- Email: [email protected]
A Novel Human Homologue of the SH3BGR Gene Encodes a Small Protein Similar to Glutaredoxin 1 of Escherichia coli
Biochemical and Biophysical Research Communications 285, 540 –545 (2001) doi:10.1006/bbrc.2001.5169, available online at http://www.idealibrary.com on
A Novel Human Homologue of the SH3BGR Gene Encodes a Small Protein Similar to Glutaredoxin 1 of Escherichia coli Michela Mazzocco,* Patrizio Arrigo,† Aliana Egeo,* Massimo Maffei,* Alessandro Vergano,* Raffaella Di Lisi,‡ Fabio Ghiotto,§ Ermanno Ciccone,§ Roberta Cinti, ¶ Roberto Ravazzolo, ¶ and Paolo Scartezzini* ,1 *Divisione di Neonatologia, E.O. Ospedali Galliera, Mura delle Cappuccine 14, I-16128 Genoa, Italy; †Istituto Circuiti Elettronici, Consiglio Nazionale delle Ricerche, Genoa, Italy; ‡Dipartimento di Scienze Biomediche, Centro CNR di Biologia e Fisiopatologia Muscolare, University of Padua, Padua, Italy; §DIMES Sezione di Anatomia Umana, University of Genoa, Genoa, Italy; and ¶Laboratorio di Genetica Molecolare, Istituto Gaslini, Dipartimento di Oncologia Biologia e Genetica, University of Genoa, Genoa, Italy
Received May 28, 2001
Glutaredoxins (GRXs) are ubiquitous GSHdependent oxidoreductases, which catalyze the reduction of protein-glutathionyl-mixed disulfides and are considered to play an important role in the enzymatic regulation of redox-sensitive proteins. In this paper, we describe the identification and characterization of a new human homologue of the SH3BGR gene, named SH3BGRL3 (SH3 domain binding glutamic acid-rich protein like 3). SH3BGRL3 is widely expressed and codes for a highly conserved small protein, which shows a significant similarity to Glutaredoxin 1 (GRX1) of Escherichia coli and is predicted to belong to the Thioredoxin Superfamily. However, the SH3BGRL3 protein lacks both the conserved cysteine residues, which characterize the enzymatic active site of GRX. This structural feature raises the possibility that SH3BGRL3 could function as an endogenous modulator of GRX biological activity. EGFP-SH3BGRL3 fusion protein expressed in COS-7 cells localizes both to the nucleus and to the cytoplasm. The SH3BGRL3 gene was mapped to chromosome 1p34.3–35. © 2001 Academic Press
The human SH3BGR gene was isolated and characterized as part of an effort to identify new genes located to chromosome 21, which could be involved in the pathogenesis of Down syndrome congenital heart disease. SH3BGR maps to chromosome 21q22.2 close to HMG14 and is highly expressed in human heart and skeletal muscle (1). During mouse development, the murine Sh3bgr gene is already expressed in the precardiogenic mesoderm, and its expression is restricted To whom correspondence should be addressed. Fax: ⫹39-0105634556. E-mail: [email protected]. 1
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
to the myocardial cells until the completion of heart development (2). Subsequently, Sh3bgr transcripts are also detected in skeletal muscle and in the smooth muscle of gut and urinary bladder. SH3BGR codes for a protein of unknown function, characterized by the presence of a highly conserved N-terminal region, and of a less conserved C-terminal region highly enriched in glutamic acid residues, which is predicted to assume a largely ␣-helical conformation (1). The N-terminal region contains a proline-rich sequence (PLPPQIF), which conforms both the SH3 binding motif (PXXP) (3), and the Homer EVH1 binding motif (PPXXF) (4). After the characterization of SH3BGR, a new human gene, highly homologous to SH3BGR, was identified through the screening of the human EST database and named SH3BGRL (SH3BGR-like). SH3BGRL is widely expressed and encodes a small protein, which shows a high homology to the N-terminal region of the SH3BGR protein and conserves the proline-rich sequence (5). In this report we describe an additional human homologue of the SH3BGR gene, SH3BGRL3, coding for a highly conserved, small protein, which, like SH3BGRL, is similar to the N-terminal region of the SH3BGR protein, but lacks both the SH3 and Homer EVH1 binding motifs. Interestingly, the SH3BGRL3 protein shows a significant similarity to GRX1 of Escherichia coli, although it completely lacks the conserved consensus sequence (CXXC) which is essential for GRX enzymatic activity (6). The SH3BGRL3 gene was mapped to chromosome 1p34.3–35. MATERIALS AND METHODS EST database searches, cDNA sequencing, and sequence analysis. The human EST database at the National Center for Biotechnology Information (NCBI) was screened by BLAST 2 (7), using as queries
540
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
human SH3BGR and SH3BGRL nucleotide and amino acid sequences. Two human cDNA clones, showing about 40% identity to SH3BGR at the amino acid level, were obtained from the IMAGE consortium (8). Plasmid DNA was isolated using the Plasmid Midi Kit (Qiagen). cDNA inserts were sequenced by primer walking, with both vector and custom primers, using the thermo sequenase radiolabeled terminator cycle sequencing kit (USB), following the instructions of the supplier. Amino acid sequences were aligned using ClustalW (9). The SCOP (Structural Characterization of Proteins) SUPERFAMILY (10) and 3D-PSSM (Three-Dimensional Position-Specific Scoring Matrix) (11) were utilized to perform structural analysis of proteins. Cell lines and RNA extraction. Jurkat and Molt-4 cells (derived from T cell leukemias), LY8 (derived from a B cell lymphoma), and NK 3.3 (derived from NK cell leukemia) were cultured in RPMI additioned of 10% fetal calf serum. T cell clones were generated as described (12). Peripheral blood mononuclear cells (PBL) were isolated from heparinized venous blood on Ficoll density gradients. All cultured cells were washed once in PBS and used for RNA extraction. Total RNA was extracted from 5 ⫻ 10 6 to 5 ⫻ 10 7 cells using the RNA Clean solution (TIB Molbiol, Genoa, Italy), according to the manufacturer’s instructions. Northern blot and RT-PCR analysis. To study SH3BGRL3 mRNA expression a nylon membrane containing 2 g poly-(A)⫹ RNA samples from different human tissues (Clontech MNT# 7760-1) was hybridized using as probes the full-length SH3BGRL3 cDNA or -actin cDNA labeled with (␣- 32P) dCTP by random priming. Hybridization was carried out in 50% formamide solution at 42°C for 16 h. The filter was then washed twice for 20 min in 2⫻ SSC, 0.1% SDS at 55°C, and twice in 0.1% SSC, 0.1% SDS at 55°C, and exposed to Kodak X-Omat film at ⫺70°C for 12– 48 h. For RT-PCR analysis one g of total RNA was transcribed into cDNA by incubation at 42°C for 1 h with 20 pmol of oligo dT, 500 M dNTPs, 30 U RNAse inhibitor, 200 U M-MLV reverse transcriptase in a total volume of 20 l. To check mRNA expression of SH3BGRL3, the following primers were synthesized: HL3-F (CTGCTGGACTCCATCACCACACTC) and HL3-R (CATTTAATTGCCTCTAGGGTCCTCC), which amplifies a specific fragment of 360 bp. As control, the following primers, specific for G3PDH, were used: G3PDH-F (ACATCGCTCAGAACACCTATGG) and G3PDH-R (GGGTCTACATGGCAACTGTGAG). One microliter of cDNA was amplified using 20 pmol of both forward and reverse primer, 200 M dNTPs, 1.5 mM MgCl 2, and 1.25 U Platinum Taq (Gibco-BRL, Gaithersburg, MD). The reaction was amplified in a Mastercycle Personal (Eppendorf, Hamburg, Germany) using the following profiles: SH3BGRL3 1⫻ 95°C 2 min; 35⫻ (94°C 30 s, 65°C 30 s, 72°C 30 s); 1⫻ 72°C 5 min; G3PDH 1⫻ 95°C 2 min; 35⫻ (94°C 45 s, 60°C 30 s, 72°C 1 min); 1⫻ 72°C 5 min. Ten microliters of the PCR products were run in a 1.2% agarose gel and stained by ethidium bromide. Transfection experiments. A GFP expression vector (EGFP-C2, Clontech) was used to generate the SH3BGRL3 fusion construct. The full-length open reading frame of the SH3BGRL3 cDNA was amplified by PCR using the following primers: GFPL3F (AGTACTCGAGCAGCGGCCTGCGCGTCTACAG) and GFPL3R (AGTACGAATTCGGGGAACTCTGGACAGGC) and cloned downstream to the GFP coding sequence. The construct was confirmed by sequencing. Construct DNA or vector-only DNA was transfected into COS-7 cells growing in Dulbecco’s Modified Eagle Medium, 10% fetal calf serum using Lipofectamine (Life Technologies Inc.), according to the protocol provided by the supplier. After 24 – 48 h the cells were fixed in 4% paraformaldeide and than incubated with 4⬘,6⬘-diamino-2phenylindole (DAPI) to counterstain DNA. Cells were analyzed using an Olympus AX70 CCD camera. Fluorescent in situ hybridization (FISH). FISH was performed on human chromosome metaphases according to the protocol described by Pinkel et al. (13) with minor modifications. SH3BGRL3 cDNA
probe was labeled by nick translation with biotin 16-dUTP (Boehringer Mannheim). For probe detection the slides were incubated with avidin-FITC conjugated (Vector Laboratories); the intensity of the FITC signals was amplified twice with additional layers of biotinylated anti-avidin antibodies (Vector Laboratories) and avidin-FITC. Chromosomes were stained with DAPI (1 g/ml) and propidium iodide (0.5 g/ml). After mounting in Vectashield (Vector Laboratories) the slides were evaluated on a Zeiss Axiophot epifluorescence microscope. Radiation hybrid mapping. HL3-F and HL3-R primers were used at annealing temperature of 58°C, to perform a PCR screen of a GeneBridge4 Radiation Hybrid Panel (ResearchGenetics, Huntsville, AL). The data array thus obtained, was processed by the RHMAPPER software program available to the Whitehead Institute/ MIT Center for Genome Research, Cambridge, MA (http:// www.genome.wi.mit.edu/).
RESULTS Identification and analysis of SH3BGRL3 cDNA. Using the amino acid sequences of SH3BGR and SH3BGRL as query to screen the human EST database, we have identified a large number of EST clones showing significant similarity to the N-terminal region of SH3BGR and to SH3BGRL proteins. Two of these clones (GeneBank Accession Nos. AA064995 and N25824) were obtained and sequenced, revealing a full-length cDNA of 765 bp (GeneBank Accession No. AJ297915), which is close to the mRNA size (0.8 Kb) estimated from Northern blot analysis (described later), and contains an open reading frame of 282 bp encoding a predicted protein of 93 amino acids (Fig. 1A). The putative initiation codon was identified at position 72–74 and is surrounded by a sequence, which conforms to the Kozak consensus motif for translation start site in eucaryotes (14). The first in frame stop codon (TGA) is located at position 351–353 and is followed by a short 3⬘ UTR region containing a poly-(A⫹) addition signal (AATTAAA) at position 727–733. Using the human SH3BGRL3 sequence to screen the mouse EST database, we have identified several cDNA clones showing 93% identity and 100% conservation to SH3BGRL3 at the amino acid level. One of these cDNA clones (GeneBank Accession No. AA245400) was obtained and sequenced (Fig. 1B). The SH3BGRL3 gene codes for a small protein of 93 amino acids, showing 39% identity, 76% similarity to the N-terminal region of the SH3BGR protein and 42% identity, 73% similarity to the SH3BGRL protein respectively. The higher level of homology was found within a domain of about 30 amino acids at the C-terminal of SH3BGRL3 protein (Fig. 2A). Iterative database searches using the PSI-BLAST program with the SH3BGRL3 amino acid sequence, revealed a significant similarity between the SH3BGRL3 protein and GRX1 of E. coli (E ⫽ 0.008). An alignment of human SH3BGRL3 and E. coli GRX1 proteins shows 25% identity and 63% conservation (Fig. 2B). The higher level of similarity was
541
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. (A) Nucleotide sequence and translated amino acid sequence of the human SH3BGRL3 cDNA. The termination codon is marked by the asterisk and the poly (A⫹) addition signal is underlined. (B) Alignment of human and mouse SH3BGR3 amino acid sequences. Alignment was performed using the ClustalW program (version 1.8). Amino acid identity is indicated by asterisks, and conservative amino acids substitutions are indicated by periods.
found within a region of about 50 amino acids at the C-terminal of the two proteins, which comprises the previously described domain, highly conserved between the proteins of the SH3BGR family. The multiple alignment in Fig. 2C, contains partial amino acid sequences of the human SH3BGR family proteins, E. coli GRX1 and of a new protein domain recently identified in the PICOT protein (PICOTHD), which appears related to GRX (15). The similarity between these proteins and the high level of conservation within the motif corresponding to the hydrophobic surface area of GRX (16) is shown. The structural characterization of SH3BGRL3 protein using the SCOP/SUPERFAMILY program evidenced a significant level of similarity with the Thioredoxin-like protein Superfamily (E value: 4.8e-13). Similar results were obtained for SH3BGR and SH3BGRL proteins (E value: 1e-09 and 2.1e-09 respectively). Further analysis using the 3D-PSSM software, confirmed the structural relationship between SH3BGRL3 and Thioredoxin Superfamily (E value: 2.39 e-07). Expression analysis. The expression pattern of SH3BGRL3 was determined by Northern blot and RT-
PCR analysis using various human tissues and cell lines. First we examined the tissue distribution of SH3BGRL3 using a commercial Northern blot from Clontech. A single transcript was detected in all the tissues examined, but a lower level of expression was found in skeletal muscle (Fig. 3A). Since this blot does not contains RNA samples from immune system tissues, we have performed RT-PCR analysis using RNAs collected from peripheral blood lymphocytes, CD4, CD8, T cell clones and Jurkat, Molt-4, LY8 and NK3.3 leukemic cell lines. Our results show that SH3BGRL3 is expressed both in normal and leukemic cells (Fig. 3B). Subcellular localization. To determine the subcellular localization of the SH3BGRL3 protein, the SH3BGRL3 coding sequence was cloned downstream to the GFP coding sequence and the fusion product was transiently transfected into COS-7 cells. A strong nuclear signal and a lower cytoplasmic signal were detected by fluorescent microscopy (Fig. 4). Chromosomal localization. We performed FISH experiments in order to map the SH3BGRL3 gene. The analysis of 70 metaphases showed that 40% of signals
542
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. (A) Multiple alignment of human SH3BGR, SH3BGRL, and SH3BGRL3 amino acid sequences. (B) Alignment of human SH3BGRL3 and E. coli GRX1 amino acid sequences. Amino acid identity and conservative substitution are indicated as in the legend to Fig. 1B; the sequence containing the enzymatic active site of GRX1 is boldfaced. (C) Multiple alignment of partial amino acid sequences from human SH3BGR, SH3BGRL, SH3BGRL3, E. coli GRX1, and PICOT HD1 and HD2 domains from human PICOT protein. The motif of hydrophobic surface area is underlined.
were specifically located on chromosome 1p34.3–35 (Fig. 5). No other signal was detected in any other region at a significant percentage. In order to sublocalize the SH3BGRL3 gene relative to molecular markers, we screened a radiation hybrid panel. With respect to the retention of SH3BGRL3, each of the 93 hybrids was classified as positive (13), negative (76), or missing (4). The SH3BGRL3 gene was thus assigned to within a 2.74 cR of the framework marker WI-9053 and proximally to D1S511 marker within a 0.60 cR interval (data not shown). The WI9053 and D1S511 markers define an interval of approximately 4 cR. DISCUSSION The control of redox homeostasis is important for the regulation of basic cellular functions as proliferation, apoptosis and senescence. Sulphidryl groups (-SH) have been shown to be deeply involved in the response to oxidative stress, since the redox status of cysteine residues affects the structure and the function of several enzymes, receptors and transcriptional factors (17).
GRX, like thioredoxin, is a small disulfide reducing enzyme, which acts as hydrogen donor and is thought to play a crucial role in regenerating glutathionylated proteins (18). GRX has been structurally conserved through evolution and contains a consensus sequence, “CPYC,” which is essential for its enzymatic activity (6). GRX was showed to enhance the activation of NF-kB and AP-1 (19), and to exert a protective activity against dopamine induced apoptosis in cerebellar granule neurons (20). Increased levels of GRX expression were detected in pancreatic ductal carcinoma cells and in CDDP-resistant subclones of HeLa cells (21). These data support a functional role of GRX in promoting cell growth and in protecting cells from apoptosis. The SH3BGRL3 gene is widely expressed in human tissues and codes for a protein of 93 amino acids (10.4 kD), which appears to be present both in the nucleus and in the cytoplasm of COS-7 cells. SH3BGRL3 maps to chromosome 1p34.3–35, a region associated with loss of heterozygosity in several tumors, as neuroblastoma (22) or prostate cancer (23). The SH3BGRL3 protein, like SH3BGRL, shows a high homology to the N-terminal region of the
543
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. (A) Subcellular localization of EGFP-SH3BGRL3 in transiently transfected COS7 cells. (B) Counterstaining with DAPI.
FIG. 3. (A) Northern blot analysis of SH3BGRL3 expression in adult human tissues showing the presence of a single transcript of about 0.8 Kb in all the tissues examined. (B) RT-PCR analysis of SH3BGRL3 expression in normal lymphocyte and in leukemic cell lines. PCR products were resolved by electrophoresis in 1.2% agarose gel containing ethidium bromide. A PCR product of 360 bp is detectable in all the sample examined and no significant difference was found between normal and leukemic cells.
protein suggest that it could function as an endogenous antagonist of GRX, possibly by competition for specific substrate binding, and that it could modulate GRX biological activity. Recently, a novel, highly conserved, protein domain (PICOT-HD), was characterized, which has an overall predicted structure resembling that of GRX (15). Interestingly, the C-terminal region of the SH3BGRL3 protein appears related to the C-terminal region of the PICOT-HD domain. Furthermore, Lundberg and colleagues (24) have recently identified a novel human Glutaredoxin (GRX2), which is 34% identical to human GRX1 and is located in the nucleus and in the mitochondria. GRX2 conserves the CXXC motif at the active site and shows the enzymatic characteristics of GRXs, although its specific activity is ⬍10% of the GRX1 specific activity. The identification of a second mammalian GRX, together with the identification of proteins or protein domains related to GRX, but probably devoid of the enzymatic activity, raises the possibility that protein glutathionylation could be subjected to a complex homeostatic control and supports the importance of further investigations to elucidate the functional role of the SH3BGRL3 protein.
SH3BGR protein, but lacks both the SH3 and Homer EVH1 domains binding motifs. In addition, using the PSI-BLAST program, we found a significant similarity between SH3BGRL3 protein and E. coli GRX1. The region of high homology encompasses about 50 amino acids at the C-terminal of the two proteins and corresponds to the region of higher homology found between SH3BGR, SH3BGRL and SH3BGRL3 proteins. These findings were confirmed by the use of different structural prediction programs. However, since SH3BGRL3 lacks both the two cysteine residues that characterize the active site of GRX, it almost certainly does not possess GRX enzymatic activity. These molecular features of the SH3BGRL3
FIG. 5. Chromosomal localization of the SH3BGRL3 gene. (A) Fluorescence in situ hybridization of the biotin-labeled SH3BGRL3 cDNA on human chromosomes. Specific labeling was observed at 1p34.3–35 (arrow). (B) The same partial metaphase stained with DAPI showing the identification of the labeled chromosome 1 (arrow).
544
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
ACKNOWLEDGMENTS We thank Domenico Carratta for technical assistance. This work was supported by Telethon Italy (Grant E.773 to P.S.) and Fondazione Maria Piaggio Casarsa.
13.
14.
REFERENCES 1. Scartezzini, P., Egeo, A., Colella, S., Fumagalli, P., Arrigo, P., Nizetic, D., Taramelli, R., and Rasore-Quartino, A. (1997) Cloning a new human gene from chromosome 21q22.3 encoding a glutamic acid-rich protein expressed in heart and skeletal muscle. Hum. Genet. 99, 387–392. 2. Egeo, A., Di Lisi, R., Sandri, C., Mazzocco, M., Lapide, M., Schiaffino, S., and Scartezzini, P. (2000) Developmental expression of the SH3BGR gene, mapping to the Down syndrome heart critical region. Mech. Dev. 90, 313–316. 3. Powson, T., and Scott, J. D. (1997) Signaling through scaffold, anchoring, and adaptor proteins. Science 278, 2075–2080. 4. Beneken, J., Tu, J. C., Xiao, B., Nuriya, M., Yuan, J. P., Worley, P. F., and Leahy, D. J. (2000) Structure of the Homer EVH1 domain-peptide complex reveals a new twist in polyproline Recognition. Neuron 26, 143–154. 5. Egeo, A., Mazzocco, M., Arrigo, P., Vidal-Taboada, J. M., Oliva, R., Pirola, B., Giglio, S., Rasore-Quartino, A., and Scartezzini, P. (1998) Identification and characterization of a new Gene encoding a small protein with high homology to the proline-rich region of the SH3BGR Gene. Biochem. Biophys. Res. Commun. 247, 302–306. 6. Holmgren, A. (1989) Thioredoxin and glutaredoxin systems. J. Biol. Chem. 264, 13963–13966. 7. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: A new generation of protein database search. Nucleic Acid Res. 25, 3389 –3402. 8. Lennon, G., Auffray, C., Polymeropoulos, M., and Bento Soares, M. (1996) The IMAGE consortium: An integrated molecular analysis of genomes and their expression. Genomics 33, 151–152. 9. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997) The CLUSTAL X windows interfacies: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Res. 25, 4876 – 4882. 10. Lo Conte, L., Ailey, B., Hubbard, T. J., Brenner, S. E., Murzin, A. G., and Chothia, C. (2000) SCOP: A structural classification of protein database. Nucleic Acid Res. 28, 257–259. 11. Kelley, L. A., MacCallum, R. M., and Sternberg, M. J. (2000) Enhanced genome annotation using structural profiles in the program 3D-PSSM. J. Mol. Biol. 299, 499 –520. 12. Severino, D., Fabbi, M., Ghiotto, F., Merlo, A., Bruno, S., Zarcone, D., Tenca, C., Tiso, M., Santoro, G., Anastasi, G., Cosman, D., Grossi, C. E., and Ciccone, E. (2000) The CD85/LIR-1/ITL2
15.
16. 17.
18.
19.
20.
21.
22.
23.
24.
545
inhibitory receptor is expressed by all human T limphocytes and down-regulates their functions. J. Immunol. 165, 3742–3755. Pinkel, D., Straume, T., and Gray, J. W. (1986) Cytogenetic analysis using quantitative, high sensitivity, fluorescence hybridization. Proc. Natl. Acad. Sci. USA 83, 2934 –2938. Kozak, M. (1986) Point mutation define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283–292. Isakov, N., Witte, S., and Altman, A. (2000) PICOT-HD: A highly conserved protein domain that is often associated with thioredoxin and glutaredoxin modules. Trends Biochem. Sci. 25, 537– 539. Holmgren, A., and Aslund, F. (1995) Glutaredoxin. Methods Enzymol. 252, 283–292. Adler, V., Zhimin, Y., Tew, K. T., and Ronai, Z. (1999) Role of redox potential and reactive oxygen species in stress signaling. Oncogene 18, 6104 – 6111. Chrestensen, C. A., Starke, D. W., and Mieyal, J. J. (2000) Acute cadmium exposure inactivate thioltransferase (Glutaredoxin), inhibits intracellular reduction of protein-glutathionyl-mixed disulfides, and initiates apoptosis. J. Biol. Chem. 275, 26556 – 26565. Hirota, K., Matsui, M., Murata, M., Takashima, Y., Cheng, F. S., Itoh, T., Fukuda, K., and Yodoi, J. (2000) Nucleoredoxin, glutaredoxin and thioredoxin differentially regulate NF-kB, AP-1, and CREB activation in HEK293 cells. Biochem. Biophys. Res. Commun. 274, 177–182. Daily, D., Vlamis-Cardikas, A., Offen, D., Mittelman, L., Melamed, E., Holmgren, A., and Barzilai, A. (2001) Glutaredoxin protects cerebellar granule neurons from dopamine-induced Apoptosis by dual activation of the Ras-phosphoinositide 3 kinase and Jun N-terminal kinase Pathways. J. Biol. Chem. 276, 1335– 1344. Nakamura, H., Bai, J., Nishinaka, Y., Ueda, S., Sasada, T., Ohshio, G., Imamura, M., Takabayashi, A., Yamaoka, Y., and Yodoi, J. (2000) Expression of thioredoxin and glutaredoxin, redox-regulating proteins, in pancreatic cancer. Cancer Detect. Prev. 24, 53– 60. Mora, J., Cheung, N. K., Kushner, B. H., LaQuaglia, M. P., Kramer, K., Fazzari, M., Heller, G., Chen, L., and Gerald, W. L. (2000) Clinical categories of neuroblastoma are associated with different patterns of loss of heterozygosity on chromosome arm 1p. J. Mol. Diagn. 2, 37– 46. Suarez, B. K., Lin, J., Burmester, J. K., Broman, K. W., Weber, J. L., Banerjee, T. K., Goddard, K. A., Witte, J. S., Elston, R. C., and Catalona, W. J. (2000) A genome screen of multiplex sibships with prostate cancer. Am. J. Hum. Genet. 66, 933–944. Lundberg, M., Johansson, C., Chandra, J., Enoksson, M., Jacobsson, G., Ljung, J., Johansson, M., and Holmgren, A. (2001) Cloning and expression of a novel human glutaredoxin (Grx2) with mitochondrial and nuclear isoforms. J. Biol. Chem., in press.
A Novel Human Homologue of the SH3BGR Gene Encodes a Small Protein Similar to Glutaredoxin 1 of Escherichia coli Michela Mazzocco,* Patrizio Arrigo,† Aliana Egeo,* Massimo Maffei,* Alessandro Vergano,* Raffaella Di Lisi,‡ Fabio Ghiotto,§ Ermanno Ciccone,§ Roberta Cinti, ¶ Roberto Ravazzolo, ¶ and Paolo Scartezzini* ,1 *Divisione di Neonatologia, E.O. Ospedali Galliera, Mura delle Cappuccine 14, I-16128 Genoa, Italy; †Istituto Circuiti Elettronici, Consiglio Nazionale delle Ricerche, Genoa, Italy; ‡Dipartimento di Scienze Biomediche, Centro CNR di Biologia e Fisiopatologia Muscolare, University of Padua, Padua, Italy; §DIMES Sezione di Anatomia Umana, University of Genoa, Genoa, Italy; and ¶Laboratorio di Genetica Molecolare, Istituto Gaslini, Dipartimento di Oncologia Biologia e Genetica, University of Genoa, Genoa, Italy
Received May 28, 2001
Glutaredoxins (GRXs) are ubiquitous GSHdependent oxidoreductases, which catalyze the reduction of protein-glutathionyl-mixed disulfides and are considered to play an important role in the enzymatic regulation of redox-sensitive proteins. In this paper, we describe the identification and characterization of a new human homologue of the SH3BGR gene, named SH3BGRL3 (SH3 domain binding glutamic acid-rich protein like 3). SH3BGRL3 is widely expressed and codes for a highly conserved small protein, which shows a significant similarity to Glutaredoxin 1 (GRX1) of Escherichia coli and is predicted to belong to the Thioredoxin Superfamily. However, the SH3BGRL3 protein lacks both the conserved cysteine residues, which characterize the enzymatic active site of GRX. This structural feature raises the possibility that SH3BGRL3 could function as an endogenous modulator of GRX biological activity. EGFP-SH3BGRL3 fusion protein expressed in COS-7 cells localizes both to the nucleus and to the cytoplasm. The SH3BGRL3 gene was mapped to chromosome 1p34.3–35. © 2001 Academic Press
The human SH3BGR gene was isolated and characterized as part of an effort to identify new genes located to chromosome 21, which could be involved in the pathogenesis of Down syndrome congenital heart disease. SH3BGR maps to chromosome 21q22.2 close to HMG14 and is highly expressed in human heart and skeletal muscle (1). During mouse development, the murine Sh3bgr gene is already expressed in the precardiogenic mesoderm, and its expression is restricted To whom correspondence should be addressed. Fax: ⫹39-0105634556. E-mail: [email protected]. 1
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
to the myocardial cells until the completion of heart development (2). Subsequently, Sh3bgr transcripts are also detected in skeletal muscle and in the smooth muscle of gut and urinary bladder. SH3BGR codes for a protein of unknown function, characterized by the presence of a highly conserved N-terminal region, and of a less conserved C-terminal region highly enriched in glutamic acid residues, which is predicted to assume a largely ␣-helical conformation (1). The N-terminal region contains a proline-rich sequence (PLPPQIF), which conforms both the SH3 binding motif (PXXP) (3), and the Homer EVH1 binding motif (PPXXF) (4). After the characterization of SH3BGR, a new human gene, highly homologous to SH3BGR, was identified through the screening of the human EST database and named SH3BGRL (SH3BGR-like). SH3BGRL is widely expressed and encodes a small protein, which shows a high homology to the N-terminal region of the SH3BGR protein and conserves the proline-rich sequence (5). In this report we describe an additional human homologue of the SH3BGR gene, SH3BGRL3, coding for a highly conserved, small protein, which, like SH3BGRL, is similar to the N-terminal region of the SH3BGR protein, but lacks both the SH3 and Homer EVH1 binding motifs. Interestingly, the SH3BGRL3 protein shows a significant similarity to GRX1 of Escherichia coli, although it completely lacks the conserved consensus sequence (CXXC) which is essential for GRX enzymatic activity (6). The SH3BGRL3 gene was mapped to chromosome 1p34.3–35. MATERIALS AND METHODS EST database searches, cDNA sequencing, and sequence analysis. The human EST database at the National Center for Biotechnology Information (NCBI) was screened by BLAST 2 (7), using as queries
540
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
human SH3BGR and SH3BGRL nucleotide and amino acid sequences. Two human cDNA clones, showing about 40% identity to SH3BGR at the amino acid level, were obtained from the IMAGE consortium (8). Plasmid DNA was isolated using the Plasmid Midi Kit (Qiagen). cDNA inserts were sequenced by primer walking, with both vector and custom primers, using the thermo sequenase radiolabeled terminator cycle sequencing kit (USB), following the instructions of the supplier. Amino acid sequences were aligned using ClustalW (9). The SCOP (Structural Characterization of Proteins) SUPERFAMILY (10) and 3D-PSSM (Three-Dimensional Position-Specific Scoring Matrix) (11) were utilized to perform structural analysis of proteins. Cell lines and RNA extraction. Jurkat and Molt-4 cells (derived from T cell leukemias), LY8 (derived from a B cell lymphoma), and NK 3.3 (derived from NK cell leukemia) were cultured in RPMI additioned of 10% fetal calf serum. T cell clones were generated as described (12). Peripheral blood mononuclear cells (PBL) were isolated from heparinized venous blood on Ficoll density gradients. All cultured cells were washed once in PBS and used for RNA extraction. Total RNA was extracted from 5 ⫻ 10 6 to 5 ⫻ 10 7 cells using the RNA Clean solution (TIB Molbiol, Genoa, Italy), according to the manufacturer’s instructions. Northern blot and RT-PCR analysis. To study SH3BGRL3 mRNA expression a nylon membrane containing 2 g poly-(A)⫹ RNA samples from different human tissues (Clontech MNT# 7760-1) was hybridized using as probes the full-length SH3BGRL3 cDNA or -actin cDNA labeled with (␣- 32P) dCTP by random priming. Hybridization was carried out in 50% formamide solution at 42°C for 16 h. The filter was then washed twice for 20 min in 2⫻ SSC, 0.1% SDS at 55°C, and twice in 0.1% SSC, 0.1% SDS at 55°C, and exposed to Kodak X-Omat film at ⫺70°C for 12– 48 h. For RT-PCR analysis one g of total RNA was transcribed into cDNA by incubation at 42°C for 1 h with 20 pmol of oligo dT, 500 M dNTPs, 30 U RNAse inhibitor, 200 U M-MLV reverse transcriptase in a total volume of 20 l. To check mRNA expression of SH3BGRL3, the following primers were synthesized: HL3-F (CTGCTGGACTCCATCACCACACTC) and HL3-R (CATTTAATTGCCTCTAGGGTCCTCC), which amplifies a specific fragment of 360 bp. As control, the following primers, specific for G3PDH, were used: G3PDH-F (ACATCGCTCAGAACACCTATGG) and G3PDH-R (GGGTCTACATGGCAACTGTGAG). One microliter of cDNA was amplified using 20 pmol of both forward and reverse primer, 200 M dNTPs, 1.5 mM MgCl 2, and 1.25 U Platinum Taq (Gibco-BRL, Gaithersburg, MD). The reaction was amplified in a Mastercycle Personal (Eppendorf, Hamburg, Germany) using the following profiles: SH3BGRL3 1⫻ 95°C 2 min; 35⫻ (94°C 30 s, 65°C 30 s, 72°C 30 s); 1⫻ 72°C 5 min; G3PDH 1⫻ 95°C 2 min; 35⫻ (94°C 45 s, 60°C 30 s, 72°C 1 min); 1⫻ 72°C 5 min. Ten microliters of the PCR products were run in a 1.2% agarose gel and stained by ethidium bromide. Transfection experiments. A GFP expression vector (EGFP-C2, Clontech) was used to generate the SH3BGRL3 fusion construct. The full-length open reading frame of the SH3BGRL3 cDNA was amplified by PCR using the following primers: GFPL3F (AGTACTCGAGCAGCGGCCTGCGCGTCTACAG) and GFPL3R (AGTACGAATTCGGGGAACTCTGGACAGGC) and cloned downstream to the GFP coding sequence. The construct was confirmed by sequencing. Construct DNA or vector-only DNA was transfected into COS-7 cells growing in Dulbecco’s Modified Eagle Medium, 10% fetal calf serum using Lipofectamine (Life Technologies Inc.), according to the protocol provided by the supplier. After 24 – 48 h the cells were fixed in 4% paraformaldeide and than incubated with 4⬘,6⬘-diamino-2phenylindole (DAPI) to counterstain DNA. Cells were analyzed using an Olympus AX70 CCD camera. Fluorescent in situ hybridization (FISH). FISH was performed on human chromosome metaphases according to the protocol described by Pinkel et al. (13) with minor modifications. SH3BGRL3 cDNA
probe was labeled by nick translation with biotin 16-dUTP (Boehringer Mannheim). For probe detection the slides were incubated with avidin-FITC conjugated (Vector Laboratories); the intensity of the FITC signals was amplified twice with additional layers of biotinylated anti-avidin antibodies (Vector Laboratories) and avidin-FITC. Chromosomes were stained with DAPI (1 g/ml) and propidium iodide (0.5 g/ml). After mounting in Vectashield (Vector Laboratories) the slides were evaluated on a Zeiss Axiophot epifluorescence microscope. Radiation hybrid mapping. HL3-F and HL3-R primers were used at annealing temperature of 58°C, to perform a PCR screen of a GeneBridge4 Radiation Hybrid Panel (ResearchGenetics, Huntsville, AL). The data array thus obtained, was processed by the RHMAPPER software program available to the Whitehead Institute/ MIT Center for Genome Research, Cambridge, MA (http:// www.genome.wi.mit.edu/).
RESULTS Identification and analysis of SH3BGRL3 cDNA. Using the amino acid sequences of SH3BGR and SH3BGRL as query to screen the human EST database, we have identified a large number of EST clones showing significant similarity to the N-terminal region of SH3BGR and to SH3BGRL proteins. Two of these clones (GeneBank Accession Nos. AA064995 and N25824) were obtained and sequenced, revealing a full-length cDNA of 765 bp (GeneBank Accession No. AJ297915), which is close to the mRNA size (0.8 Kb) estimated from Northern blot analysis (described later), and contains an open reading frame of 282 bp encoding a predicted protein of 93 amino acids (Fig. 1A). The putative initiation codon was identified at position 72–74 and is surrounded by a sequence, which conforms to the Kozak consensus motif for translation start site in eucaryotes (14). The first in frame stop codon (TGA) is located at position 351–353 and is followed by a short 3⬘ UTR region containing a poly-(A⫹) addition signal (AATTAAA) at position 727–733. Using the human SH3BGRL3 sequence to screen the mouse EST database, we have identified several cDNA clones showing 93% identity and 100% conservation to SH3BGRL3 at the amino acid level. One of these cDNA clones (GeneBank Accession No. AA245400) was obtained and sequenced (Fig. 1B). The SH3BGRL3 gene codes for a small protein of 93 amino acids, showing 39% identity, 76% similarity to the N-terminal region of the SH3BGR protein and 42% identity, 73% similarity to the SH3BGRL protein respectively. The higher level of homology was found within a domain of about 30 amino acids at the C-terminal of SH3BGRL3 protein (Fig. 2A). Iterative database searches using the PSI-BLAST program with the SH3BGRL3 amino acid sequence, revealed a significant similarity between the SH3BGRL3 protein and GRX1 of E. coli (E ⫽ 0.008). An alignment of human SH3BGRL3 and E. coli GRX1 proteins shows 25% identity and 63% conservation (Fig. 2B). The higher level of similarity was
541
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. (A) Nucleotide sequence and translated amino acid sequence of the human SH3BGRL3 cDNA. The termination codon is marked by the asterisk and the poly (A⫹) addition signal is underlined. (B) Alignment of human and mouse SH3BGR3 amino acid sequences. Alignment was performed using the ClustalW program (version 1.8). Amino acid identity is indicated by asterisks, and conservative amino acids substitutions are indicated by periods.
found within a region of about 50 amino acids at the C-terminal of the two proteins, which comprises the previously described domain, highly conserved between the proteins of the SH3BGR family. The multiple alignment in Fig. 2C, contains partial amino acid sequences of the human SH3BGR family proteins, E. coli GRX1 and of a new protein domain recently identified in the PICOT protein (PICOTHD), which appears related to GRX (15). The similarity between these proteins and the high level of conservation within the motif corresponding to the hydrophobic surface area of GRX (16) is shown. The structural characterization of SH3BGRL3 protein using the SCOP/SUPERFAMILY program evidenced a significant level of similarity with the Thioredoxin-like protein Superfamily (E value: 4.8e-13). Similar results were obtained for SH3BGR and SH3BGRL proteins (E value: 1e-09 and 2.1e-09 respectively). Further analysis using the 3D-PSSM software, confirmed the structural relationship between SH3BGRL3 and Thioredoxin Superfamily (E value: 2.39 e-07). Expression analysis. The expression pattern of SH3BGRL3 was determined by Northern blot and RT-
PCR analysis using various human tissues and cell lines. First we examined the tissue distribution of SH3BGRL3 using a commercial Northern blot from Clontech. A single transcript was detected in all the tissues examined, but a lower level of expression was found in skeletal muscle (Fig. 3A). Since this blot does not contains RNA samples from immune system tissues, we have performed RT-PCR analysis using RNAs collected from peripheral blood lymphocytes, CD4, CD8, T cell clones and Jurkat, Molt-4, LY8 and NK3.3 leukemic cell lines. Our results show that SH3BGRL3 is expressed both in normal and leukemic cells (Fig. 3B). Subcellular localization. To determine the subcellular localization of the SH3BGRL3 protein, the SH3BGRL3 coding sequence was cloned downstream to the GFP coding sequence and the fusion product was transiently transfected into COS-7 cells. A strong nuclear signal and a lower cytoplasmic signal were detected by fluorescent microscopy (Fig. 4). Chromosomal localization. We performed FISH experiments in order to map the SH3BGRL3 gene. The analysis of 70 metaphases showed that 40% of signals
542
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. (A) Multiple alignment of human SH3BGR, SH3BGRL, and SH3BGRL3 amino acid sequences. (B) Alignment of human SH3BGRL3 and E. coli GRX1 amino acid sequences. Amino acid identity and conservative substitution are indicated as in the legend to Fig. 1B; the sequence containing the enzymatic active site of GRX1 is boldfaced. (C) Multiple alignment of partial amino acid sequences from human SH3BGR, SH3BGRL, SH3BGRL3, E. coli GRX1, and PICOT HD1 and HD2 domains from human PICOT protein. The motif of hydrophobic surface area is underlined.
were specifically located on chromosome 1p34.3–35 (Fig. 5). No other signal was detected in any other region at a significant percentage. In order to sublocalize the SH3BGRL3 gene relative to molecular markers, we screened a radiation hybrid panel. With respect to the retention of SH3BGRL3, each of the 93 hybrids was classified as positive (13), negative (76), or missing (4). The SH3BGRL3 gene was thus assigned to within a 2.74 cR of the framework marker WI-9053 and proximally to D1S511 marker within a 0.60 cR interval (data not shown). The WI9053 and D1S511 markers define an interval of approximately 4 cR. DISCUSSION The control of redox homeostasis is important for the regulation of basic cellular functions as proliferation, apoptosis and senescence. Sulphidryl groups (-SH) have been shown to be deeply involved in the response to oxidative stress, since the redox status of cysteine residues affects the structure and the function of several enzymes, receptors and transcriptional factors (17).
GRX, like thioredoxin, is a small disulfide reducing enzyme, which acts as hydrogen donor and is thought to play a crucial role in regenerating glutathionylated proteins (18). GRX has been structurally conserved through evolution and contains a consensus sequence, “CPYC,” which is essential for its enzymatic activity (6). GRX was showed to enhance the activation of NF-kB and AP-1 (19), and to exert a protective activity against dopamine induced apoptosis in cerebellar granule neurons (20). Increased levels of GRX expression were detected in pancreatic ductal carcinoma cells and in CDDP-resistant subclones of HeLa cells (21). These data support a functional role of GRX in promoting cell growth and in protecting cells from apoptosis. The SH3BGRL3 gene is widely expressed in human tissues and codes for a protein of 93 amino acids (10.4 kD), which appears to be present both in the nucleus and in the cytoplasm of COS-7 cells. SH3BGRL3 maps to chromosome 1p34.3–35, a region associated with loss of heterozygosity in several tumors, as neuroblastoma (22) or prostate cancer (23). The SH3BGRL3 protein, like SH3BGRL, shows a high homology to the N-terminal region of the
543
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. (A) Subcellular localization of EGFP-SH3BGRL3 in transiently transfected COS7 cells. (B) Counterstaining with DAPI.
FIG. 3. (A) Northern blot analysis of SH3BGRL3 expression in adult human tissues showing the presence of a single transcript of about 0.8 Kb in all the tissues examined. (B) RT-PCR analysis of SH3BGRL3 expression in normal lymphocyte and in leukemic cell lines. PCR products were resolved by electrophoresis in 1.2% agarose gel containing ethidium bromide. A PCR product of 360 bp is detectable in all the sample examined and no significant difference was found between normal and leukemic cells.
protein suggest that it could function as an endogenous antagonist of GRX, possibly by competition for specific substrate binding, and that it could modulate GRX biological activity. Recently, a novel, highly conserved, protein domain (PICOT-HD), was characterized, which has an overall predicted structure resembling that of GRX (15). Interestingly, the C-terminal region of the SH3BGRL3 protein appears related to the C-terminal region of the PICOT-HD domain. Furthermore, Lundberg and colleagues (24) have recently identified a novel human Glutaredoxin (GRX2), which is 34% identical to human GRX1 and is located in the nucleus and in the mitochondria. GRX2 conserves the CXXC motif at the active site and shows the enzymatic characteristics of GRXs, although its specific activity is ⬍10% of the GRX1 specific activity. The identification of a second mammalian GRX, together with the identification of proteins or protein domains related to GRX, but probably devoid of the enzymatic activity, raises the possibility that protein glutathionylation could be subjected to a complex homeostatic control and supports the importance of further investigations to elucidate the functional role of the SH3BGRL3 protein.
SH3BGR protein, but lacks both the SH3 and Homer EVH1 domains binding motifs. In addition, using the PSI-BLAST program, we found a significant similarity between SH3BGRL3 protein and E. coli GRX1. The region of high homology encompasses about 50 amino acids at the C-terminal of the two proteins and corresponds to the region of higher homology found between SH3BGR, SH3BGRL and SH3BGRL3 proteins. These findings were confirmed by the use of different structural prediction programs. However, since SH3BGRL3 lacks both the two cysteine residues that characterize the active site of GRX, it almost certainly does not possess GRX enzymatic activity. These molecular features of the SH3BGRL3
FIG. 5. Chromosomal localization of the SH3BGRL3 gene. (A) Fluorescence in situ hybridization of the biotin-labeled SH3BGRL3 cDNA on human chromosomes. Specific labeling was observed at 1p34.3–35 (arrow). (B) The same partial metaphase stained with DAPI showing the identification of the labeled chromosome 1 (arrow).
544
Vol. 285, No. 2, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
ACKNOWLEDGMENTS We thank Domenico Carratta for technical assistance. This work was supported by Telethon Italy (Grant E.773 to P.S.) and Fondazione Maria Piaggio Casarsa.
13.
14.
REFERENCES 1. Scartezzini, P., Egeo, A., Colella, S., Fumagalli, P., Arrigo, P., Nizetic, D., Taramelli, R., and Rasore-Quartino, A. (1997) Cloning a new human gene from chromosome 21q22.3 encoding a glutamic acid-rich protein expressed in heart and skeletal muscle. Hum. Genet. 99, 387–392. 2. Egeo, A., Di Lisi, R., Sandri, C., Mazzocco, M., Lapide, M., Schiaffino, S., and Scartezzini, P. (2000) Developmental expression of the SH3BGR gene, mapping to the Down syndrome heart critical region. Mech. Dev. 90, 313–316. 3. Powson, T., and Scott, J. D. (1997) Signaling through scaffold, anchoring, and adaptor proteins. Science 278, 2075–2080. 4. Beneken, J., Tu, J. C., Xiao, B., Nuriya, M., Yuan, J. P., Worley, P. F., and Leahy, D. J. (2000) Structure of the Homer EVH1 domain-peptide complex reveals a new twist in polyproline Recognition. Neuron 26, 143–154. 5. Egeo, A., Mazzocco, M., Arrigo, P., Vidal-Taboada, J. M., Oliva, R., Pirola, B., Giglio, S., Rasore-Quartino, A., and Scartezzini, P. (1998) Identification and characterization of a new Gene encoding a small protein with high homology to the proline-rich region of the SH3BGR Gene. Biochem. Biophys. Res. Commun. 247, 302–306. 6. Holmgren, A. (1989) Thioredoxin and glutaredoxin systems. J. Biol. Chem. 264, 13963–13966. 7. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: A new generation of protein database search. Nucleic Acid Res. 25, 3389 –3402. 8. Lennon, G., Auffray, C., Polymeropoulos, M., and Bento Soares, M. (1996) The IMAGE consortium: An integrated molecular analysis of genomes and their expression. Genomics 33, 151–152. 9. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997) The CLUSTAL X windows interfacies: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Res. 25, 4876 – 4882. 10. Lo Conte, L., Ailey, B., Hubbard, T. J., Brenner, S. E., Murzin, A. G., and Chothia, C. (2000) SCOP: A structural classification of protein database. Nucleic Acid Res. 28, 257–259. 11. Kelley, L. A., MacCallum, R. M., and Sternberg, M. J. (2000) Enhanced genome annotation using structural profiles in the program 3D-PSSM. J. Mol. Biol. 299, 499 –520. 12. Severino, D., Fabbi, M., Ghiotto, F., Merlo, A., Bruno, S., Zarcone, D., Tenca, C., Tiso, M., Santoro, G., Anastasi, G., Cosman, D., Grossi, C. E., and Ciccone, E. (2000) The CD85/LIR-1/ITL2
15.
16. 17.
18.
19.
20.
21.
22.
23.
24.
545
inhibitory receptor is expressed by all human T limphocytes and down-regulates their functions. J. Immunol. 165, 3742–3755. Pinkel, D., Straume, T., and Gray, J. W. (1986) Cytogenetic analysis using quantitative, high sensitivity, fluorescence hybridization. Proc. Natl. Acad. Sci. USA 83, 2934 –2938. Kozak, M. (1986) Point mutation define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283–292. Isakov, N., Witte, S., and Altman, A. (2000) PICOT-HD: A highly conserved protein domain that is often associated with thioredoxin and glutaredoxin modules. Trends Biochem. Sci. 25, 537– 539. Holmgren, A., and Aslund, F. (1995) Glutaredoxin. Methods Enzymol. 252, 283–292. Adler, V., Zhimin, Y., Tew, K. T., and Ronai, Z. (1999) Role of redox potential and reactive oxygen species in stress signaling. Oncogene 18, 6104 – 6111. Chrestensen, C. A., Starke, D. W., and Mieyal, J. J. (2000) Acute cadmium exposure inactivate thioltransferase (Glutaredoxin), inhibits intracellular reduction of protein-glutathionyl-mixed disulfides, and initiates apoptosis. J. Biol. Chem. 275, 26556 – 26565. Hirota, K., Matsui, M., Murata, M., Takashima, Y., Cheng, F. S., Itoh, T., Fukuda, K., and Yodoi, J. (2000) Nucleoredoxin, glutaredoxin and thioredoxin differentially regulate NF-kB, AP-1, and CREB activation in HEK293 cells. Biochem. Biophys. Res. Commun. 274, 177–182. Daily, D., Vlamis-Cardikas, A., Offen, D., Mittelman, L., Melamed, E., Holmgren, A., and Barzilai, A. (2001) Glutaredoxin protects cerebellar granule neurons from dopamine-induced Apoptosis by dual activation of the Ras-phosphoinositide 3 kinase and Jun N-terminal kinase Pathways. J. Biol. Chem. 276, 1335– 1344. Nakamura, H., Bai, J., Nishinaka, Y., Ueda, S., Sasada, T., Ohshio, G., Imamura, M., Takabayashi, A., Yamaoka, Y., and Yodoi, J. (2000) Expression of thioredoxin and glutaredoxin, redox-regulating proteins, in pancreatic cancer. Cancer Detect. Prev. 24, 53– 60. Mora, J., Cheung, N. K., Kushner, B. H., LaQuaglia, M. P., Kramer, K., Fazzari, M., Heller, G., Chen, L., and Gerald, W. L. (2000) Clinical categories of neuroblastoma are associated with different patterns of loss of heterozygosity on chromosome arm 1p. J. Mol. Diagn. 2, 37– 46. Suarez, B. K., Lin, J., Burmester, J. K., Broman, K. W., Weber, J. L., Banerjee, T. K., Goddard, K. A., Witte, J. S., Elston, R. C., and Catalona, W. J. (2000) A genome screen of multiplex sibships with prostate cancer. Am. J. Hum. Genet. 66, 933–944. Lundberg, M., Johansson, C., Chandra, J., Enoksson, M., Jacobsson, G., Ljung, J., Johansson, M., and Holmgren, A. (2001) Cloning and expression of a novel human glutaredoxin (Grx2) with mitochondrial and nuclear isoforms. J. Biol. Chem., in press.