- Email: [email protected]
A novel immune-related gene HDD1 of silkworm Bombyx mori is involved in bacterial response
Molecular Immunology 88 (2017) 106–115
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
A novel immune-related gene HDD1 of silkworm Bombyx mori is involved in bacterial response
MARK
Kui Zhang1, Guangzhao Pan1, Yuzu Zhao, Xiangwei Hao, Chongyang Li, Li Shen, Rui Zhang, ⁎ Jingjing Su, Hongjuan Cui State Key Laboratory of Silkworm Genome Biology, The Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, China
A R T I C L E I N F O
A B S T R A C T
Keywords: BmHDD1 20E Insect immunity Bacterial response Bombyx mori
Insects have evolved an effective immune system to respond to various challenges. In this study, a novel immune-related gene, called BmHDD1, was first charactered in silkworm, Bombyx mori. BmHDD1 contained an ORF of 837 bp and encoding a deduced protein of 278 amino acids. BmHDD1 was specifically expressed in hemocytes, and highly expressed at the molting and metamorphosis stages under normal physiological conditions. Our results suggested that BmHDD1 was mainly generated by hemocytes and secreted into hemolymph. Our results also showed that the expression level of BmHDD1 was significantly increased after 20E injection, which indicated that BmHDD1 might be regulated by ecdysone. More importantly, BmHDD1 was dramatically induced after injected with different types of PAMPs or bacteria, either in hemocytes or fat body. Those results suggested that BmHDD1 plays a role in developing and immunity system in silkworm, Bombyx mori.
1. Introduction Organisms have evolved an effective immune system, which including innate and acquired immunity to respond to various challenges. As the biggest population, insects have developed a special immune system during the long-term evolutionary progress. They have an effective innate immunity to eliminate invading pathogenic microorganisms, but with lacking of adaptive immune system (Lemaitre and Hoffmann, 2007). Innate immunity includes humoral and cellular defenses, and humoral defenses mainly includes soluble effector molecules, such as antimicrobial peptides, polyphenoloxidase, lysozyme, anti-virus factor, lectin, and proteinase inhibitor (Kanost et al., 2004). Cellular immunity includes phagocytosis, encapsulation, and nodule, which are mainly mediated by hemocytes (Oliver et al., 2011; Liu et al., 2013; Satyavathi et al., 2014; Zhang et al., 2014a). The domesticated silkworm, Bombyx mori is an economic insect, can secrete silk to form cocoon. At the same time, it also could be used as a lepidopteron insect model. Although whole-genome sequencing, more than 20,000 genes were identified in silkworm. However, nearly one quarter of them are novel genes (Xia et al., 2004; Xia et al., 2009; Xia et al., 2014). In this study, a novel gene BmHDD1 was first cloned and identified in silkworm, Bombyx mori. Its temporal and spatial expression profiles were investigated. BmHDD1 recombinant protein was acquired using ⁎
1
Corresponding author at: 2, Tiansheng Rd., Beibei District Chongqing, China. E-mail address: [email protected] (H. Cui). These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.molimm.2017.06.023 Received 20 December 2016; Received in revised form 5 June 2017; Accepted 7 June 2017 0161-5890/ © 2017 Elsevier Ltd. All rights reserved.
prokaryotic expression system and purified by Ni-affinity chromatography, and antibody against was generated and verified. The response to the treatment of 20-Hydroxyecdysone (20E) and various bacteria were also surveyed. 2. Materials and methods 2.1. Insect and cell line The Bombyx mori strain Dazao used in this study was from our laboratory and reared with fresh mulberry (Zhang et al., 2015a). Eggs were collected during whole embryo stages. Epidermis, malpighian tubules, midgut, silk gland, head, hemocytes, ovary, testis, and fat body in day 3 of the fifth-instar were dissected or collected. All materials were stored in liquid nitrogen. The silkworm cell line BmE-SWU3 was generated in our lab (Xu et al., 2015a) and was cultured in Grace medium (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen). 2.2. RNA isolation and cDNA synthesis Total RNA was extracted by TRIzol (Takara, Japan) according to the manufacturer's instructions. Subsequently, Total RNAs were treated with DNase I (Takara, Japan) for 30 min at 37 °C to remove the residual
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
2.6. Polyclonal antibody preparation
Table 1 Sequences of the primers were used in this study. Name
Sequence (5′-3′)
Usage
BmHDD1-F BmHDD1-R GSP1 NGSP1 GSP2 NGSP2 Bm HDD1-CDS-F Bm HDD1-CDSR BmHDD1-PE-F BmHDD1-PE-R BmHDD1-qRT-F BmHDD1-qRT-R BmGAPDH-qRTF BmGAPDH-qRTR
ATGTACAGACTAGTGTGCTTCCTT TTAATGAGACAAGAAGCCATTAC GCCGTGGTGCGATCAGCAGTAGTG CCTCAGGTTTCTGGGTCGTAATCA CGACCCAGAAACCTGAGGAGTTCT CGACGATTCCACCAGTGGGTTACA ATGTACAGACTAGTGTGCTTCCTT ATCATTTCGCGCGTACTTAT
PCR
AACGACATTGTTATCGGCC ATCATTTCGCGCGTACTTAT ACGTTGAAGTTTATTCTGTGCCC TTCAGTTGTCGCTGTGAAGGTC CATTCCGCGTCCCTGTTGCTAAT
Mice were immunized to prepare the polyclonal antibody against BmHDD1. For the first immunization, 50 μg proteins were used with mixed and homogenized with an equal volume of Freund’s complete adjuvant (Sigma). For the following three subsequent immunizations, 75, 100, and 125 μg proteins were used with Freund’s incomplete adjuvant respectively. 150 μg proteins were injected directly without any adjuvant in the fifth immunization. Three days after the last immunization, mice were killed and the serum was collected and stored.
5′RACE 3′RACE Overexpression
2.7. Western blotting assay
Prokaryotic expression
Hemocytes and fat body were harvested, and suspended in RIPA Lysis Buffer for protein analysis. Protein concentrations were measured using a BCA protein assay kit (Beyotime Biotech, China). Cell lysate or cell-free hemolymph were subjected to SDS-PAGE and transferred onto PVDF membranes (Millipore, USA). After blocking with 5% BSA, the membranes were incubated gently with primary antibody against BmHDD1 (1:200) or Tubulin (1:1000, Beyotime) at 4 °C overnight. After washed with TBST buffer (20 mM Tris-HCl, 500 mM NaCl, and 0.1% Tween 20), the membranes were incubated with HRP-labeled goat anti-mouse IgG (H + L) (Invitrogen, 1:10000) at room temperature for 2 h. Proteins were visualized by SuperSignal West Femto Maximum Sensitivity Substrate (Thermo SCIENTIFIC) using a western blotting detection instrument (Clinx Science). The western blot bands were quantified using ImageJ software.
qRT-PCR
GCTGCCTCCTTGACCTTTTGC
genomic DNA. First-strand cDNA was synthesized with M-MLV reverse transcriptase (Promega, USA) by using 1–5 μg of total RNA in a 20 μL reaction mixture according to the protocol provided by the manufacturer. 2.3. Gene cloning and rapid amplification of cDNA ends (RACE) The predicated coding-sequence (CDS) and EST sequences were downloaded from SilkDB (http://www.silkdb.org/silkdb/) and KAIKObase (http://sgp.dna.affrc.go.jp/KAIKObase/). Primers were designed and the fragment of the BmHDD1 was acquired by PCR. The PCR condition included 2 min initial denaturation at 94 °C, followed by 25–35 cycles of the following: 30 s denaturation at 94 °C, 30 s annealing at 55 °C, 1 min of extension at 72 °C and a final 10 min extension at 72 °C. Subsequently, 3′ and 5′ RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) were performed to obtain its full-length cDNA according to the GeneRacer™ kit (Clontech, USA) manual. All primers used in this study were listed in Table 1. All PCR products were cloned into PMD19-T vector (TaKaRa, Japan) and sequenced at BGI (Beijing, China).
2.8. Immunofluorescence assay Hemocytes were collected in the molting stage of 4th instar larva by cutting a leg and incubated for 15 min at room temperature. After attached, cells were washed and fixed with 4% PFA for 15 min. Samples were permeabilized using 0.5% Triton-X 100 for 15 min. Washed three times, cells were blocked with 10% goat serum for 2 h at 37 °C. Subsequently, the cells were incubated with anti-BmHDD1 serum (1:200) for 1 h at 37 °C. Cells washed three times and incubated with Alexa Fluor®488 goat anti-mouse IgG (H + L) (1:1000, Invitrogen) for 1 h. Hoechst 33342 (1:2000, Invitrogen) was used for nuclear staining. Cells were observed under an inverted fluorescence microscopy (Nikon 80i).
2.4. Bioinformatic and phylogeny analysis 2.9. Bacteria challenge experiment The nucleotide of BmHDD1 was analyzed with the BioEdit program. The open reading frame (ORF) of BmHDD1 was confirmed by the ORF Finder software (http://www.ncbi.nlm.nih.gov/gorf.html). The molecular weight and isoelectric point was calculated using isoelectric point calculator (http://isoelectric.ovh.org/). The signal peptide and transmember domain were predicted by SignalP 4.0 (http://www.cbs.dtu. dk/services/SignalP) and TMpred (http://www.ch.embnet.org/ software/TMPRED_form.html) respectively. The SMART (http:// smart.embl-heidelberg.de/) was also used to analyze the predict protein.
Two PAMPs (pathogen-associated molecular pattern) molecular, including PGN (Peptidoglycan from Bacillus subtilis, SIGMA), and LPS (Lipopolysaccharides from Escherichia coli 055:B5, SIGMA), and three types of bacteria, including S. aureus, E. Coli, and P. aeruginosa, were used in this challenging experiment. 0.2 μg PGN, or 1 μg LPS was injected into each larva on the third day of the 5th instar, respectively. PBS buffer was used for control. Hemocytes and fat body were collected at different time points. S. aureus, E. Coli, and P. aeruginosa were stored in our laboratory, and were cultured on Luria-Bertani (LB) broth at 220 rpm at 37 °C on a shaker. The cultured bacteria were inactivated by 0.1% PFA at 37 °C for 1 day. After washed, centrifuged, and re-suspended in the PBS buffer, bacteria were counted by a hemocytometer. On the third day of the 5th instar, larva was injected with either S. aureus (106 CFU/Larva), E. Coli (Two gradients, 106, and 107 CFU/Larva), or P. aeruginosa (106 CFU/ Larva). The hemocytes, fat body, and cell-free hemolymph were collected at different time points for further analysis.
2.5. Expression and purification of the recombinant protein The full-length CDS sequence of BmHDD1 without the signal peptide, was cloned to PET22b vector, and transformed into E. Coli Rosetta (DE3). 0.1 mM IPTG was used for 24 h at 16 °C to induce the recombinant protein expression. Induced bacteria were centrifuged and washed with PBS, and re-suspended in PB buffer (19 mM NaH2PO4, 81 mM Na2HPO4, pH 7.4). After homogenized and centrifuged, the supernatant was filtrated and used for further purification. The sample was loading onto Ni-NTA His Bind Resin (Novagen, USA) and washed with imidazole gradient elution buffer. All fractions were collected and subjected to SDS-PAGE.
2.10. Injection of 20E The second day of the 5th instar larva was chosen for 20E (20Hydroxyecdysone, Sigma Aldrich, USA) at the dose of 1.5 μg/larva. 107
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
expressed as mean ± standard error. The significance of differences was determined with one-way analysis of variance (ANOVA) and a ttest as shown in previous describe (Zhu et al., 2017). The P values < 0.05 and < 0.01 were considered statistically and extremely statistically significant, respectively.
Ethanol was used as control as described in our previous study (Zhang et al., 2014b; Zhang et al., 2015b). Briefly, hemocytes, fat body and cell-free hemolymph were collected at 3, 6, 12, 24, and 48 h after 20E treatment. Each group was employed at least 10 silkworms. 2.11. Quantitative real-time PCR (qRT-PCR)
3. Results qRT-PCR was used to detect the mRNA expression of BmHDD1, as described in previous reports (Li et al., 2016; Xu et al., 2015b). qRTPCR was performed on a LightCycler 96 (Roche) machine using the GoTaq® qPCR Master Mix (Promega, USA). The reaction volume was 20 μL, which contains 10 μL of 2 × GoTaq® Probe qPCR Master Mix, 2 μL of the diluted cDNA template, 0.4 μL of each primers (10 μM), and 7.2 μL of distilled water. The qPCR consisted of 10 min at 95 °C, followed by 45 cycles of 95 °C for 15 s and 60 °C for 30 s. The primers used are listed in Table 1, and BmGAPDH was used as an internal control. The results were analyzed based on the standard 2−ΔΔCt method (Livak and Schmittgen, 2001). All data were given in terms of relative transcripts expression as means ± SE. The statistical significance were analyzed by an online server GraphPad Software (http://www. graphpad.com/quickcalcs/ttest1.cfm), and the P < 0.05 were considered to indicate statistical significance.
3.1. The BmHDD1 was cloned and identified The transcriptome difference of hematopoietic lineages of silkworm has been systematically analyzed by RNA-seq in our previous study (data not shown). Results showed that there was a difference between granulocytes and plasmatocytes, which are the two main cell types of hemocytes in silkworm. Interestingly, a novel transcript named Bm_nscaf3099_107, was found highly expressed in hemocytes. This transcript was clustered on nscaf3099, which was located on chromosome 28 in silkworm genome. A full-length cDNA of the BmHDD1 was acquired by RT-PCR and RACE technology. BmHDD1 was a single exon gene and the size of the cDNA was 1340 bp, which contains a 23 bp 5′UTR, a 480 bp 3′-UTR and an ORF of 837 bp. BmHDD1 encoding a putative protein of 278 amino acids peptide with predicted molecular weight of 30.35 kDa, and an isoelectric point of 4.86 (Fig. 1A, B). The BmHDD1 predicted peptide contains a signal peptide and a MBF2 domain (Fig. 1C). Stop codon (TAA), the polyadenylation consensus signal (AATAA), and a poly (A) tail were found in the 3′UTR area (Fig. 1B). Multiple alignment of BmHDD1 with its orthologs suggested that the
2.12. Statistical analysis All experiments were carried out in three technical and biological replicates. All data were analyzed with SPSS statistics software, and are
Fig. 1. Bioinformatics of BmHDD1 in silkworm, Bombyx mori. (A) The genomic locations of BmHDD1. The red boxes and black arrow represent the BmHDD1 localization and transcriptional orientation, respectively. (B) The nucleotide and deduced amino acid sequence of BmHDD1. Numbers to the left of each row refer to nucleotide position; the initiation codon (ATG) and the terminator codon (TAA) are labeled in red; the polyadenylation signal sequence (AATAA) is labled by red box; the red and green background with white letters represent signal peptide and MBF2 domain, respectively. (C) Conserved domains of BmHDD1 are highlighted. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
108
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 2. Multiple alignment of BmHDD1 with the homologous amino acid sequences from other species. Identities are shaded in dark gray and similarities in light gray. The homologous amino acid sequences from Hyphantria cunea (Hc, AAD09279.1), Amyelois transitella (At, XP_013195139.1), Danaus plexippus (Dp, EHJ72619.1), and Operophtera brumata(Ob, KOB74444.1) were analyzed.
also investigated by using qRT-PCR (Fig. 3D). In hemocytes, the expression level of BmHDD1 reached top on L4 M stage, followed by a rapid decline, and growth rised again during metamorphosis stage (Fig. 3D). On the whole, the expression level of BmHDD1 in fat body was lower than in hemocytes. Similarly with hemocytes, the expression of BmHDD1 in fat body reached on peaks in molting and metamorphosis stages (Fig. 3D).
MBF2 domain was highly conserved (Fig. 2). 3.2. BmHDD1 is specifically and highly expressed in hemocytes During embryonic development, transcript levels of BmHDD1 were undetectable from day 1 to day 6, while reached a peak at day 7, then rapidly decreased from day 8 to day 9 (Fig. 3A). In Larval stage However, it’s highly and specifically expressed in hemocytes, but not in other tissues such as epidermis, malpighian tubules, midgut, silk gland, head, ovary, testis, and fat body either at the third day of the 5th instar larva or the second day of pre-pupa (Fig. 3B, C). Moreover, the temporal expression patterns of BmHDD1 in hemocytes and fat body were
3.3. BmHDD1 is a secreted protein To detect the expression of BmHDD1, a western blot analysis was conducted. In the present study, a signal peptide was found in the NFig. 3. The expression profiles of BmHDD1. (A) The expression levels of BmHDD1 in silkworm embryo development. The expression patterns of BmHDD1 in different tissues from the third day of the 5th instar larva (B) and second day of prepupa stage (C). Ep, epidermis; Ma, Malpighian tubules; Mi, midgut; Si, silk gland; He, head; Ha, hemocytes; Ov, ovary; Te, testis; Fa, fat body. (D) The temporal expression of BmHDD1 in larval hemocytes and fat body. cDNA of hemocytes and fat body from the third day of the 4th instar to the wandering stage were analyzed. Experiments were carried out in three technical and biological replicates. The data are shown as the mean ± S.E.M. derived from three repeats.
109
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
terminal of BmHDD1, it is indicated that BmHDD1 may be secreted into hemolymph. Herein, protein from cell-free hemolymph and hemocytes were subjected to western blot, results showed that BmHDD1 both exist in hemolymph and hemocytes (Fig. 4). To increase the credibility, the purified recombinant BmHDD1 protein (rBmHDD1) was used as a positive control. To further investigate the expression of BmHDD1 in hemocytes, the immunofluorescence assay was conducted. As shown in Fig. 5, a signal was observed in the cytoplasm of hemocytes. 3.4. Subcellular localization of BmHDD1 The subcellular localization of BmHDD1 was determined by the expression of BmHDD1-EGFP fusion protein in BmE-SWU3 cells (Fig. 6). Western blotting test shown that the BmHDD1-EGFP fusion protein was successfully expressed (Fig. 6B). As shown in Fig. 6C, the BmHDD1-EGFP fusion protein was distributed in the cytoplasm. In the control group, the green fluorescent signal was observed in both cytoplasm and nuclei. At the same time, cells were stained with mouse
Fig. 4. The expression of BmHDD1 was detected in silkworm larval hemolymph by western blot. Cell-free hemolymph and hemocytes from the third day of the 5th instar larva were subjected to western blot analysis, and the purified recombinant BmHDD1 protein (rBmHDD1) was used as a positive control.
Fig. 5. Immunofluorescence staining of silkworm hemocytes with anti-BmHDD1 antibody. Hemocytes from the third day of the 5th instar larva were analyzed.
Fig. 6. Subcellular localization of BmHDD1 in BmE-SWU3 cell line. (A) Schematic representation of the ectopic expression vector. (B) BmE-SWU3 was transfected with PIZ-opIE2-EGFP or PIZ-opIE2-BmHDD1-EGFP, and then subjected to western blotting analysis with anti-BmHDD1 polyclonal antibody. (C) Subcellular localization of BmHDD1 with fluorescence microscopy. Cells were transfection with PIZ-opIE2-EGFP (upper row) or PIZ-opIE2BmHDD1-EGFP (Lower row). Three days later, cells were treated with anti-BmHDD1 and second-fluorescence, finally stained with Hoechst 33342.
110
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 7. Relative expression level of BmHDD1 in response to 20E treated in hemocytes (A) and fat body (B). The differences between the experimental and the control groups were analyzed with one-way analysis of variance (ANOVA) and a ttest, *P < 0.05, **P < 0.01. Experiments were carried out in three technical and biological replicates.
the BmHDD1 in silkworm, different types of bacteria, which including one gram-positive bacteria (S. aureus), two kinds of gram-negative bacteria (E. Coli, and P. aeruginosa), were killed and used to stimulate silkworm larva. All bacteria test in the current study could significantly upregulated the expression of BmHDD1. As shown in Fig. 10C, the expression level of BmHDD1 increased after injection P. aeruginosa (Pa), approached about 12.2,7.8, and 2.5 times of blank control at 3, 6, and 12 h. Most notably, the expression of BmHDD1 continued to increase after injection with E. Coli, the detection value raisen at least 20 times at detected point (Fig. 10B). S. aureus (Sa) infection could significatly upregulate the expression level of BmHDD1 at 2–12 h, and the expression level then downregulated at 24–24 h (Fig. 10D).
polyclonal antibody anti-BmHDD1, results shown that the antiBmHDD1 signal (Red) could be completely merged with EGFP signal (Green). In conclusion, the subcellular localization assay showed that BmHDD1 was accumulated in the cytoplasm. 3.5. BmHDD1 could be induced by 20E To analyze whether 20E could affect BmHDD1 expression in vivo, the expression level of BmHDD1 was quantified by real-time quantitative PCR before and after 20E injection. No significant changes were observed in hemocytes and fat body 3, and 6 h after treated by 20E (Fig. 6). However, at 12 h after treated by 20E, the expression level of BmHDD1 was significantly increased, which up-regulated 1.6-, and 7.1fold in hemocytes, and fat body, respectively (Fig. 6). In hemocytes, the changes reached a peak at 24 h after 20E injection (Fig. 7A). And large change ratio were continue maintained in fat body at 24, and 48 h after 20E injection (Fig. 7B). Western blot were used to detect the expression of BmHDD1 after treated by 20E in protein level. In fat body, 20E injection could increase the protein level of BmHDD1 (Fig. 8A), and a similar tendency was observed in hemocytes (Fig. 8B). Subsequently, the BmHDD1 in serum was analyzed individually. As shown in Fig. 8C, a significant increase was also observed. Taken together, the expression level of BmHDD1, both in transcript and protein levels could be induced by 20E both in hemocytes and fat body. 3.6. Transcriptional response of BmHDD1 after bacterial challenge To investigate the potential role BmHDD1 played in silkworm innate immunity, the dynamic changes of the BmHDD1 transcript upon PAMPs and pathogen invasion in hemocytes and fat body, which are the two important immune organs in silkworm, were analyzed using qPCR. Fat body play a critical role in insect growth and development, including immunity. Many host defense factor, including antimicrobial peptides, were mainly produced by fat body and are essential to against foreign invaders in insect (Fauvarque and Williams, 2011a). At 12–48 h post-inject of PGN, the transcription level of BmHDD1 was significantly upregulated (Fig. 9A). The expression of BmHDD1 was significantly upregulated after treated by E. Coli than the control (Fig. 9B). BmHDD1’s transcription level treated by P. aeruginosa (Pa) was strongly up-regulated in all detected points (Fig. 9C). Infection with S. aureus (Sa) also significantly induced the expression of BmHDD1 in fat body, and peaked at 12 h (Fig. 9D). Contrasted with control group, the mRNA expression level of BmHDD1 was significantly up regulated in hemocytes after injection with PGN, the expression level of BmHDD1 were increased about 5.4, 5.2, and 4.3 fold at 3, 6, and 24 h post-injection compared to control, respectively(Fig. 10A). In order to get more detailed information upon
Fig. 8. The BmHDD1 expression was detected by western blot after treated with 20E. (A) Fat body, (B) Hemocytes, (C) Hemolymph. The western blot bands were quantified using ImageJ software.
111
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 9. Time-course expression profiles of BmHDD1 in fat body injected with PGN or different types of inactivated bacteria. A-D show fold changes of BmHDD1 expression in fat body with PGN, E. Coli, P. aeruginosa, and S. aureus, respectively. BmGAPDH was used as an internal control. The differences between the experimental and the control groups were analyzed with one-way analysis of variance (ANOVA) and a t-test, *P < 0.05, **P < 0.01. Experiments were carried out in three technical and biological replicates.
that MBF2 is involved in BmFTZ-F1-mediated activation of the Fushi tarazu gene (Li et al., 1994). What more, MBF2 could activate transcription through interacting with TFIIA (QL et al., 1997). Recently, nine homologous genes of MBF2 were identified and found that these proteins were related to insect defense against pathogens and nutrient metabolism (Zhou et al., 2016). Herein, a novel gene BmHDD1 contains MBF2 domain was firstly identified from silkworm hemocytes (Fig. 1). Sequence analysis showed that BmHDD1 protein had low homology with other MBF2-contained members that have been reported in silkworm (data not shown). Temporal and spatial expression profiles of BmHDD1 were detailedly surveyed with qRT-PCR (Fig. 3). Those results indicated that BmHDD1 was specific-expressed in hemocytes under normal physiological conditions, which suggested that it could play a role in silkworm hemocytes. Interestingly, the expression peaks of BmHDD1 appeared at the 4th molting and metamorphosis stages, both in hemocytes and fat body, although the expression of BmHDD1 in fat body was lower than in hemocytes (Fig. 3D). We hypothesized that BmHDD1 could participate in silkworm molting and metamorphosis processes, which are most regulated by ecdysone hormone. Furthermore, the expression levels of BmHDD1 were significantly increased after treated with 20E either in hemocytes or fat body (Figs. 7 and 8).
Western blot analysis was used to detect the expression of BmHDD1 after challenged with E. Coli, which could significantly induced the BmHDD1’s expression in RNA level. After treated with E. Coli (106 CFU/ larva), significant increase of BmHDD1 were observed at 24 and 48 h post-injection in fat body (Fig. 11A). In circulating hemocytes, a significant increase of BmHDD1 was observed at 24 h post-injection. However, BmHDD1 was significantly decreased at post-injection with a low level of tubulin, which was used as an internal control (Fig. 11B). Furthermore, the secreted BmHDD1 was also investigated, and the results suggested that the protein content in hemolymph increased at 24 and 48 h post-injection. 4. Discussion A novel gene BmHDD1 was firstly identified in hemocytes cDNA library generated in our lab. In the present study, the 1340 bp fulllength cDNA of BmHDD1 was acquired, which contained an ORF of 837 bp and encoding a deduced protein of 278 amino acids. This deduced protein contains one MBF2 (Multiprotein bridge factor 2) domain, which is a kind of Lepidopteran specific genes and temporalspatial specific genes (Liu et al., 1998; Liu et al., 2000). MBF2 plays a key role in the development of silkworm. Previous reports suggested
112
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 10. Time-course expression profiles of BmHDD1 in hemocytes injected with PAMPs or different types of inactivated bacteria. A-E show fold changes of BmHDD1 expression in hemocytes with PGN, E. Coli, P. aeruginosa, and S. aureus, respectively. BmGAPDH was used as an internal control. The differences between the experimental and the control groups were analyzed with one-way analysis of variance (ANOVA) and a t-test, *P < 0.05, **P < 0.01. Experiments were carried out in three technical and biological replicates.
that 20E could also enhance the immune response in silkworm (Sun et al., 2016). Here, BmHDD1 remarkably increased after treated with 20E (Fig. 8A, B), and the secretory protein in hemolymph also increased significantly (Fig. 8C). In drosophila, 20E controls the expression of immune related genes through the direct and indirect ways (Rus et al., 2013). While, the mechanism of 20E induced the expression of BmHDD1 remains to be further studied in silkworm. Insect immunity is a defense mechanism against attacking by various parasitoids. Generally, hemocytes and fat body were considered as two important components, which are mainly involved in cellular and humoral immunity, respectively (Liu et al., 2013; Fauvarque and Williams, 2011b). Stimulation of silkworm with different kinds of PAMPs or bacteria shown that the expression level of BmHDD1 increased either in fat body (Fig. 9) or in hemocytes (Fig. 10). This indicated that BmHDD1 has effect on immunity. Furthermore, our results shown that BmHDD1 were increased not only in fat body and hemocytes, but also in cell-free hemolymph when challenged with E. Coli (Fig. 11). We hypothesized that BmHDD1 could be induced and secreted into hemolymph, and participate in immune response when encounter immune challenges in silkworm. Clearance or phagocytosis
Polyclonal antibody of BmHDD1 was prepared through immunization of mice with recombinant BmHDD1 protein, which was expressed by using prokaryotic expression system and purified with the method of nickel affinity chromatography. Western blot shown that anti-BmHDD1 could specific recognition of the recombinant protein and endogenous BmHDD1 protein (Figs. 4 and 6). The BmHDD1 could be detected both in cell-free hemolymph and circulating hemocytes, our results indicated that BmHDD1 was a secreted protein, and its mainly generated and secreted by hemocytes. As one of the two most important regulators in insect, 20E is not only play a major role in insect fundamental events, including growth, development, metamorphosis, and reproduction, but also involved in insect innate immune response (Kozlova and Thummel, 2003; Lafont et al., 2012). 20E could induced the exprssion of the immune related genes, especially antimicrobial peptide genes (AMPs) in Drosophila melanogaster (Meister and Richards, 1996; Dimarcq et al., 1997; Tan et al., 2014), and promotes the immunological functions of hemocyte, including hemocyte motility, encapsulation, phagocytosis and nodulation (Lanot et al., 2001; Sorrentino et al., 2002; Franssens et al., 2006; Regan et al., 2013; Sampson et al., 2013). Sun and his colleagues found
113
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
2014a). Our preliminary results shown that the recombinant BmHDD1 protein could significantly enhance the bacterial clearance ability of the hemocytes (data not shown). However, the function of BmHDD1 in silkworm, especially in innate immune response, needs to be further studied. In conclusion, a novel immune-related gene, named BmHDD1 was firstly identified in silkworm, Bombyx mori. In the present study, temporal and spatial expression profiles of BmHDD1 were analyzed, and found it mainly expressed in hemocytes and secreted into hemolymph under normal physiological conditions. Our results also showed that the expression of BmHDD1 could be significantly induced by 20E and various microbial, both in hemocytes and fat body. All the results showed that BmHDD1 plays a role in developing and immunity system in silkworm. However, further research is needed and better understanding of the function of BmHDD1 will pave a new way for the strategy development of silkworm diseases prevention.
Acknowledgements This work was supported by the National Natural Science Foundation of China (31672496), the Natural Science Foundation of Chongqing (cstc2016jcyjA0425), Chongqing University Innovation Team Building Program funded projects (CXTDX201601010), the Graduate Scientific Research Foundation of Chongqing (CYB2015067), and the Fundamental Research Funds for the Central Universities (XDJK2015D021).
Fig. 11. The BmHDD1 expression was detected by western blot protein after treated with inactivated E. Coli. (A) Fat body, (B) Hemocytes, (C) Hemolymph. The western blot bands were quantified using ImageJ software.
of pathogens is an important function of hemocytes (Zhang et al., Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molimm.2017.06.023.
and Samia cynthia. Gene 220, 55–59. Liu, Q.X., Ueda, H., Hirose, S., 2000. MBF2 is a tissue- and stage-Specific coactivator that is regulated at the step of nuclear transport in the silkworm bombyx mori. Dev. Biol. 225, 437–446. Liu, F., Xu, Q., Zhang, Q., Lu, A., Beerntsen, B.T., Ling, E., 2013. Hemocytes and hematopoiesis in the silkworm, Bombyx mori. Invertebr. Survival J. 10, 102–109. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realTime quantitative PCR and the 2-ΔΔCT. Method methods 25, 402–408. Meister, M., Richards, G., 1996. Ecdysone and insect immunity: the maturation of the inducibility of the diptericin gene in Drosophila larvae. Insect Biochem. Mol. Biol. 26, 155–160. Oliver, J.D., Loy, J.D., Parikh, G., Bartholomay, L., 2011. Comparative analysis of hemocyte phagocytosis between six species of arthropods as measured by flow cytometry. J. Invertebr. Pathol. 108, 126–130. QL, F.-Q.L., Takemaru, K.I., Goto, M., Ueda, H., Handa, H., Hirose, S., 1997. Transcriptional activation through interaction of MBF2 with TFIIA. Genes Cells 2, 143–153. Regan, J.C., Brandão, A.S., Leitão, A.B., Dias, Â.R.M., Sucena, É., Jacinto, A., ZaidmanRémy, A., 2013. Steroid hormone signaling is essential to regulate innate immune cells and fight bacterial infection in Drosophila. PLoS Pathog. 9, e1003720. Rus, F., Flatt, T., Tong, M., Aggarwal, K., Okuda, K., Kleino, A., Yates, E., Tatar, M., Silverman, N., 2013. Ecdysone triggered PGRP-LC expression controls Drosophila innate immunity. EMBO J. 32, 1626–1638. Sampson, C.J., Amin, U., Couso, J.-P., 2013. Activation of Drosophila hemocyte motility by the ecdysone hormone. Biology open 2, 1412–1420. Satyavathi, V.V., Minz, A., Nagaraju, J., 2014. Nodulation: an unexplored cellular defense mechanism in insects ☆. Cell. Signal. 26, 1753–1763. Sorrentino, R.P., Carton, Y., Govind, S., 2002. Cellular immune response to parasite infection in the Drosophila lymph gland is developmentally regulated. Dev. Biol. 243, 65–80. Sun, W., Shen, Y.-H., Zhou, L.-X., Zhang, Z., 2016. Ecdysone titer determined by 3DE-3βreductase enhances the immune response in the silkworm. J. Immunol. 196,
References Dimarcq, J.-L., Imler, J.-L., Lanot, R., Ezekowitz, R.A.B., Hoffmann, J.A., Janeway, C.A., Lagueux, M., 1997. Treatment of l (2) mbn Drosophila tumorous blood cells with the steroid hormone ecdysone amplifies the inducibility of antimicrobial peptide gene expression. Insect Biochem. Mol. Biol. 27, 877–886. Fauvarque, M.O., Williams, M.J., 2011a. Drosophila cellular immunity: a story of migration and adhesion. J. Cell Sci. 124, 1373–1382. Fauvarque, M.O., Williams, M.J., 2011b. Drosophila cellular immunity: a story of migration and adhesion. J. Cell Sci. 124, 1373–1382. Franssens, V., Smagghe, G., Simonet, G., Claeys, I., Breugelmans, B., De Loof, A., Broeck, J.V., 2006. 20-Hydroxyecdysone and juvenile hormone regulate the laminarin-induced nodulation reaction in larvae of the flesh fly, Neobellieria bullata. Dev. Compar. Immunol. 30, 735–740. Kanost, M.R., Jiang, H., Yu, X.Q., 2004. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 198, 97–105. Kozlova, T., Thummel, C.S., 2003. Essential roles for ecdysone signaling during Drosophila mid-embryonic development. Science 301, 1911–1914. Lafont, R., Dauphin-Villemant, C., Warren, J., Rees, H., 2012. Ecdysteroid chemistry and biochemistry. Insect Endocrinol. 106–176. Lanot, R., Zachary, D., Holder, F., Meister, M., 2001. Postembryonic hematopoiesis in drosophila. Dev. Biol. 230, 243–257. Lemaitre, B., Hoffmann, J., 2007. The host defense of drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. Li, F.Q., Ueda, H., Hirose, S., 1994. Mediators of activation of fushi tarazu gene transcription by BmFTZ-F1. Mol. Cell. Biol. 14, 3013–3021. Li, H., Wang, S., Qian, Z., Wu, Z., Lǚ, K., Weng, S., He, J., Li, C., 2016. MKK6 from pacific white shrimp Litopenaeus vannamei is responsive to bacterial and WSSV infection. Mol. Immunol. 70, 72–83. Liu, Q.X., Ueda, H., Hirose, S., 1998. Comparison of sequences of a transcriptional coactivator MBF2 from three Lepidopteran species Bombyx mori, Bombyx mandarina
114
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
silkworm Bombyx mori. J. Insect Physiol. 71, 61–67. Zhang, K., Xu, M., Su, J., Yu, S., Sun, Z., Li, Y., Zhang, W., Hou, J., Shang, L., Cui, H., 2014b. Characterization and identification of the integrin family in silkworm, Bombyx mori. Gene 549, 149–155. Zhang, K., Yu, S., Su, J., Xu, M., Tan, P., Zhang, Y., Xiang, Z., Cui, H., 2015a. Identification and characterization of three novel hemocyte-specific promoters in silkworm Bombyx mori. Biochem. Biophys. Res. Commun. 461, 102–108. Zhang, K., Su, J., Chen, S., Yu, S., Tan, J., Xu, M., Liang, H., Zhao, Y., Chao, H., Yang, L., 2015b. Molecular cloning, characterization and expression analysis of cathepsin O in silkworm Bombyx mori related to bacterial response. Mol. Immunol. 66, 409–417. Zhou, C.Y., Zha, X.F., Liu, C., Han, M.J., Zhang, L.Y., Shi, P.P., Wang, H., Zheng, R.W., Xia, Q.Y., 2016. Identification of MBF2 family genes in Bombyx mori and their expression in different tissues and stages and in response to Bacillus bombysepticus infection and starvation. Insect Sci. 23, 502–512. Zhu, J., Wang, H., Wang, J., Wang, X., Peng, S., Geng, Y., Wang, K., Ouyang, P., Li, Z., Huang, X., 2017. Identification and characterization of a β-defensin gene involved in the immune defense response of channel catfish, Ictalurus punctatus. Mol. Immunol. 85, 256–264.
1646–1654. Tan, K.L., Vlisidou, I., Wood, W., 2014. Ecdysone mediates the development of immunity in the Drosophila embryo. Curr. Biol. 24, 1145–1152. Xia, Q., Zhou, Z., Lu, C., Cheng, D., Dai, F., Li, B., Zhao, P., Zha, X., Cheng, T., Chai, C., 2004. A draft sequence for the genome of the domesticated silkworm (Bombyx mori). Science 306, 1937–1940. Xia, Q., Guo, Y., Zhang, Z., Li, D., Xuan, Z., Li, Z., Dai, F., Li, Y., Cheng, D., Li, R., 2009. Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx). Science 326, 433–436. Xia, Q., Li, S., Feng, Q., 2014. Advances in silkworm studies accelerated by the genome sequencing of Bombyx mori. Annu. Rev. Entomol. 59, 513–536. Xu, M., Tan, J., Wang, X., Zhong, X., Cui, H., 2015a. Establishment and characterization of a new embryonic cell line from the silkworm, Bombyx mori. ISJ 12. Xu, M., Wang, X., Tan, J., Zhang, K., Guan, X., Patterson, L.H., Ding, H., Cui, H., 2015b. A novel Lozenge gene in silkworm Bombyx mori regulates the melanization response of hemolymph. Dev. Compar. Immunol. 53, 191. Zhang, K., Tan, J., Xu, M., Su, J., Hu, R., Chen, Y., Xuan, F., Yang, R., Cui, H., 2014a. A novel granulocyte-specific α integrin is essential for cellular immunity in the
115
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
A novel immune-related gene HDD1 of silkworm Bombyx mori is involved in bacterial response
MARK
Kui Zhang1, Guangzhao Pan1, Yuzu Zhao, Xiangwei Hao, Chongyang Li, Li Shen, Rui Zhang, ⁎ Jingjing Su, Hongjuan Cui State Key Laboratory of Silkworm Genome Biology, The Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, China
A R T I C L E I N F O
A B S T R A C T
Keywords: BmHDD1 20E Insect immunity Bacterial response Bombyx mori
Insects have evolved an effective immune system to respond to various challenges. In this study, a novel immune-related gene, called BmHDD1, was first charactered in silkworm, Bombyx mori. BmHDD1 contained an ORF of 837 bp and encoding a deduced protein of 278 amino acids. BmHDD1 was specifically expressed in hemocytes, and highly expressed at the molting and metamorphosis stages under normal physiological conditions. Our results suggested that BmHDD1 was mainly generated by hemocytes and secreted into hemolymph. Our results also showed that the expression level of BmHDD1 was significantly increased after 20E injection, which indicated that BmHDD1 might be regulated by ecdysone. More importantly, BmHDD1 was dramatically induced after injected with different types of PAMPs or bacteria, either in hemocytes or fat body. Those results suggested that BmHDD1 plays a role in developing and immunity system in silkworm, Bombyx mori.
1. Introduction Organisms have evolved an effective immune system, which including innate and acquired immunity to respond to various challenges. As the biggest population, insects have developed a special immune system during the long-term evolutionary progress. They have an effective innate immunity to eliminate invading pathogenic microorganisms, but with lacking of adaptive immune system (Lemaitre and Hoffmann, 2007). Innate immunity includes humoral and cellular defenses, and humoral defenses mainly includes soluble effector molecules, such as antimicrobial peptides, polyphenoloxidase, lysozyme, anti-virus factor, lectin, and proteinase inhibitor (Kanost et al., 2004). Cellular immunity includes phagocytosis, encapsulation, and nodule, which are mainly mediated by hemocytes (Oliver et al., 2011; Liu et al., 2013; Satyavathi et al., 2014; Zhang et al., 2014a). The domesticated silkworm, Bombyx mori is an economic insect, can secrete silk to form cocoon. At the same time, it also could be used as a lepidopteron insect model. Although whole-genome sequencing, more than 20,000 genes were identified in silkworm. However, nearly one quarter of them are novel genes (Xia et al., 2004; Xia et al., 2009; Xia et al., 2014). In this study, a novel gene BmHDD1 was first cloned and identified in silkworm, Bombyx mori. Its temporal and spatial expression profiles were investigated. BmHDD1 recombinant protein was acquired using ⁎
1
Corresponding author at: 2, Tiansheng Rd., Beibei District Chongqing, China. E-mail address: [email protected] (H. Cui). These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.molimm.2017.06.023 Received 20 December 2016; Received in revised form 5 June 2017; Accepted 7 June 2017 0161-5890/ © 2017 Elsevier Ltd. All rights reserved.
prokaryotic expression system and purified by Ni-affinity chromatography, and antibody against was generated and verified. The response to the treatment of 20-Hydroxyecdysone (20E) and various bacteria were also surveyed. 2. Materials and methods 2.1. Insect and cell line The Bombyx mori strain Dazao used in this study was from our laboratory and reared with fresh mulberry (Zhang et al., 2015a). Eggs were collected during whole embryo stages. Epidermis, malpighian tubules, midgut, silk gland, head, hemocytes, ovary, testis, and fat body in day 3 of the fifth-instar were dissected or collected. All materials were stored in liquid nitrogen. The silkworm cell line BmE-SWU3 was generated in our lab (Xu et al., 2015a) and was cultured in Grace medium (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen). 2.2. RNA isolation and cDNA synthesis Total RNA was extracted by TRIzol (Takara, Japan) according to the manufacturer's instructions. Subsequently, Total RNAs were treated with DNase I (Takara, Japan) for 30 min at 37 °C to remove the residual
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
2.6. Polyclonal antibody preparation
Table 1 Sequences of the primers were used in this study. Name
Sequence (5′-3′)
Usage
BmHDD1-F BmHDD1-R GSP1 NGSP1 GSP2 NGSP2 Bm HDD1-CDS-F Bm HDD1-CDSR BmHDD1-PE-F BmHDD1-PE-R BmHDD1-qRT-F BmHDD1-qRT-R BmGAPDH-qRTF BmGAPDH-qRTR
ATGTACAGACTAGTGTGCTTCCTT TTAATGAGACAAGAAGCCATTAC GCCGTGGTGCGATCAGCAGTAGTG CCTCAGGTTTCTGGGTCGTAATCA CGACCCAGAAACCTGAGGAGTTCT CGACGATTCCACCAGTGGGTTACA ATGTACAGACTAGTGTGCTTCCTT ATCATTTCGCGCGTACTTAT
PCR
AACGACATTGTTATCGGCC ATCATTTCGCGCGTACTTAT ACGTTGAAGTTTATTCTGTGCCC TTCAGTTGTCGCTGTGAAGGTC CATTCCGCGTCCCTGTTGCTAAT
Mice were immunized to prepare the polyclonal antibody against BmHDD1. For the first immunization, 50 μg proteins were used with mixed and homogenized with an equal volume of Freund’s complete adjuvant (Sigma). For the following three subsequent immunizations, 75, 100, and 125 μg proteins were used with Freund’s incomplete adjuvant respectively. 150 μg proteins were injected directly without any adjuvant in the fifth immunization. Three days after the last immunization, mice were killed and the serum was collected and stored.
5′RACE 3′RACE Overexpression
2.7. Western blotting assay
Prokaryotic expression
Hemocytes and fat body were harvested, and suspended in RIPA Lysis Buffer for protein analysis. Protein concentrations were measured using a BCA protein assay kit (Beyotime Biotech, China). Cell lysate or cell-free hemolymph were subjected to SDS-PAGE and transferred onto PVDF membranes (Millipore, USA). After blocking with 5% BSA, the membranes were incubated gently with primary antibody against BmHDD1 (1:200) or Tubulin (1:1000, Beyotime) at 4 °C overnight. After washed with TBST buffer (20 mM Tris-HCl, 500 mM NaCl, and 0.1% Tween 20), the membranes were incubated with HRP-labeled goat anti-mouse IgG (H + L) (Invitrogen, 1:10000) at room temperature for 2 h. Proteins were visualized by SuperSignal West Femto Maximum Sensitivity Substrate (Thermo SCIENTIFIC) using a western blotting detection instrument (Clinx Science). The western blot bands were quantified using ImageJ software.
qRT-PCR
GCTGCCTCCTTGACCTTTTGC
genomic DNA. First-strand cDNA was synthesized with M-MLV reverse transcriptase (Promega, USA) by using 1–5 μg of total RNA in a 20 μL reaction mixture according to the protocol provided by the manufacturer. 2.3. Gene cloning and rapid amplification of cDNA ends (RACE) The predicated coding-sequence (CDS) and EST sequences were downloaded from SilkDB (http://www.silkdb.org/silkdb/) and KAIKObase (http://sgp.dna.affrc.go.jp/KAIKObase/). Primers were designed and the fragment of the BmHDD1 was acquired by PCR. The PCR condition included 2 min initial denaturation at 94 °C, followed by 25–35 cycles of the following: 30 s denaturation at 94 °C, 30 s annealing at 55 °C, 1 min of extension at 72 °C and a final 10 min extension at 72 °C. Subsequently, 3′ and 5′ RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) were performed to obtain its full-length cDNA according to the GeneRacer™ kit (Clontech, USA) manual. All primers used in this study were listed in Table 1. All PCR products were cloned into PMD19-T vector (TaKaRa, Japan) and sequenced at BGI (Beijing, China).
2.8. Immunofluorescence assay Hemocytes were collected in the molting stage of 4th instar larva by cutting a leg and incubated for 15 min at room temperature. After attached, cells were washed and fixed with 4% PFA for 15 min. Samples were permeabilized using 0.5% Triton-X 100 for 15 min. Washed three times, cells were blocked with 10% goat serum for 2 h at 37 °C. Subsequently, the cells were incubated with anti-BmHDD1 serum (1:200) for 1 h at 37 °C. Cells washed three times and incubated with Alexa Fluor®488 goat anti-mouse IgG (H + L) (1:1000, Invitrogen) for 1 h. Hoechst 33342 (1:2000, Invitrogen) was used for nuclear staining. Cells were observed under an inverted fluorescence microscopy (Nikon 80i).
2.4. Bioinformatic and phylogeny analysis 2.9. Bacteria challenge experiment The nucleotide of BmHDD1 was analyzed with the BioEdit program. The open reading frame (ORF) of BmHDD1 was confirmed by the ORF Finder software (http://www.ncbi.nlm.nih.gov/gorf.html). The molecular weight and isoelectric point was calculated using isoelectric point calculator (http://isoelectric.ovh.org/). The signal peptide and transmember domain were predicted by SignalP 4.0 (http://www.cbs.dtu. dk/services/SignalP) and TMpred (http://www.ch.embnet.org/ software/TMPRED_form.html) respectively. The SMART (http:// smart.embl-heidelberg.de/) was also used to analyze the predict protein.
Two PAMPs (pathogen-associated molecular pattern) molecular, including PGN (Peptidoglycan from Bacillus subtilis, SIGMA), and LPS (Lipopolysaccharides from Escherichia coli 055:B5, SIGMA), and three types of bacteria, including S. aureus, E. Coli, and P. aeruginosa, were used in this challenging experiment. 0.2 μg PGN, or 1 μg LPS was injected into each larva on the third day of the 5th instar, respectively. PBS buffer was used for control. Hemocytes and fat body were collected at different time points. S. aureus, E. Coli, and P. aeruginosa were stored in our laboratory, and were cultured on Luria-Bertani (LB) broth at 220 rpm at 37 °C on a shaker. The cultured bacteria were inactivated by 0.1% PFA at 37 °C for 1 day. After washed, centrifuged, and re-suspended in the PBS buffer, bacteria were counted by a hemocytometer. On the third day of the 5th instar, larva was injected with either S. aureus (106 CFU/Larva), E. Coli (Two gradients, 106, and 107 CFU/Larva), or P. aeruginosa (106 CFU/ Larva). The hemocytes, fat body, and cell-free hemolymph were collected at different time points for further analysis.
2.5. Expression and purification of the recombinant protein The full-length CDS sequence of BmHDD1 without the signal peptide, was cloned to PET22b vector, and transformed into E. Coli Rosetta (DE3). 0.1 mM IPTG was used for 24 h at 16 °C to induce the recombinant protein expression. Induced bacteria were centrifuged and washed with PBS, and re-suspended in PB buffer (19 mM NaH2PO4, 81 mM Na2HPO4, pH 7.4). After homogenized and centrifuged, the supernatant was filtrated and used for further purification. The sample was loading onto Ni-NTA His Bind Resin (Novagen, USA) and washed with imidazole gradient elution buffer. All fractions were collected and subjected to SDS-PAGE.
2.10. Injection of 20E The second day of the 5th instar larva was chosen for 20E (20Hydroxyecdysone, Sigma Aldrich, USA) at the dose of 1.5 μg/larva. 107
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
expressed as mean ± standard error. The significance of differences was determined with one-way analysis of variance (ANOVA) and a ttest as shown in previous describe (Zhu et al., 2017). The P values < 0.05 and < 0.01 were considered statistically and extremely statistically significant, respectively.
Ethanol was used as control as described in our previous study (Zhang et al., 2014b; Zhang et al., 2015b). Briefly, hemocytes, fat body and cell-free hemolymph were collected at 3, 6, 12, 24, and 48 h after 20E treatment. Each group was employed at least 10 silkworms. 2.11. Quantitative real-time PCR (qRT-PCR)
3. Results qRT-PCR was used to detect the mRNA expression of BmHDD1, as described in previous reports (Li et al., 2016; Xu et al., 2015b). qRTPCR was performed on a LightCycler 96 (Roche) machine using the GoTaq® qPCR Master Mix (Promega, USA). The reaction volume was 20 μL, which contains 10 μL of 2 × GoTaq® Probe qPCR Master Mix, 2 μL of the diluted cDNA template, 0.4 μL of each primers (10 μM), and 7.2 μL of distilled water. The qPCR consisted of 10 min at 95 °C, followed by 45 cycles of 95 °C for 15 s and 60 °C for 30 s. The primers used are listed in Table 1, and BmGAPDH was used as an internal control. The results were analyzed based on the standard 2−ΔΔCt method (Livak and Schmittgen, 2001). All data were given in terms of relative transcripts expression as means ± SE. The statistical significance were analyzed by an online server GraphPad Software (http://www. graphpad.com/quickcalcs/ttest1.cfm), and the P < 0.05 were considered to indicate statistical significance.
3.1. The BmHDD1 was cloned and identified The transcriptome difference of hematopoietic lineages of silkworm has been systematically analyzed by RNA-seq in our previous study (data not shown). Results showed that there was a difference between granulocytes and plasmatocytes, which are the two main cell types of hemocytes in silkworm. Interestingly, a novel transcript named Bm_nscaf3099_107, was found highly expressed in hemocytes. This transcript was clustered on nscaf3099, which was located on chromosome 28 in silkworm genome. A full-length cDNA of the BmHDD1 was acquired by RT-PCR and RACE technology. BmHDD1 was a single exon gene and the size of the cDNA was 1340 bp, which contains a 23 bp 5′UTR, a 480 bp 3′-UTR and an ORF of 837 bp. BmHDD1 encoding a putative protein of 278 amino acids peptide with predicted molecular weight of 30.35 kDa, and an isoelectric point of 4.86 (Fig. 1A, B). The BmHDD1 predicted peptide contains a signal peptide and a MBF2 domain (Fig. 1C). Stop codon (TAA), the polyadenylation consensus signal (AATAA), and a poly (A) tail were found in the 3′UTR area (Fig. 1B). Multiple alignment of BmHDD1 with its orthologs suggested that the
2.12. Statistical analysis All experiments were carried out in three technical and biological replicates. All data were analyzed with SPSS statistics software, and are
Fig. 1. Bioinformatics of BmHDD1 in silkworm, Bombyx mori. (A) The genomic locations of BmHDD1. The red boxes and black arrow represent the BmHDD1 localization and transcriptional orientation, respectively. (B) The nucleotide and deduced amino acid sequence of BmHDD1. Numbers to the left of each row refer to nucleotide position; the initiation codon (ATG) and the terminator codon (TAA) are labeled in red; the polyadenylation signal sequence (AATAA) is labled by red box; the red and green background with white letters represent signal peptide and MBF2 domain, respectively. (C) Conserved domains of BmHDD1 are highlighted. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
108
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 2. Multiple alignment of BmHDD1 with the homologous amino acid sequences from other species. Identities are shaded in dark gray and similarities in light gray. The homologous amino acid sequences from Hyphantria cunea (Hc, AAD09279.1), Amyelois transitella (At, XP_013195139.1), Danaus plexippus (Dp, EHJ72619.1), and Operophtera brumata(Ob, KOB74444.1) were analyzed.
also investigated by using qRT-PCR (Fig. 3D). In hemocytes, the expression level of BmHDD1 reached top on L4 M stage, followed by a rapid decline, and growth rised again during metamorphosis stage (Fig. 3D). On the whole, the expression level of BmHDD1 in fat body was lower than in hemocytes. Similarly with hemocytes, the expression of BmHDD1 in fat body reached on peaks in molting and metamorphosis stages (Fig. 3D).
MBF2 domain was highly conserved (Fig. 2). 3.2. BmHDD1 is specifically and highly expressed in hemocytes During embryonic development, transcript levels of BmHDD1 were undetectable from day 1 to day 6, while reached a peak at day 7, then rapidly decreased from day 8 to day 9 (Fig. 3A). In Larval stage However, it’s highly and specifically expressed in hemocytes, but not in other tissues such as epidermis, malpighian tubules, midgut, silk gland, head, ovary, testis, and fat body either at the third day of the 5th instar larva or the second day of pre-pupa (Fig. 3B, C). Moreover, the temporal expression patterns of BmHDD1 in hemocytes and fat body were
3.3. BmHDD1 is a secreted protein To detect the expression of BmHDD1, a western blot analysis was conducted. In the present study, a signal peptide was found in the NFig. 3. The expression profiles of BmHDD1. (A) The expression levels of BmHDD1 in silkworm embryo development. The expression patterns of BmHDD1 in different tissues from the third day of the 5th instar larva (B) and second day of prepupa stage (C). Ep, epidermis; Ma, Malpighian tubules; Mi, midgut; Si, silk gland; He, head; Ha, hemocytes; Ov, ovary; Te, testis; Fa, fat body. (D) The temporal expression of BmHDD1 in larval hemocytes and fat body. cDNA of hemocytes and fat body from the third day of the 4th instar to the wandering stage were analyzed. Experiments were carried out in three technical and biological replicates. The data are shown as the mean ± S.E.M. derived from three repeats.
109
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
terminal of BmHDD1, it is indicated that BmHDD1 may be secreted into hemolymph. Herein, protein from cell-free hemolymph and hemocytes were subjected to western blot, results showed that BmHDD1 both exist in hemolymph and hemocytes (Fig. 4). To increase the credibility, the purified recombinant BmHDD1 protein (rBmHDD1) was used as a positive control. To further investigate the expression of BmHDD1 in hemocytes, the immunofluorescence assay was conducted. As shown in Fig. 5, a signal was observed in the cytoplasm of hemocytes. 3.4. Subcellular localization of BmHDD1 The subcellular localization of BmHDD1 was determined by the expression of BmHDD1-EGFP fusion protein in BmE-SWU3 cells (Fig. 6). Western blotting test shown that the BmHDD1-EGFP fusion protein was successfully expressed (Fig. 6B). As shown in Fig. 6C, the BmHDD1-EGFP fusion protein was distributed in the cytoplasm. In the control group, the green fluorescent signal was observed in both cytoplasm and nuclei. At the same time, cells were stained with mouse
Fig. 4. The expression of BmHDD1 was detected in silkworm larval hemolymph by western blot. Cell-free hemolymph and hemocytes from the third day of the 5th instar larva were subjected to western blot analysis, and the purified recombinant BmHDD1 protein (rBmHDD1) was used as a positive control.
Fig. 5. Immunofluorescence staining of silkworm hemocytes with anti-BmHDD1 antibody. Hemocytes from the third day of the 5th instar larva were analyzed.
Fig. 6. Subcellular localization of BmHDD1 in BmE-SWU3 cell line. (A) Schematic representation of the ectopic expression vector. (B) BmE-SWU3 was transfected with PIZ-opIE2-EGFP or PIZ-opIE2-BmHDD1-EGFP, and then subjected to western blotting analysis with anti-BmHDD1 polyclonal antibody. (C) Subcellular localization of BmHDD1 with fluorescence microscopy. Cells were transfection with PIZ-opIE2-EGFP (upper row) or PIZ-opIE2BmHDD1-EGFP (Lower row). Three days later, cells were treated with anti-BmHDD1 and second-fluorescence, finally stained with Hoechst 33342.
110
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 7. Relative expression level of BmHDD1 in response to 20E treated in hemocytes (A) and fat body (B). The differences between the experimental and the control groups were analyzed with one-way analysis of variance (ANOVA) and a ttest, *P < 0.05, **P < 0.01. Experiments were carried out in three technical and biological replicates.
the BmHDD1 in silkworm, different types of bacteria, which including one gram-positive bacteria (S. aureus), two kinds of gram-negative bacteria (E. Coli, and P. aeruginosa), were killed and used to stimulate silkworm larva. All bacteria test in the current study could significantly upregulated the expression of BmHDD1. As shown in Fig. 10C, the expression level of BmHDD1 increased after injection P. aeruginosa (Pa), approached about 12.2,7.8, and 2.5 times of blank control at 3, 6, and 12 h. Most notably, the expression of BmHDD1 continued to increase after injection with E. Coli, the detection value raisen at least 20 times at detected point (Fig. 10B). S. aureus (Sa) infection could significatly upregulate the expression level of BmHDD1 at 2–12 h, and the expression level then downregulated at 24–24 h (Fig. 10D).
polyclonal antibody anti-BmHDD1, results shown that the antiBmHDD1 signal (Red) could be completely merged with EGFP signal (Green). In conclusion, the subcellular localization assay showed that BmHDD1 was accumulated in the cytoplasm. 3.5. BmHDD1 could be induced by 20E To analyze whether 20E could affect BmHDD1 expression in vivo, the expression level of BmHDD1 was quantified by real-time quantitative PCR before and after 20E injection. No significant changes were observed in hemocytes and fat body 3, and 6 h after treated by 20E (Fig. 6). However, at 12 h after treated by 20E, the expression level of BmHDD1 was significantly increased, which up-regulated 1.6-, and 7.1fold in hemocytes, and fat body, respectively (Fig. 6). In hemocytes, the changes reached a peak at 24 h after 20E injection (Fig. 7A). And large change ratio were continue maintained in fat body at 24, and 48 h after 20E injection (Fig. 7B). Western blot were used to detect the expression of BmHDD1 after treated by 20E in protein level. In fat body, 20E injection could increase the protein level of BmHDD1 (Fig. 8A), and a similar tendency was observed in hemocytes (Fig. 8B). Subsequently, the BmHDD1 in serum was analyzed individually. As shown in Fig. 8C, a significant increase was also observed. Taken together, the expression level of BmHDD1, both in transcript and protein levels could be induced by 20E both in hemocytes and fat body. 3.6. Transcriptional response of BmHDD1 after bacterial challenge To investigate the potential role BmHDD1 played in silkworm innate immunity, the dynamic changes of the BmHDD1 transcript upon PAMPs and pathogen invasion in hemocytes and fat body, which are the two important immune organs in silkworm, were analyzed using qPCR. Fat body play a critical role in insect growth and development, including immunity. Many host defense factor, including antimicrobial peptides, were mainly produced by fat body and are essential to against foreign invaders in insect (Fauvarque and Williams, 2011a). At 12–48 h post-inject of PGN, the transcription level of BmHDD1 was significantly upregulated (Fig. 9A). The expression of BmHDD1 was significantly upregulated after treated by E. Coli than the control (Fig. 9B). BmHDD1’s transcription level treated by P. aeruginosa (Pa) was strongly up-regulated in all detected points (Fig. 9C). Infection with S. aureus (Sa) also significantly induced the expression of BmHDD1 in fat body, and peaked at 12 h (Fig. 9D). Contrasted with control group, the mRNA expression level of BmHDD1 was significantly up regulated in hemocytes after injection with PGN, the expression level of BmHDD1 were increased about 5.4, 5.2, and 4.3 fold at 3, 6, and 24 h post-injection compared to control, respectively(Fig. 10A). In order to get more detailed information upon
Fig. 8. The BmHDD1 expression was detected by western blot after treated with 20E. (A) Fat body, (B) Hemocytes, (C) Hemolymph. The western blot bands were quantified using ImageJ software.
111
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 9. Time-course expression profiles of BmHDD1 in fat body injected with PGN or different types of inactivated bacteria. A-D show fold changes of BmHDD1 expression in fat body with PGN, E. Coli, P. aeruginosa, and S. aureus, respectively. BmGAPDH was used as an internal control. The differences between the experimental and the control groups were analyzed with one-way analysis of variance (ANOVA) and a t-test, *P < 0.05, **P < 0.01. Experiments were carried out in three technical and biological replicates.
that MBF2 is involved in BmFTZ-F1-mediated activation of the Fushi tarazu gene (Li et al., 1994). What more, MBF2 could activate transcription through interacting with TFIIA (QL et al., 1997). Recently, nine homologous genes of MBF2 were identified and found that these proteins were related to insect defense against pathogens and nutrient metabolism (Zhou et al., 2016). Herein, a novel gene BmHDD1 contains MBF2 domain was firstly identified from silkworm hemocytes (Fig. 1). Sequence analysis showed that BmHDD1 protein had low homology with other MBF2-contained members that have been reported in silkworm (data not shown). Temporal and spatial expression profiles of BmHDD1 were detailedly surveyed with qRT-PCR (Fig. 3). Those results indicated that BmHDD1 was specific-expressed in hemocytes under normal physiological conditions, which suggested that it could play a role in silkworm hemocytes. Interestingly, the expression peaks of BmHDD1 appeared at the 4th molting and metamorphosis stages, both in hemocytes and fat body, although the expression of BmHDD1 in fat body was lower than in hemocytes (Fig. 3D). We hypothesized that BmHDD1 could participate in silkworm molting and metamorphosis processes, which are most regulated by ecdysone hormone. Furthermore, the expression levels of BmHDD1 were significantly increased after treated with 20E either in hemocytes or fat body (Figs. 7 and 8).
Western blot analysis was used to detect the expression of BmHDD1 after challenged with E. Coli, which could significantly induced the BmHDD1’s expression in RNA level. After treated with E. Coli (106 CFU/ larva), significant increase of BmHDD1 were observed at 24 and 48 h post-injection in fat body (Fig. 11A). In circulating hemocytes, a significant increase of BmHDD1 was observed at 24 h post-injection. However, BmHDD1 was significantly decreased at post-injection with a low level of tubulin, which was used as an internal control (Fig. 11B). Furthermore, the secreted BmHDD1 was also investigated, and the results suggested that the protein content in hemolymph increased at 24 and 48 h post-injection. 4. Discussion A novel gene BmHDD1 was firstly identified in hemocytes cDNA library generated in our lab. In the present study, the 1340 bp fulllength cDNA of BmHDD1 was acquired, which contained an ORF of 837 bp and encoding a deduced protein of 278 amino acids. This deduced protein contains one MBF2 (Multiprotein bridge factor 2) domain, which is a kind of Lepidopteran specific genes and temporalspatial specific genes (Liu et al., 1998; Liu et al., 2000). MBF2 plays a key role in the development of silkworm. Previous reports suggested
112
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
Fig. 10. Time-course expression profiles of BmHDD1 in hemocytes injected with PAMPs or different types of inactivated bacteria. A-E show fold changes of BmHDD1 expression in hemocytes with PGN, E. Coli, P. aeruginosa, and S. aureus, respectively. BmGAPDH was used as an internal control. The differences between the experimental and the control groups were analyzed with one-way analysis of variance (ANOVA) and a t-test, *P < 0.05, **P < 0.01. Experiments were carried out in three technical and biological replicates.
that 20E could also enhance the immune response in silkworm (Sun et al., 2016). Here, BmHDD1 remarkably increased after treated with 20E (Fig. 8A, B), and the secretory protein in hemolymph also increased significantly (Fig. 8C). In drosophila, 20E controls the expression of immune related genes through the direct and indirect ways (Rus et al., 2013). While, the mechanism of 20E induced the expression of BmHDD1 remains to be further studied in silkworm. Insect immunity is a defense mechanism against attacking by various parasitoids. Generally, hemocytes and fat body were considered as two important components, which are mainly involved in cellular and humoral immunity, respectively (Liu et al., 2013; Fauvarque and Williams, 2011b). Stimulation of silkworm with different kinds of PAMPs or bacteria shown that the expression level of BmHDD1 increased either in fat body (Fig. 9) or in hemocytes (Fig. 10). This indicated that BmHDD1 has effect on immunity. Furthermore, our results shown that BmHDD1 were increased not only in fat body and hemocytes, but also in cell-free hemolymph when challenged with E. Coli (Fig. 11). We hypothesized that BmHDD1 could be induced and secreted into hemolymph, and participate in immune response when encounter immune challenges in silkworm. Clearance or phagocytosis
Polyclonal antibody of BmHDD1 was prepared through immunization of mice with recombinant BmHDD1 protein, which was expressed by using prokaryotic expression system and purified with the method of nickel affinity chromatography. Western blot shown that anti-BmHDD1 could specific recognition of the recombinant protein and endogenous BmHDD1 protein (Figs. 4 and 6). The BmHDD1 could be detected both in cell-free hemolymph and circulating hemocytes, our results indicated that BmHDD1 was a secreted protein, and its mainly generated and secreted by hemocytes. As one of the two most important regulators in insect, 20E is not only play a major role in insect fundamental events, including growth, development, metamorphosis, and reproduction, but also involved in insect innate immune response (Kozlova and Thummel, 2003; Lafont et al., 2012). 20E could induced the exprssion of the immune related genes, especially antimicrobial peptide genes (AMPs) in Drosophila melanogaster (Meister and Richards, 1996; Dimarcq et al., 1997; Tan et al., 2014), and promotes the immunological functions of hemocyte, including hemocyte motility, encapsulation, phagocytosis and nodulation (Lanot et al., 2001; Sorrentino et al., 2002; Franssens et al., 2006; Regan et al., 2013; Sampson et al., 2013). Sun and his colleagues found
113
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
2014a). Our preliminary results shown that the recombinant BmHDD1 protein could significantly enhance the bacterial clearance ability of the hemocytes (data not shown). However, the function of BmHDD1 in silkworm, especially in innate immune response, needs to be further studied. In conclusion, a novel immune-related gene, named BmHDD1 was firstly identified in silkworm, Bombyx mori. In the present study, temporal and spatial expression profiles of BmHDD1 were analyzed, and found it mainly expressed in hemocytes and secreted into hemolymph under normal physiological conditions. Our results also showed that the expression of BmHDD1 could be significantly induced by 20E and various microbial, both in hemocytes and fat body. All the results showed that BmHDD1 plays a role in developing and immunity system in silkworm. However, further research is needed and better understanding of the function of BmHDD1 will pave a new way for the strategy development of silkworm diseases prevention.
Acknowledgements This work was supported by the National Natural Science Foundation of China (31672496), the Natural Science Foundation of Chongqing (cstc2016jcyjA0425), Chongqing University Innovation Team Building Program funded projects (CXTDX201601010), the Graduate Scientific Research Foundation of Chongqing (CYB2015067), and the Fundamental Research Funds for the Central Universities (XDJK2015D021).
Fig. 11. The BmHDD1 expression was detected by western blot protein after treated with inactivated E. Coli. (A) Fat body, (B) Hemocytes, (C) Hemolymph. The western blot bands were quantified using ImageJ software.
of pathogens is an important function of hemocytes (Zhang et al., Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molimm.2017.06.023.
and Samia cynthia. Gene 220, 55–59. Liu, Q.X., Ueda, H., Hirose, S., 2000. MBF2 is a tissue- and stage-Specific coactivator that is regulated at the step of nuclear transport in the silkworm bombyx mori. Dev. Biol. 225, 437–446. Liu, F., Xu, Q., Zhang, Q., Lu, A., Beerntsen, B.T., Ling, E., 2013. Hemocytes and hematopoiesis in the silkworm, Bombyx mori. Invertebr. Survival J. 10, 102–109. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realTime quantitative PCR and the 2-ΔΔCT. Method methods 25, 402–408. Meister, M., Richards, G., 1996. Ecdysone and insect immunity: the maturation of the inducibility of the diptericin gene in Drosophila larvae. Insect Biochem. Mol. Biol. 26, 155–160. Oliver, J.D., Loy, J.D., Parikh, G., Bartholomay, L., 2011. Comparative analysis of hemocyte phagocytosis between six species of arthropods as measured by flow cytometry. J. Invertebr. Pathol. 108, 126–130. QL, F.-Q.L., Takemaru, K.I., Goto, M., Ueda, H., Handa, H., Hirose, S., 1997. Transcriptional activation through interaction of MBF2 with TFIIA. Genes Cells 2, 143–153. Regan, J.C., Brandão, A.S., Leitão, A.B., Dias, Â.R.M., Sucena, É., Jacinto, A., ZaidmanRémy, A., 2013. Steroid hormone signaling is essential to regulate innate immune cells and fight bacterial infection in Drosophila. PLoS Pathog. 9, e1003720. Rus, F., Flatt, T., Tong, M., Aggarwal, K., Okuda, K., Kleino, A., Yates, E., Tatar, M., Silverman, N., 2013. Ecdysone triggered PGRP-LC expression controls Drosophila innate immunity. EMBO J. 32, 1626–1638. Sampson, C.J., Amin, U., Couso, J.-P., 2013. Activation of Drosophila hemocyte motility by the ecdysone hormone. Biology open 2, 1412–1420. Satyavathi, V.V., Minz, A., Nagaraju, J., 2014. Nodulation: an unexplored cellular defense mechanism in insects ☆. Cell. Signal. 26, 1753–1763. Sorrentino, R.P., Carton, Y., Govind, S., 2002. Cellular immune response to parasite infection in the Drosophila lymph gland is developmentally regulated. Dev. Biol. 243, 65–80. Sun, W., Shen, Y.-H., Zhou, L.-X., Zhang, Z., 2016. Ecdysone titer determined by 3DE-3βreductase enhances the immune response in the silkworm. J. Immunol. 196,
References Dimarcq, J.-L., Imler, J.-L., Lanot, R., Ezekowitz, R.A.B., Hoffmann, J.A., Janeway, C.A., Lagueux, M., 1997. Treatment of l (2) mbn Drosophila tumorous blood cells with the steroid hormone ecdysone amplifies the inducibility of antimicrobial peptide gene expression. Insect Biochem. Mol. Biol. 27, 877–886. Fauvarque, M.O., Williams, M.J., 2011a. Drosophila cellular immunity: a story of migration and adhesion. J. Cell Sci. 124, 1373–1382. Fauvarque, M.O., Williams, M.J., 2011b. Drosophila cellular immunity: a story of migration and adhesion. J. Cell Sci. 124, 1373–1382. Franssens, V., Smagghe, G., Simonet, G., Claeys, I., Breugelmans, B., De Loof, A., Broeck, J.V., 2006. 20-Hydroxyecdysone and juvenile hormone regulate the laminarin-induced nodulation reaction in larvae of the flesh fly, Neobellieria bullata. Dev. Compar. Immunol. 30, 735–740. Kanost, M.R., Jiang, H., Yu, X.Q., 2004. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 198, 97–105. Kozlova, T., Thummel, C.S., 2003. Essential roles for ecdysone signaling during Drosophila mid-embryonic development. Science 301, 1911–1914. Lafont, R., Dauphin-Villemant, C., Warren, J., Rees, H., 2012. Ecdysteroid chemistry and biochemistry. Insect Endocrinol. 106–176. Lanot, R., Zachary, D., Holder, F., Meister, M., 2001. Postembryonic hematopoiesis in drosophila. Dev. Biol. 230, 243–257. Lemaitre, B., Hoffmann, J., 2007. The host defense of drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. Li, F.Q., Ueda, H., Hirose, S., 1994. Mediators of activation of fushi tarazu gene transcription by BmFTZ-F1. Mol. Cell. Biol. 14, 3013–3021. Li, H., Wang, S., Qian, Z., Wu, Z., Lǚ, K., Weng, S., He, J., Li, C., 2016. MKK6 from pacific white shrimp Litopenaeus vannamei is responsive to bacterial and WSSV infection. Mol. Immunol. 70, 72–83. Liu, Q.X., Ueda, H., Hirose, S., 1998. Comparison of sequences of a transcriptional coactivator MBF2 from three Lepidopteran species Bombyx mori, Bombyx mandarina
114
Molecular Immunology 88 (2017) 106–115
K. Zhang et al.
silkworm Bombyx mori. J. Insect Physiol. 71, 61–67. Zhang, K., Xu, M., Su, J., Yu, S., Sun, Z., Li, Y., Zhang, W., Hou, J., Shang, L., Cui, H., 2014b. Characterization and identification of the integrin family in silkworm, Bombyx mori. Gene 549, 149–155. Zhang, K., Yu, S., Su, J., Xu, M., Tan, P., Zhang, Y., Xiang, Z., Cui, H., 2015a. Identification and characterization of three novel hemocyte-specific promoters in silkworm Bombyx mori. Biochem. Biophys. Res. Commun. 461, 102–108. Zhang, K., Su, J., Chen, S., Yu, S., Tan, J., Xu, M., Liang, H., Zhao, Y., Chao, H., Yang, L., 2015b. Molecular cloning, characterization and expression analysis of cathepsin O in silkworm Bombyx mori related to bacterial response. Mol. Immunol. 66, 409–417. Zhou, C.Y., Zha, X.F., Liu, C., Han, M.J., Zhang, L.Y., Shi, P.P., Wang, H., Zheng, R.W., Xia, Q.Y., 2016. Identification of MBF2 family genes in Bombyx mori and their expression in different tissues and stages and in response to Bacillus bombysepticus infection and starvation. Insect Sci. 23, 502–512. Zhu, J., Wang, H., Wang, J., Wang, X., Peng, S., Geng, Y., Wang, K., Ouyang, P., Li, Z., Huang, X., 2017. Identification and characterization of a β-defensin gene involved in the immune defense response of channel catfish, Ictalurus punctatus. Mol. Immunol. 85, 256–264.
1646–1654. Tan, K.L., Vlisidou, I., Wood, W., 2014. Ecdysone mediates the development of immunity in the Drosophila embryo. Curr. Biol. 24, 1145–1152. Xia, Q., Zhou, Z., Lu, C., Cheng, D., Dai, F., Li, B., Zhao, P., Zha, X., Cheng, T., Chai, C., 2004. A draft sequence for the genome of the domesticated silkworm (Bombyx mori). Science 306, 1937–1940. Xia, Q., Guo, Y., Zhang, Z., Li, D., Xuan, Z., Li, Z., Dai, F., Li, Y., Cheng, D., Li, R., 2009. Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx). Science 326, 433–436. Xia, Q., Li, S., Feng, Q., 2014. Advances in silkworm studies accelerated by the genome sequencing of Bombyx mori. Annu. Rev. Entomol. 59, 513–536. Xu, M., Tan, J., Wang, X., Zhong, X., Cui, H., 2015a. Establishment and characterization of a new embryonic cell line from the silkworm, Bombyx mori. ISJ 12. Xu, M., Wang, X., Tan, J., Zhang, K., Guan, X., Patterson, L.H., Ding, H., Cui, H., 2015b. A novel Lozenge gene in silkworm Bombyx mori regulates the melanization response of hemolymph. Dev. Compar. Immunol. 53, 191. Zhang, K., Tan, J., Xu, M., Su, J., Hu, R., Chen, Y., Xuan, F., Yang, R., Cui, H., 2014a. A novel granulocyte-specific α integrin is essential for cellular immunity in the
115