5 °C, 81.5 °C, 79.5 °C, 81.0 °C and 82.5 °C respectively for Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708, Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150, which could be used to distinguish different Salmonella strains.
2.5. Analysis of denaturants in the HRM system Modified HRM analysis was performed by adding denaturants into PCR products. The denaturants included formamide, urea, cyclophosphamide, and n-butanol (Tianjin Yongda, China). The system contained 10 μL PCR products, denaturants at different dosages and 2 μL LC Green (Sigma, America) dye, with a final volume of 20 μL filled with water. Then, the melting curves ranging from 50 °C to 95 °C with, resolution of 0.1 °C were analyzed using fluorescence quantitative PCR (Applied Biosystems, America). 2.6. Verification with standardized samples For the verification of the potential applicability and efficiency of the proposed method, double-blind detection of artificially contaminated milk was carried out in 250 samples artificially contaminated by 105 CFU/mL Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708, Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150, with 50 copies of each stain added. Additionally, 20 milk samples without any bacteria were used as negative samples. All spiked samples were analyzed by modified HRM.
Table 1 Detection of spiked samples. Strain Salmonella Salmonella Salmonella Salmonella Salmonella
6
Typhimurium ATCC 13311 Choleraesuis ATCC 10708 Heidelberg ATCC 8326 Enteritidis ATCC 13076 Paratyphi A ATCC 9150
Number of checkouts
Positive rate
49 48 48 49 47
98% 96% 96% 98% 94%
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al.
3.3. Verification of modified HRM in standardized samples
Author statement
For evaluating the sensitivity of the modified HRM in detecting Salmonella in food, Salmonella Typhimurium ATCC 13311, Salmonella Choleraesuis ATCC 10708, Salmonella Heidelberg ATCC 8326, Salmonella Enteritidis ATCC 13076 and Salmonella Paratyphi A ATCC 9150 was added artificially to the samples to be analyzed by the modified HRM. A total of 20 milk samples were identified by modified HRM [n-butanol accounting for 7% of the reaction system (v/v)]. As shown in Table 1, the detection rates of ATCC 13311, ATCC 10708, ATCC 8326, ATCC 13076 and ATCC 9150 were 98%, 96%, 96%, 98% and 94%, respectively. The detection rate of negative samples was 100%. It suggested that the modified HRM has high reliability and potential applicability.
I have made substantial contributions to the conception or design of the work; or the acquisition, analysis, or interpretation of data for the work. I have drafted the work or revised it critically for important intellectual content; AND I have approved the final version to be published. I agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All persons who have made substantial contributions to the work reported in the manuscript, including those who provided editing and writing assistance but who are not authors, are named in the Acknowledgments section of the manuscript and have given their written permission to be named. If the manuscript does not include Acknowledgments, it is because the authors have not received substantial contributions from nonauthors.
4. Discussion
Declaration of Competing Interest
During HRM analysis, there is a need to select specific sequences and design different primers to obtain different Tm values in some cases (Bratchikov and Mauricas, 2011; Souza and Falcão, 2012), and specific software was used to further optimize HRM analysis in other cases (Ganopoulos et al., 2018). However, these HRM methods do not yet possess the capability to distinguish samples with the same Tm value. The present study was carried out without the need to target specific genes or use new analysis software. Rapid identification of different Salmonella strains with the same Tm value was achieved by expanding the 16S region and simply adding n-butanol. The hydrogen bond between purines and pyrimidines in DNA molecules is one of the main factors affecting the Tm value (Šponer et al., 2001). Dannenberg has found that hydrogen bonds are mainly characterized by electrostatic interaction and polarization (Dannenberg et al., 1999). N-butanol in aqueous solution can form negative ions by losing hydrogen ions to exert strong electrostatic interaction with hydrogen bonds, thus interfering with the structure of hydrogen bonds (Di Michele et al., 2004; Silva et al., 2014; Stone, 2017). In this experiment, the hydrogen bond of nucleic acids was changed by adding n-butanol to change the characteristics of DNA melting. Consequently, n-butanol resulted in significant differences in Tm values for nucleic acid molecules with different sequences. In addition, the addition of guanidine hydrochloride produced slight upregulation of the Tm value, which was contrary to other reagents, but led to a rapid decline in the response value of HRM. Therefore, the use of guanidine hydrochloride alone is not suitable for HRM analysis. It expected to explore the mixing ratio of guanidine hydrochloride and nbutanol in the future to further increase the difference in Tm value. Moreover, DNA modifiers, such as determinants, hydroxylates and alkylators, are planned to be added in future experiments to modify different DNA by differential methylation, so as to change the molecular structure of DNA and further increase the Tm differences among strains. Due to the limited species of Salmonella strains preserved in the laboratory, this study failed to perform large-scale typing for different serotypes of Salmonella. It is expected that more strains will be obtained in the future to verify the application of the proposed method. In conclusion, this study established a method of Salmonella genotyping by the Tm value of HRM analysis, which displayed differential melting curves of different Salmonella rapidly and sensitively. The detection rates of the spiked samples were over 90%, highlighting the stability and reliability of the obtained results in this study.
No conflict of interest declared. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mimet.2019.105806. References Aaydha, C.V., Tien, A.N., Krishna, K., Pia, E., Vivek, P.D., Mohammad-Ali, S., Anders, W., Dang, D.B., 2019. Biosens. Bioelectron. 129, 224–230. Bratchikov, M., Mauricas, M., 2011. Development of a multiple-run high-resolution melting assay for Salmonella spp. genotyping hrm application for salmonella spp. subtyping. Diagn. Microbiol. Infect. Dis. 71, 192–200. Dannenberg, J.J., Haskamp, L., Masunov, A., 1999. Are hydrogen bonds covalent or electrostatic? A molecular orbital comparison of molecules in electric fields and hbonding environments. J. Phys. Chem. A 103, 7083–7086. Di Michele, A., Freda, M., Onori, G., Santucci, A., 2004. Hydrogen bonding of water in aqueous solutions of trimethylamine-N-oxide and tert-butyl alcohol: a near-infrared spectroscopy study. J. Phys. Chem. A 108, 6145–6150. Ganopoulos, I., Mylona, P., Mellidou, I., Kalivas, A., Bosmali, I., Kontzidou, S., Osathanunkul, M., Madesis, Panagiotis, 2018. Microsatellite genotyping and molecular screening of pea (Pisum sativum L.) germplasm with high-resolution melting analysis for resistance to powdery mildew. Plant Gene. 15, 1–5. Giovannacci, I., Queguiner, S., Ragimbeau, C., Salvat, G., Vendeuvre, J.L., Carlier, V., Ermel, G., 2001. Tracing of salmonella spp. in two pork slaughter and cutting plants using serotyping and macrorestriction genotyping. J. Appl. Microbiol. 90, 17–21. Leekitcharoenphon, P., Nielsen, E.M., Kaas, R.S., Lund, O., Aarestrup, F.M., 2014. Evaluation of whole genome sequencing for outbreak detection of salmonella enterica. PLoS One 9, 87991–87998. Liew, M., Pryor, R., Palais, R., Meadows, C., Erali, M., Lyon, E., Wittwer, C., 2004. Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clin. Chem. 50, 1156–1164. Liu, W.B., Liu, B., Zhu, X.N., Yu, S.J., Shi, X.M., 2011. Diversity of salmonella isolates using serotyping and multilocus sequence typing. Food Microbiol. 28, 1182–1189. Merkouropoulos, G., Ganopoulos, I., Tsaftaris, A., Papadopoulos, I., Drogoudi, P., 2016. Combination of high resolution melting (HRM) analysis and ssr molecular markers speeds up plum genotyping: case study genotyping the greek plum genebank collection. Plant Genetic Resour. 15, 366–375. Pashazadeh, P., Mokhtarzadeh, A., Hasanzadeh, M., Hejazi, M., Hashemi, M., De, lG M., 2017. Nano-materials for use in sensing of salmonella infections: recent advances. Biosens. Bioelectron. 87, 1050–1064. Ravansalar, H., Tadayon, K., Ghazvini, K., 2016. Molecular typing methods used in studies of mycobacterium tuberculosis in Iran: a systematic review. Iran. J. Microbiol. 8, 338–346. Reed, G.H., Wittwer, C.T., 2004. Sensitivity and specificity of single-nucleotide polymorphism scanning by high-resolution melting analysis. Clin. Chem. 50, 1748–1754. Roberto, V., Lee, M.K., Barry, N.K., Mark, A., Federico, P., Dror, M., Dubert, M.G., Keith, S.K., Latania, K.L., Maria, V.V., Robert, A.B., 2017. A comparison of molecular typing methods applied to enterobacter cloacae complex: hsp60 sequencing, rep-PCR, and MLST. Pathog. Immun. 2, 2469–2964. Sharma, A., Changotra, H., 2017. Novel artificial restriction fragment length polymorphism methods for genotyping immunity-related GTPase M promoter polymorphisms. Inflamm. Bowel Dis. 23, E52–E53. Silva, J.A.B.D., Moreira, F.G.B., Santos, V.M.L.D., Longo, R.L., 2014. Topological analyses and small-world patterns of hydrogen bond networks in water + t-butanol, water + n-butanol and water + ammonia mixtures. Phys. Chem. Chem. Phys. 16, 19479–19491. Souza, R.A., Falcão, J.P., 2012. A novel high-resolution melting analysis-based method for
Acknowledgments This work was supported by National Natural Science Foundation (31260363, 31000048, 31260263), and Hundred People Overseas Training Project of Jiangxi Association for Acience and Technology (2016). 7
Journal of Microbiological Methods 172 (2020) 105806
M. Hu, et al. yersinia pseudotuberculosis genotyping. J. Microbiol. Methods 91, 329–335. Šponer, J., Leszczynski, J., Hobza, P., 2001. Hydrogen bonding, stacking and cation binding of DNA bases. J. Mol. Struct. Theochem. 573, 43–53. Stone, A.J., 2017. Natural bond orbitals and the nature of the hydrogen bond. J. Phys. Chem. A 122, 1531–1534. Thompson, C.J., Mckean, J.D., O’Connor, A.M., 2007. Pulse-field-gel-electrophoresis
development for salmonella species using PaeR7 I. enzyme. 6, 496–497. Torpdahl, M., Ahrens, P., 2010. Population structure of salmonella investigated by amplified fragment length polymorphism. J. Appl. Microbiol. 97, 566–573. Wojdacz, T.K., Dobrovic, A., Hansen, L.L., 2008. Methylation-sensitive high-resolution melting. Nat. Protoc. 3, 1903–1908.
8