- Email: [email protected]
A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA Changwen Bo, Xiuli Li, Li He, Sujing Zhang, Na Li**, Yonghui An* Department of Oncology, The First Hospital of Hebei Medical University, Shijiazhuang, Hebei province, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 September 2019 Accepted 29 September 2019 Available online xxx
Aberrant expression of long non-coding RNAs (lncRNAs) has been observed in hepatocellular carcinoma (HCC) and confirmed to participate in the initiation and progression of HCC. In the present study, we identified a novel functional lncRNA, hedgehog-interacting protein antisense RNA 1 (HHIP-AS1). The expression levels of HHIP-AS1 were significantly decreased in HCC tissues. Downregulation of HHIP-AS1 expression correlated with larger tumor size, metastasis, and advanced TNM stage, and also predicted worse overall survival rate of HCC patients. Through performing overexpression and knockdown experiments, the biological function of HHIP-AS1 was identified to suppress HCC cell proliferation, migration and invasion, while promote apoptosis. Further investigation showed that HHIP-AS1 interacted with and positively regulated the stability of HHIP mRNA in a HuR-dependent manner. HHIP-AS1 exerted its suppressive effects through HHIP. Taken together, our findings demonstrate that HHIP-AS1 represses HCC progression by promoting HHIP expression, and indicate that the use of HHIP-AS1 may offer a promising treatment for HCC patients. © 2019 Elsevier Inc. All rights reserved.
Keywords: Antisense RNA Stability HHIP Degradation HuR
1. Introduction Hepatocellular carcinoma (HCC) is one of the most common human malignancies worldwide, contributing to a great proportion of cancer-related death, especially in China [1]. Even though the great advancements of therapeutic methods for HCC, such as surgical resection and chemotherapy, have been made in the past decades, the prognoses of HCC patients are unsatisfied due to tumor recurrence and intrahepatic or distant metastasis with a high frequency [2]. However, the underlying mechanisms of pathogenesis of HCC development remains poorly explored. Numerous evidence has demonstrated that long noncoding RNAs (lncRNAs) exert important functions in regulating biological processes, such as proliferation, apoptosis, migration, angiogenesis, metabolism and autophagy [3e6]. Aberrant expression of some lncRNAs has been observed in HCC, which contributes to tumorigenesis and progression of HCC. For example, lncRNA HCAL acts as a competing endogenous RNA (ceRNA) of LAPTM4B to enhance HCC grow and metastasis [7]. lncRNA HULC suppresses autophagy via
upregulating USP22 and stabilizing SIRT1, which facilitates chemoresistance of HCC [8]. lncRNA FENDRR associates with miR-423 and suppresses the miR-423-mediated GADD45B downregulation [9]. DANCR binds to CTNNB1 30 UTR region and then blocks the repressing effect of miR-214, miR-320a, and miR-199a on CTNNB1, increasing stemness features of HCC cells [10]. Hence, because of the crucial roles of lncRNAs, it is essential to reveal the correlation between lncRNAs and HCC progression. In the present study, we identified a novel functional lncRNA, hedgehog-interacting protein antisense RNA 1 (HHIP-AS1, GeneSymbol: NR_037595), which was significantly downregulated in HCC tissues. Moreover, we found that HHIP-AS1 interacted with and stabilized hedgehog-interacting protein (HHIP) mRNA, which increased HHIP expression and eventually inhibited HCC progression. Thus, our findings implicated the potential application of HHIP-AS1 for the prognosis and treatment of HCC patients. 2. Materials and methods 2.1. Tissues collection
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (N. Li), [email protected] (Y. An).
60 pairs of HCC tissues and adjacent normal liver tissues were obtained from patients who underwent surgical resection due to HCC in the First Hospital of Hebei Medical University. None of these
https://doi.org/10.1016/j.bbrc.2019.09.137 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
2
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
patients were preoperatively treated. This study was approved by the Ethics Committee of the First Hospital of Hebei Medical University. Signed written informed consents were obtained from all participants. This research was carried out according to the standards set by the Declaration of Helsinki.
2.8. Flow cytometry
2.2. Cell culture
2.9. Transwell assay
Hep3B, PLC/PRF/5, Huh7, HepG2 and MHCC-97 h cell lines were obtained from Cell Bank of Chinese Academy of Sciences and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) in a 5% CO2 incubator at 37 C.
To detect cell migration and invasion, transwell chambers precoated with or without Matrigel (BD Biosciences) was used, respectively. 1 105 cells suspended in 200 ml serum-free DMEM were added to the upper chambers. 500 ml DMEM containing 10% FBS was added to the bottom chamber. 24 h later, the cells across the membrane were fixed, stained and then counted under a microscope.
2.3. Isolation of cytoplasmic and nuclear RNA To isolate cytoplasmic and nuclear RNA, Cytoplasmic and Nuclear RNA Purification Kit (Norgen Biotek Corp.) was used according to the manufacturer’s instruction. U6 and GAPDH were used as cytoplasmic and nuclear internal controls, respectively. 2.4. Construction of stable cells Lentiviral particles expressing scramble shRNA (shNC) or HHIPAS1 shRNAs or HHIP shRNAs or empty vector (NC) or full-length HHIP-AS1 or HHIP were purchased from GENECHEM Company (Shanghai, China). Cells were infected with above lentiviral particles in the presence of 10 mg/ml polybrene. After 48 h, the stable cells were selected by using 3 mg/ml puromycin for 1 week. 2.5. Quantitative real-time PCR (qRT-PCR) Total RNA were extracted by using Trizol reagent (Invitrogen). The cDNA was reversely transcribed by using PrimeScript 1st Strand cDNA Synthesis Kit (Takara). qRT-PCR detection was performed by using TransStart® Top Green qPCR SuperMix (Transgen, China). GAPDH mRNA was used as internal reference. The relative expression of indicated genes was normalized to control group and calculated using 2-△△Ct methods. The primer sequences were listed below: HHIP-forward: GTCATGGAGGTGTCTGTGTTAG HHIP-reverse: GTCACTCTGCGGATGTTTCT HHIP-AS1-forward: GGCTGAAGAAGCAGAGGATAG HHIP-AS1-reverse: TTCACCACTCTGTCGGTTTAG GAPDH-forward: GGTGTGAACCATGAGAAGTATGA GAPDH- reverse: GAGTCCTTCCACGATACCAAAG
2.6. Western blot
To analysis the effect of HHIP-AS1 on cell apoptosis, Annexin VFITC Apoptosis Detection Kit (Dojindo) was used as the manufacturer’s instructions.
2.10. Caspase-3 activity detection Caspase-3 activity was measured using the Caspase-3 activity assay kit (Cell signaling) according to the manufacturer’s instructions. RNA immunoprecipitation (RIP) and MS2-binding sequencesMS2-binding proteinebased RIP assay (MS2-RIP). Magna RIP RNA-Binding Protein Immunoprecipitation kit was used for RIP assay according to the manufacturer’s instructions. The antibodies were used as follows: HuR (Abcam), IGF2BP1 (Abcam) or AUF1 (Abcam). MS2-RIP was performed to determine the association between HHIP-AS1 and HHIP mRNA using the IgG or anti-GFP (Abcam) and Magna RIP RNA-Binding Protein Immunoprecipitation kit as described previously [7,12]. The immunoprecipitated RNA was measured by qRT-PCR. 2.11. RNA pull-down assay RNA pull-down assay was performed by using Pierce Magnetic RNA-Protein Pull-Down Kit as the manufacturer’s instructions. The amount of pull-down RNA was measured by qRT-PCR. 2.12. Statistical analysis The statistical analysis was performed by using SPSS 24.0 software (Chicago, IL, USA). Student’s t-test or One-way ANOVA was used to analyze the differences between different groups. Chisquare test was used to determine the relationship between HHIP-AS1 levels and clinicopathological features. Pearson’s correlation analysis was used to evaluate the correlation between HHIPAS1 and HHIP mRNA levels in HCC tissues. Kaplan-Meier survival plots and log-rank tests were performed to determine the correlation of HHIP-AS1 expression and prognosis of HCC patients. A p < 0.05 was considered statistically significant. 3. Results
Western blot analysis was performed according to standard protocols as described previously [11]. The antibodies were used as follows: HHIP (Abcam), GAPDH (Cell Signaling). 2.7. CCK-8 and colony formation assay For CCK-8 assay, 2 103 cells per well in 100 ml DMEM were seeded into 96-well plate. At the indicated time points, optical density (OD) at 450 nm was measured using the CCK-8 kit (Dojindo) for depicting the proliferation curve. For colony formation assay, 2 103 cells per well were seeded in a 6-well plate. After 2 weeks, cell clones were fixed and stained with 0.05% crystal violet.
3.1. Downregulation of HHIP-AS1 predicts poor prognosis of HCC patients We first analyzed the profiles of differentially expressed lncRNAs obtained through microarray chips or RNA sequencing from previous studies [7,13,14]. Among these dysregulated lncRNAs, we identified that HHIP-AS1 located in chromosome 4q31 and was one of the most deceased lncRNAs in HCC tissues. To validate this result, the HHIP-AS1 levels in 60 pairs of HCC tissues and adjacent normal liver tissues were assessed by qRT-PCR. It was shown that the HHIP-AS1 levels were significantly decreased in HCC tissues compared to that in normal liver tissues (Fig. 1A). Based on the
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. HHIP-AS1 is downregulated in HCC tissues and predicts poor prognosis A. The qRT-PCR analysis of 60 pairs of HCC tissues and adjacent normal liver tissues. B. Kaplan-Meier survival plots and log-rank tests were conducted to clarify the relationship between HHIP-AS1 levels and prognosis of HCC patients. The median expression level of HHIP-AS1 in HCC tissues was used as the cutoff.
median of HHIP-AS1 levels in HCC tissue samples, the HCC patients were divided into high- and low-level groups. The correlation analysis of HHIP-AS1 expression with clinicopathological features of HCC patients demonstrated that HHIP-AS1 expression was significantly associated with tumor size, metastasis, and TNM stage (Table 1). Furthermore, Kaplan-Meier survival plots and log-rank tests were conducted to clarify the relationship between HHIPAS1 levels and prognosis of HCC patients, and the results demonstrated that patients with low-level HHIP-AS1 had a worse survival rate than patients with high-level HHIP-AS1 (Fig. 1B). 3.2. HHIP-AS1 inhibits proliferation and enhances apoptosis in HCC cells
3
Hep3B cells with relatively low level of HHIP-AS1 (Fig. 2C). The effect of HHIP-AS1 on cell proliferation was determined by CCK-8 and colony formation assays. It was observed that depletion of endogenous HHIP-AS1 markedly increased the proliferative ability of Huh7 cells compared to the control group (Fig. 2D and E), while the proliferation was significantly attenuated after overexpressing HHIP-AS1 in Hep3B cells (Fig. 2F and G). We then evaluated whether HHIP-AS1 affected apoptosis in HCC cells. The results of flow cytometry analysis demonstrated that Huh7 cells with knockdown of HHIP-AS1 showed a lower apoptotic rate compared to control cells (Fig. 2H and Supplemental Fig. 1A). In contrast, overexpression of HHIP-AS1 enhanced the apoptosis in Hep3B cells (Fig. 2I and Supplemental Fig. 1B). Similarly, the caspase-3 activity detection confirmed a stimulative effect of HHIP-AS1 on HCC cell apoptosis (Fig. 2J and K). 3.3. HHIP-AS1 represses HCC cell migration and invasion To examine whether HHIP-AS1 affected migration and invasion in HCC cells, experiments using transwell chambers without or with matrigel were conducted, respectively. We observed a significantly increased number of HHIP-AS1 knockdown Huh7 cells on the outside membranes of the transwell chamber without or with matrigel, compared with that of control cells (Fig. 2L and Supplemental Fig. 1C), whereas a reverse effect was found after overexpressing HHIP-AS1 in Hep3B cells (Fig. 2M and Supplemental Fig. 1D). These results suggest that HHIP-AS1 weakens migratory and invasive capacities in HCC cells. 3.4. HHIP-AS1 increases the stability of HHIP mRNA
To clarify the functional roles of HHIP-AS1 in malignant behaviors of HCC cells, knockdown and overexpression experiments were conducted. Based on the endogenous HHIP-AS1 levels in different HCC cells (Fig. 2A), lentiviral particles expressing two different HHIP-AS1 shRNAs (sh1 and sh2) were transfected into the Huh7 cells with relatively high level of HHIP-AS1 (Fig. 2B), while lentiviral particles expressing HHIP-AS1 was transfected into in
Table 1 Clinical characteristics and outcome of 60 HCC patients according to HHIP-AS1 expression levels. Features
Age ＜60 60 Gender Male Female Tumor size ＜5 cm 5 cm TNM stage I/II III/IV Liver cirrhosis No Yes Serum AFP ＜400 400 Metastasis Yes No
HHIP-AS1
p value
Low
High
24 6
26 4
0.488
25 5
24 6
0.739
6 24
14 16
0.028
8 22
18 12
0.009
10 20
12 18
0.592
12 18
13 17
0.793
20 10
12 18
0.038
The median expression level of HHIP-AS1 in HCC tissues was used as the cutoff.
To reveal the underlying mechanisms of HHIP-AS1 in inhibiting malignant behaviors of HCC cells, we first determined the cellular localization of HHIP-AS1. The cytoplasmic and nuclear RNA was isolated and then used to detect HHIP-AS1 expression via qRT-PCR. As shown in Fig. 3A, HHIP-AS1 mainly distributed in the cytoplasm of Huh7 and Hep3B cells, indicating that HHIP-AS1 may involve in post-transcriptional regulation. Recently, it has been reported that antisense lncRNA could associate with its sense RNA and increase its stability [15,16]. To validate the association between HHIP-AS1 and its sense RNA, hedgehog-interacting protein (HHIP), we incubated biotin-labeled HHIP-AS1 with Huh7 or Hep3B cell extracts and performed RNA pull-down assay, followed by qRT-PCR detection. We identified a significant interaction between HHIP-AS1 and HHIP mRNA (Fig. 3B). For further confirmation, we performed MS2RIP to pull down endogenous HHIP mRNA associated with HHIPAS1. It was demonstrated that the HHIP-AS1 RIP was significantly enriched for HHIP mRNA compared to the empty vector, IgG, or GAPDH mRNA, which did not have a complementary region with HHIP-AS1 (Fig. 3C). To detect whether HHIP-AS1 influenced the expression of HHIP, qRT-PCR and Western blot assays were carried out. We observed that HHIP-AS1-depleted Huh7 cells showed consistent reduction in the mRNA and protein levels of HHIP (Fig. 3D and E), whereas overexpression of HHIP-AS1 upregulated HHIP expression in Hep3B cells (Fig. 3F and G). Moreover, we treated control and HHIP-AS1silenced Huh-7 cells with an RNA synthesis inhibitor a-amanitin, collected samples at several time points, and detected the degradation of HHIP mRNA levels via performing qRT-PCR analyses. Huh7 cells with HHIP-AS1 knockdown exhibited a significantly shorter half-life of HHIP mRNA compared to control cells (Fig. 3H). Conversely, ectopic expression of HHIP-AS1 elongated the half-life of HHIP mRNA in Hep3B cells (Fig. 3I). Together, our findings suggest that HHIP-AS1 interacts with and stabilizes HHIP mRNA.
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
4
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. HHIP-AS1 suppresses HCC cell proliferation, migration and invasion A. The qRT-PCR analysis of 5 different HCC cell lines. B. The relative expression of HHIP-AS1 in control and HHIP-AS1-silenced Huh7 cells was detected by qRT-PCR.C. The relative expression of HHIP-AS1 in control and HHIP-AS1-overexpressed Hep3B cells was detected by qRT-PCR.D. The proliferation of HHIP-AS1 in control and HHIP-AS1-silenced Huh7 cells was determined by CCK-8 assay.E. The colony formation of HHIP-AS1 in control and HHIP-AS1-silenced Huh7 cells.F. The proliferation of HHIP-AS1 in control and HHIP-AS1overexpressed Hep3B cells was determined by CCK-8 assay.G. The colony formation of HHIP-AS1 in control and HHIP-AS1-overexpressed Hep3B cells.H. Apoptosis was assayed by flow cytometry in control and HHIP-AS1-silenced Huh7 cells.I. Apoptosis was assayed by flow cytometry in control and HHIP-AS1-overexpressed Hep3B cells.J. Caspase-3 activity of control and HHIP-AS1-silenced Huh7 cells was assayed.K. Caspase-3 activity of control and HHIP-AS1-overexpressed Hep3B cells was assayed.L. The transwell assay was conducted to detect the effect of HHIP-AS1 knockdown on migration and invasion in Huh7 cells. The represent images were shown in Supplemental Fig. 1C. M. The transwell assay was conducted to detect the effect of HHIP-AS1 overexpression on migration and invasion in Hep3B cells. The represent images were shown in Supplemental Fig. 1D.*p < 0.05, **p < 0.01.
3.5. HHIP-AS1 stabilizes HHIP mRNA through HuR Recent studies reported that lncRNAs affected the stability of their interacting RNAs via recruiting RNA-binding proteins (RBPs), such as HuR, IGF2BP1 and AUF1 [15,17]. We performed RNAimmunoprecipitation (RIP) assay using HuR, IGF2BP1 or AUF1 antibody followed by qRT-PCR to evaluate the interaction of HuR,
IGF2BP1 or AUF1 with TTIP-AS1 and TTIP mRNA in control and HHIP-AS1-silenced Huh7 cells. The results demonstrated that only HuR interacted with HHIP-AS1 and HHIP mRNA, and this interaction was significantly attenuated by HHIP-AS1 knockdown (Fig. 4A). In contrast, Hep3B cells with HHIP-AS1 overexpression showed markedly enhanced the interaction between HuR and HHIP-AS1 or HHIP mRNA (Fig. 4B). In addition, knockdown of HuR in HHIP-AS1-
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. HHIP-AS1 stabilizes HHIP mRNA A. The cellular location of HHIP-AS1 in Huh7 and Hep3B cells.B. Cell lysates from Huh7 and Hep3B cells were incubated with biotin-labeled HHIP-AS1; after pull-down, HHIP mRNA was detected by qRT-PCR. C. Left: The schematic diagram of MS2-RIP assay was shown. Right: MS2-RIP followed by qRT-PCR to detect endogenous HHIP mRNA associated with HHIP-AS1 in Huh7 and Hep3B cells.D. The mRNA levels of HHIP in control and HHIP-AS1-silenced Huh7 cells were tested by qRT-PCR.E. The protein levels of HHIP in control and HHIP-AS1-silenced Huh7 cells were tested by Western blot.F. The mRNA levels of HHIP in control and HHIP-AS1-overexpressed Hep3B cells were tested by qRT-PCR.G. The protein levels of HHIP in control and HHIP-AS1-overexpressed Hep3B cells were tested by Western blot.H. The stability of HHIP mRNA over time was measured by qRT-PCR relative to time 0 after blocking new RNA synthesis with a-amanitin (50 mM) in control and HHIP-AS1-silenced Huh7 cells and normalized to 18S rRNA (a product of RNA polymerase I that is unchanged by a-amanitin).I. The stability of HHIP mRNA over time was measured by qRT-PCR relative to time 0 after blocking new RNA synthesis with a-amanitin (50 mM) in control and HHIP-AS1-overexpressed Hep3B cells and normalized to 18S rRNA.*p < 0.05, **p < 0.01, ***p < 0.001.
overexpressed Hep3B cells abolished the upregulation of HHIP mRNA and protein levels (Fig. 4C and D). Taken together, we conclude that HHIP-AS1 facilitates HHIP mRNA stability by promoting HuR binding to HHIP mRNA. 3.6. HHIP-AS1 exerts suppressive effects via HHIP Finally, rescue experiments were conducted to assess whether HHIP-AS1 exerted suppressive effects via HHIP. We knocked down the HHIP expression in HHIP-AS1-overexpressed Hep3B cells. The results showed that downregulation of HHIP rescued the proliferative, migratory and invasive abilities reduced by HHIP-AS1
overexpression in Hep3B cells (Fig. 4E and F). To further reveal the pathological correlation between HHIP-AS1 and HHIP expression in HCC, the expression levels of HHIP mRNA in HCC and normal liver tissues were detected. It was observed that HHIP expression was decreased in HCC tissues (Fig. 4G). Moreover, HHIP-AS1 and HHIP mRNA levels showed significant positive correlation with each other in HCC tissues (Fig. 4H). Together, these results demonstrate that HHIP-AS1 exerts its function via regulating HHIP expression. 4. Discussion Increasing evidence has indicated a crucial role of lncRNAs in
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
6
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. HHIP-AS1 stabilizes HHIP mRNA through HuR. A. RIP followed by qRT-PCR assay was performed used IgG, HuR, IGF2BP1 or AUF1 antibodies in control and HHIP-AS1-silenced Huh7 cells. B. RIP followed by qRT-PCR assay was performed used IgG, HuR, IGF2BP1 or AUF1 antibodies in control and HHIP-AS1-overexpressed Hep3B cells. C. HuR expression was knocked down in HHIP-AS1-overexpressed Hep3B cells, and then the HHIP mRNA level was detected by qRT-PCR.D. HuR expression was knocked down in HHIP-AS1-overexpressed Hep3B cells, and then the HHIP protein level was detected by Western blot. E. Depletion of HHIP expression abolished the HHIP-AS1-mediated suppression of proliferation in Hep3B cells. F. Depletion of HHIP expression abolished the HHIP-AS1-mediated suppression of migration and invasion in Hep3B cells. G. The qRT-PCR analysis of 60 pairs of HCC tissues and adjacent normal liver tissues. H. The correlation between HHIP-AS1 and HHIP mRNA levels was measured via Pearson correlation analysis.*p < 0.05, **p < 0.01.
regulating development and progression of human cancers [18]. Our study is the first to reveal the functional roles and underlying mechanism of HHIP-AS1 in HCC. Here, we found that HHIP-AS1 levels were significantly downregulated in HCC tissues. Decreased expression of HHIP-AS1 correlated with larger tumor size, metastasis, and advanced TNM stage, and also predicted worse overall survival rate of HCC patients. Through overexpression and knockdown experiments, the biological function of HHIP-AS1 was identified to suppress HCC cell proliferation, migration and invasion, while promote apoptosis. These findings suggest that downregulation of HHIP-AS1 expression contributes to HCC progression. Recently, it was demonstrated that lncRNAs are capable to
associate with RBPs and elevate the stability of target mRNAs. For instance, CASC9 enhances TGFb2 mRNA stability via interaction with CPSF3, thus inducing tumor growth and metastasis in colorectal cancer [19]. LINC01093 directly binds IGF2BP1 and interrupts its interaction with oncogene GLI1 mRNA, which induces degradation of GLI1 mRNA and inhibits HCC cell proliferation and metastasis [17]. LncRNA-Assisted Stabilization of Transcripts (LAST) is shown to promote CCND1 mRNA stability via cooperating with CNBP to bind to the 50 UTR of CCND1 mRNA [20]. In osteosarcoma cells, lncRNA B4GALT1-AS1 recruits HuR to stabilize YAP mRNA and thus facilitate its transcriptional activity [21]. Here, we identified HHIP mRNA as a direct target of HHIP-AS1. The results of RNA pull-
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
down and MS2-RIP assay demonstrated that HHIP-AS1 directly associated with HHIP mRNA. Moreover, we observed that HHIP-AS1 increased the stability of HHIP-mRNA through enhancing the interaction between HHIP-mRNA and HuR. Natural antisense transcripts (NATs) are widely expressed in the human cells, and on an average ~38% of genomic loci in cancer cells express sense: antisense pairs. Similar to our findings, some NATs are shown to affect the expression of their sense partners [22]. In head-neck squamous cell carcinoma, WW domain containing transcription regulator 1 antisense RNA 1 (WWTR1-AS1) promotes cell proliferation and metastasis by regulating WWTR1 mRNA stability [23]. The antisense lncRNA of MACC1 (MACC1-AS1) stabilizes MACC1 mRNA and upregulates MACC1 expression in gastric cancer cells [24]. MAPTAS1, the antisense RNA of MAPT, can protect the MAPT mRNA from degradation in breast cancer cells [25]. Combined with these studies, our research highlighted the importance of the antisense lncRNAs-mediated posttranscriptional regulation of mRNAs in tumor development and progression. Abnormal activation of the hedgehog signaling pathway is one pivotal cause of the cancer initiation and progression [26]. HHIP is a negative regulator of the hedgehog signaling pathway and exhibit suppressive effects in cancers. Downregulation of HHIP has been found in human cancers, such as gastric cancer and glioblastoma [27e29]. However, the regulatory mechanism of HHIP expression in cancer remains unclear. Previous studies reported that loss of HHIP expression in cancers was due to DNA hypermethylation [27,28]. Our current study reveals a novel mechanism by which HHIP expression was regulated by HHIP-AS1 in a posttranscriptional manner. We suspected that HHIP-AS1 may modulate hedgehog signaling pathway via HHIP, which needs further exploration. In summary, our research identified HHIP-AS1 as a tumor suppressor in regulating malignant behaviors of HCC cells. As a direct target of HHIP-AS1, HHIP mediates the roles of HHIP-AS1 in HCC cell proliferation, migration and invasion, suggesting that HHIPAS1-HHIP axis has potential use in HCC treatment. Availability of data and materials The datasets used during this research are available. Authors’ contributions Changwen Bo, Xiuli Li, Li He and Sujing Zhang performed all the experiments. Na Li and Yonghui An designed this study and write the manuscript. Declaration of competing interest None. Acknowledgements The research was supported by The Funding of Key Research and Development Program of Hebei Province (No. 19277733D). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.137. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, CA A Cancer J. Clin. 65 (2015) (2012) 87e108.
7
[2] Y.N. Zhao, Y.Q. Zhang, J.Z. Ye, X. Liu, H.Z. Yang, F.Y. Cong, B.D. Xiang, F.X. Wu, L. Ma, L.Q. Li, H.H. Ye, Hepatic resection versus transarterial chemoembolization for patients with Barcelona Clinic Liver Cancer intermediate stage Child-Pugh A hepatocellular carcinoma, Exp. Ther. Med. 12 (2016) 3813e3819. [3] H. Shi, Y. Xu, X. Yi, D. Fang, X. Hou, Current research progress on long noncoding RNAs associated with hepatocellular carcinoma, Anal. Cell Pathol. (2019) (2019), 1534607. [4] S.A. Pirogov, V.A. Gvozdev, M.S. Klenov, Long noncoding RNAs and stress response in the nucleolus, Cells 8 (2019). [5] Y. Wu, A. Shao, L. Wang, K. Hu, C. Yu, C. Pan, S. Zhang, The role of lncRNAs in the distant metastasis of breast cancer, Front. Oncol. 9 (2019) 407. [6] A. Mongelli, F. Martelli, A. Farsetti, C. Gaetano, The dark that matters: long non-coding RNAs as master regulators of cellular metabolism in noncommunicable diseases, Front. Physiol. 10 (2019) 369. [7] C.R. Xie, F. Wang, S. Zhang, F.Q. Wang, S. Zheng, Z. Li, J. Lv, H.Q. Qi, Q.L. Fang, X.M. Wang, Z.Y. Yin, Long noncoding RNA HCAL facilitates the growth and metastasis of hepatocellular carcinoma by acting as a ceRNA of LAPTM4B, Mol. Ther. Nucleic Acids 9 (2017) 440e451. [8] H. Xiong, Z. Ni, J. He, S. Jiang, X. Li, J. He, W. Gong, L. Zheng, S. Chen, B. Li, N. Zhang, X. Lyu, G. Huang, B. Chen, Y. Zhang, F. He, LncRNA HULC triggers autophagy via stabilizing Sirt1 and attenuates the chemosensitivity of HCC cells, Oncogene 36 (2017) 3528e3540. [9] Z. Yu, H. Zhao, X. Feng, H. Li, C. Qiu, X. Yi, H. Tang, J. Zhang, Long non-coding RNA FENDRR acts as a miR-423-5p sponge to suppress the treg-mediated immune escape of hepatocellular carcinoma cells, Mol. Ther. Nucleic Acids 17 (2019) 516e529. [10] S.X. Yuan, J. Wang, F. Yang, Q.F. Tao, J. Zhang, L.L. Wang, Y. Yang, H. Liu, Z.G. Wang, Q.G. Xu, J. Fan, L. Liu, S.H. Sun, W.P. Zhou, Long noncoding RNA DANCR increases stemness features of hepatocellular carcinoma by derepression of CTNNB1, Hepatology 63 (2016) 499e511. [11] J.F. Chen, P. Wu, R. Xia, J. Yang, X.Y. Huo, D.Y. Gu, C.J. Tang, W. De, F. Yang, STAT3-induced lncRNA HAGLROS overexpression contributes to the malignant progression of gastric cancer cells via mTOR signal-mediated inhibition of autophagy, Mol. Cancer 17 (2018) 6. [12] F. Liu, J.H. Yuan, J.F. Huang, F. Yang, T.T. Wang, J.Z. Ma, L. Zhang, C.C. Zhou, F. Wang, J. Yu, W.P. Zhou, S.H. Sun, Long noncoding RNA FTX inhibits hepatocellular carcinoma proliferation and metastasis by binding MCM2 and miR374a, Oncogene 35 (2016) 5422e5434. [13] J.F. Huang, H.Y. Jiang, H. Cai, Y. Liu, Y.Q. Zhu, S.S. Lin, T.T. Hu, T.T. Wang, W.J. Yang, B. Xiao, S.H. Sun, L.Y. Ma, H.R. Yin, F. Wang, Genome-wide screening identifies oncofetal lncRNA Ptn-dt promoting the proliferation of hepatocellular carcinoma cells by regulating the Ptn receptor, Oncogene 38 (2019) 3428e3445. [14] Q. Pan, X. Long, L. Song, D. Zhao, X. Li, D. Li, M. Li, J. Zhou, X. Tang, H. Ren, K. Ding, Transcriptome sequencing identified hub genes for hepatocellular carcinoma by weighted-gene co-expression analysis, Oncotarget 7 (2016) 38487e38499. [15] M. Jadaliha, O. Gholamalamdari, W. Tang, Y. Zhang, A. Petracovici, Q. Hao, A. Tariq, T.G. Kim, S.E. Holton, D.K. Singh, X.L. Li, S.M. Freier, S. Ambs, R. Bhargava, A. Lal, S.G. Prasanth, J. Ma, K.V. Prasanth, A natural antisense lncRNA controls breast cancer progression by promoting tumor suppressor gene mRNA stability, PLoS Genet. 14 (2018), e1007802. [16] J. Hu, Y. Qian, L. Peng, L. Ma, T. Qiu, Y. Liu, X. Li, X. Chen, Long noncoding RNA EGFR-AS1 promotes cell proliferation by increasing EGFR mRNA stability in gastric cancer, Cell. Physiol. Biochem. 49 (2018) 322e334. [17] J. He, Q. Zuo, B. Hu, H. Jin, C. Wang, Z. Cheng, X. Deng, C. Yang, H. Ruan, C. Yu, F. Zhao, M. Yao, J. Fang, J. Gu, J. Zhou, J. Fan, W. Qin, X.R. Yang, H. Wang, A novel, liver-specific long noncoding RNA LINC01093 suppresses HCC progression by interaction with IGF2BP1 to facilitate decay of GLI1 mRNA, Cancer Lett. 450 (2019) 98e109. [18] J. Li, Z. Li, W. Zheng, X. Li, Z. Wang, Y. Cui, X. Jiang, LncRNA-ATB, An indispensable cancer-related long noncoding RNA, Cell Prolif 50 (2017). [19] K. Luo, J. Geng, Q. Zhang, Y. Xu, X. Zhou, Z. Huang, K.Q. Shi, C. Pan, J. Wu, LncRNA CASC9 interacts with CPSF3 to regulate TGF-beta signaling in colorectal cancer, J. Exp. Clin. Cancer Res. 38 (2019) 249. [20] L. Cao, P. Zhang, J. Li, M. Wu, LAST, a c-Myc-inducible long noncoding RNA, cooperates with CNBP to promote CCND1 mRNA stability in human cells, Elife 6 (2017). [21] Z. Li, Y. Wang, R. Hu, R. Xu, W. Xu, LncRNA B4GALT1-AS1 recruits HuR to promote osteosarcoma cells stemness and migration via enhancing YAP transcriptional activity, Cell Prolif 51 (2018), e12504. [22] O.A. Balbin, R. Malik, S.M. Dhanasekaran, J.R. Prensner, X. Cao, Y.M. Wu, D. Robinson, R. Wang, G. Chen, D.G. Beer, A.I. Nesvizhskii, A.M. Chinnaiyan, The landscape of antisense gene expression in human cancers, Genome Res. 25 (2015) 1068e1079. [23] J. Li, Z. Li, Y. Wu, P. Diao, W. Zhang, Y. Wang, J. Yang, J. Cheng, Overexpression of lncRNA WWTR1-AS1 associates with tumor aggressiveness and unfavorable survival in head-neck squamous cell carcinoma, J. Cell. Biochem. 120 (10) (2019 Oct) 18266e18277. [24] Y. Zhao, Y. Liu, L. Lin, Q. Huang, W. He, S. Zhang, S. Dong, Z. Wen, J. Rao, W. Liao, M. Shi, The lncRNA MACC1-AS1 promotes gastric cancer cell metabolic plasticity via AMPK/Lin28 mediated mRNA stability of MACC1, Mol. Cancer 17 (2018) 69. [25] Y. Pan, Y. Pan, Y. Cheng, F. Yang, Z. Yao, O. Wang, Knockdown of LncRNA
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
8
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
MAPT-AS1 inhibites proliferation and migration and sensitizes cancer cells to paclitaxel by regulating MAPT expression in ER-negative breast cancers, Cell Biosci. 8 (2018) 7. [26] A. Dimou, A. Bamias, H. Gogas, K. Syrigos, Inhibition of the Hedgehog pathway in lung cancer, Lung Cancer 133 (2019) 56e61. [27] Y. Song, Y. Zuo, Occurrence of HHIP gene CpG island methylation in gastric cancer, Oncol. Lett. 8 (2014) 2340e2344.
[28] Y. Zuo, Y. Lv, X. Qian, S. Wang, Z. Chen, Q. Jiang, C. Cao, Y. Song, Inhibition of HHIP promoter methylation suppresses human gastric cancer cell proliferation and migration, Cell. Physiol. Biochem. 45 (2018) 1840e1850. [29] L. Chang, P. Zhang, D. Zhao, H. Liu, Q. Wang, C. Li, W. Du, X. Liu, H. Zhang, Z. Zhang, C. Jiang, The hedgehog antagonist HHIP as a favorable prognosticator in glioblastoma, Tumour Biol. 37 (2016) 3979e3986.
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA Changwen Bo, Xiuli Li, Li He, Sujing Zhang, Na Li**, Yonghui An* Department of Oncology, The First Hospital of Hebei Medical University, Shijiazhuang, Hebei province, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 8 September 2019 Accepted 29 September 2019 Available online xxx
Aberrant expression of long non-coding RNAs (lncRNAs) has been observed in hepatocellular carcinoma (HCC) and confirmed to participate in the initiation and progression of HCC. In the present study, we identified a novel functional lncRNA, hedgehog-interacting protein antisense RNA 1 (HHIP-AS1). The expression levels of HHIP-AS1 were significantly decreased in HCC tissues. Downregulation of HHIP-AS1 expression correlated with larger tumor size, metastasis, and advanced TNM stage, and also predicted worse overall survival rate of HCC patients. Through performing overexpression and knockdown experiments, the biological function of HHIP-AS1 was identified to suppress HCC cell proliferation, migration and invasion, while promote apoptosis. Further investigation showed that HHIP-AS1 interacted with and positively regulated the stability of HHIP mRNA in a HuR-dependent manner. HHIP-AS1 exerted its suppressive effects through HHIP. Taken together, our findings demonstrate that HHIP-AS1 represses HCC progression by promoting HHIP expression, and indicate that the use of HHIP-AS1 may offer a promising treatment for HCC patients. © 2019 Elsevier Inc. All rights reserved.
Keywords: Antisense RNA Stability HHIP Degradation HuR
1. Introduction Hepatocellular carcinoma (HCC) is one of the most common human malignancies worldwide, contributing to a great proportion of cancer-related death, especially in China [1]. Even though the great advancements of therapeutic methods for HCC, such as surgical resection and chemotherapy, have been made in the past decades, the prognoses of HCC patients are unsatisfied due to tumor recurrence and intrahepatic or distant metastasis with a high frequency [2]. However, the underlying mechanisms of pathogenesis of HCC development remains poorly explored. Numerous evidence has demonstrated that long noncoding RNAs (lncRNAs) exert important functions in regulating biological processes, such as proliferation, apoptosis, migration, angiogenesis, metabolism and autophagy [3e6]. Aberrant expression of some lncRNAs has been observed in HCC, which contributes to tumorigenesis and progression of HCC. For example, lncRNA HCAL acts as a competing endogenous RNA (ceRNA) of LAPTM4B to enhance HCC grow and metastasis [7]. lncRNA HULC suppresses autophagy via
upregulating USP22 and stabilizing SIRT1, which facilitates chemoresistance of HCC [8]. lncRNA FENDRR associates with miR-423 and suppresses the miR-423-mediated GADD45B downregulation [9]. DANCR binds to CTNNB1 30 UTR region and then blocks the repressing effect of miR-214, miR-320a, and miR-199a on CTNNB1, increasing stemness features of HCC cells [10]. Hence, because of the crucial roles of lncRNAs, it is essential to reveal the correlation between lncRNAs and HCC progression. In the present study, we identified a novel functional lncRNA, hedgehog-interacting protein antisense RNA 1 (HHIP-AS1, GeneSymbol: NR_037595), which was significantly downregulated in HCC tissues. Moreover, we found that HHIP-AS1 interacted with and stabilized hedgehog-interacting protein (HHIP) mRNA, which increased HHIP expression and eventually inhibited HCC progression. Thus, our findings implicated the potential application of HHIP-AS1 for the prognosis and treatment of HCC patients. 2. Materials and methods 2.1. Tissues collection
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (N. Li), [email protected] (Y. An).
60 pairs of HCC tissues and adjacent normal liver tissues were obtained from patients who underwent surgical resection due to HCC in the First Hospital of Hebei Medical University. None of these
https://doi.org/10.1016/j.bbrc.2019.09.137 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
2
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
patients were preoperatively treated. This study was approved by the Ethics Committee of the First Hospital of Hebei Medical University. Signed written informed consents were obtained from all participants. This research was carried out according to the standards set by the Declaration of Helsinki.
2.8. Flow cytometry
2.2. Cell culture
2.9. Transwell assay
Hep3B, PLC/PRF/5, Huh7, HepG2 and MHCC-97 h cell lines were obtained from Cell Bank of Chinese Academy of Sciences and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) in a 5% CO2 incubator at 37 C.
To detect cell migration and invasion, transwell chambers precoated with or without Matrigel (BD Biosciences) was used, respectively. 1 105 cells suspended in 200 ml serum-free DMEM were added to the upper chambers. 500 ml DMEM containing 10% FBS was added to the bottom chamber. 24 h later, the cells across the membrane were fixed, stained and then counted under a microscope.
2.3. Isolation of cytoplasmic and nuclear RNA To isolate cytoplasmic and nuclear RNA, Cytoplasmic and Nuclear RNA Purification Kit (Norgen Biotek Corp.) was used according to the manufacturer’s instruction. U6 and GAPDH were used as cytoplasmic and nuclear internal controls, respectively. 2.4. Construction of stable cells Lentiviral particles expressing scramble shRNA (shNC) or HHIPAS1 shRNAs or HHIP shRNAs or empty vector (NC) or full-length HHIP-AS1 or HHIP were purchased from GENECHEM Company (Shanghai, China). Cells were infected with above lentiviral particles in the presence of 10 mg/ml polybrene. After 48 h, the stable cells were selected by using 3 mg/ml puromycin for 1 week. 2.5. Quantitative real-time PCR (qRT-PCR) Total RNA were extracted by using Trizol reagent (Invitrogen). The cDNA was reversely transcribed by using PrimeScript 1st Strand cDNA Synthesis Kit (Takara). qRT-PCR detection was performed by using TransStart® Top Green qPCR SuperMix (Transgen, China). GAPDH mRNA was used as internal reference. The relative expression of indicated genes was normalized to control group and calculated using 2-△△Ct methods. The primer sequences were listed below: HHIP-forward: GTCATGGAGGTGTCTGTGTTAG HHIP-reverse: GTCACTCTGCGGATGTTTCT HHIP-AS1-forward: GGCTGAAGAAGCAGAGGATAG HHIP-AS1-reverse: TTCACCACTCTGTCGGTTTAG GAPDH-forward: GGTGTGAACCATGAGAAGTATGA GAPDH- reverse: GAGTCCTTCCACGATACCAAAG
2.6. Western blot
To analysis the effect of HHIP-AS1 on cell apoptosis, Annexin VFITC Apoptosis Detection Kit (Dojindo) was used as the manufacturer’s instructions.
2.10. Caspase-3 activity detection Caspase-3 activity was measured using the Caspase-3 activity assay kit (Cell signaling) according to the manufacturer’s instructions. RNA immunoprecipitation (RIP) and MS2-binding sequencesMS2-binding proteinebased RIP assay (MS2-RIP). Magna RIP RNA-Binding Protein Immunoprecipitation kit was used for RIP assay according to the manufacturer’s instructions. The antibodies were used as follows: HuR (Abcam), IGF2BP1 (Abcam) or AUF1 (Abcam). MS2-RIP was performed to determine the association between HHIP-AS1 and HHIP mRNA using the IgG or anti-GFP (Abcam) and Magna RIP RNA-Binding Protein Immunoprecipitation kit as described previously [7,12]. The immunoprecipitated RNA was measured by qRT-PCR. 2.11. RNA pull-down assay RNA pull-down assay was performed by using Pierce Magnetic RNA-Protein Pull-Down Kit as the manufacturer’s instructions. The amount of pull-down RNA was measured by qRT-PCR. 2.12. Statistical analysis The statistical analysis was performed by using SPSS 24.0 software (Chicago, IL, USA). Student’s t-test or One-way ANOVA was used to analyze the differences between different groups. Chisquare test was used to determine the relationship between HHIP-AS1 levels and clinicopathological features. Pearson’s correlation analysis was used to evaluate the correlation between HHIPAS1 and HHIP mRNA levels in HCC tissues. Kaplan-Meier survival plots and log-rank tests were performed to determine the correlation of HHIP-AS1 expression and prognosis of HCC patients. A p < 0.05 was considered statistically significant. 3. Results
Western blot analysis was performed according to standard protocols as described previously [11]. The antibodies were used as follows: HHIP (Abcam), GAPDH (Cell Signaling). 2.7. CCK-8 and colony formation assay For CCK-8 assay, 2 103 cells per well in 100 ml DMEM were seeded into 96-well plate. At the indicated time points, optical density (OD) at 450 nm was measured using the CCK-8 kit (Dojindo) for depicting the proliferation curve. For colony formation assay, 2 103 cells per well were seeded in a 6-well plate. After 2 weeks, cell clones were fixed and stained with 0.05% crystal violet.
3.1. Downregulation of HHIP-AS1 predicts poor prognosis of HCC patients We first analyzed the profiles of differentially expressed lncRNAs obtained through microarray chips or RNA sequencing from previous studies [7,13,14]. Among these dysregulated lncRNAs, we identified that HHIP-AS1 located in chromosome 4q31 and was one of the most deceased lncRNAs in HCC tissues. To validate this result, the HHIP-AS1 levels in 60 pairs of HCC tissues and adjacent normal liver tissues were assessed by qRT-PCR. It was shown that the HHIP-AS1 levels were significantly decreased in HCC tissues compared to that in normal liver tissues (Fig. 1A). Based on the
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. HHIP-AS1 is downregulated in HCC tissues and predicts poor prognosis A. The qRT-PCR analysis of 60 pairs of HCC tissues and adjacent normal liver tissues. B. Kaplan-Meier survival plots and log-rank tests were conducted to clarify the relationship between HHIP-AS1 levels and prognosis of HCC patients. The median expression level of HHIP-AS1 in HCC tissues was used as the cutoff.
median of HHIP-AS1 levels in HCC tissue samples, the HCC patients were divided into high- and low-level groups. The correlation analysis of HHIP-AS1 expression with clinicopathological features of HCC patients demonstrated that HHIP-AS1 expression was significantly associated with tumor size, metastasis, and TNM stage (Table 1). Furthermore, Kaplan-Meier survival plots and log-rank tests were conducted to clarify the relationship between HHIPAS1 levels and prognosis of HCC patients, and the results demonstrated that patients with low-level HHIP-AS1 had a worse survival rate than patients with high-level HHIP-AS1 (Fig. 1B). 3.2. HHIP-AS1 inhibits proliferation and enhances apoptosis in HCC cells
3
Hep3B cells with relatively low level of HHIP-AS1 (Fig. 2C). The effect of HHIP-AS1 on cell proliferation was determined by CCK-8 and colony formation assays. It was observed that depletion of endogenous HHIP-AS1 markedly increased the proliferative ability of Huh7 cells compared to the control group (Fig. 2D and E), while the proliferation was significantly attenuated after overexpressing HHIP-AS1 in Hep3B cells (Fig. 2F and G). We then evaluated whether HHIP-AS1 affected apoptosis in HCC cells. The results of flow cytometry analysis demonstrated that Huh7 cells with knockdown of HHIP-AS1 showed a lower apoptotic rate compared to control cells (Fig. 2H and Supplemental Fig. 1A). In contrast, overexpression of HHIP-AS1 enhanced the apoptosis in Hep3B cells (Fig. 2I and Supplemental Fig. 1B). Similarly, the caspase-3 activity detection confirmed a stimulative effect of HHIP-AS1 on HCC cell apoptosis (Fig. 2J and K). 3.3. HHIP-AS1 represses HCC cell migration and invasion To examine whether HHIP-AS1 affected migration and invasion in HCC cells, experiments using transwell chambers without or with matrigel were conducted, respectively. We observed a significantly increased number of HHIP-AS1 knockdown Huh7 cells on the outside membranes of the transwell chamber without or with matrigel, compared with that of control cells (Fig. 2L and Supplemental Fig. 1C), whereas a reverse effect was found after overexpressing HHIP-AS1 in Hep3B cells (Fig. 2M and Supplemental Fig. 1D). These results suggest that HHIP-AS1 weakens migratory and invasive capacities in HCC cells. 3.4. HHIP-AS1 increases the stability of HHIP mRNA
To clarify the functional roles of HHIP-AS1 in malignant behaviors of HCC cells, knockdown and overexpression experiments were conducted. Based on the endogenous HHIP-AS1 levels in different HCC cells (Fig. 2A), lentiviral particles expressing two different HHIP-AS1 shRNAs (sh1 and sh2) were transfected into the Huh7 cells with relatively high level of HHIP-AS1 (Fig. 2B), while lentiviral particles expressing HHIP-AS1 was transfected into in
Table 1 Clinical characteristics and outcome of 60 HCC patients according to HHIP-AS1 expression levels. Features
Age ＜60 60 Gender Male Female Tumor size ＜5 cm 5 cm TNM stage I/II III/IV Liver cirrhosis No Yes Serum AFP ＜400 400 Metastasis Yes No
HHIP-AS1
p value
Low
High
24 6
26 4
0.488
25 5
24 6
0.739
6 24
14 16
0.028
8 22
18 12
0.009
10 20
12 18
0.592
12 18
13 17
0.793
20 10
12 18
0.038
The median expression level of HHIP-AS1 in HCC tissues was used as the cutoff.
To reveal the underlying mechanisms of HHIP-AS1 in inhibiting malignant behaviors of HCC cells, we first determined the cellular localization of HHIP-AS1. The cytoplasmic and nuclear RNA was isolated and then used to detect HHIP-AS1 expression via qRT-PCR. As shown in Fig. 3A, HHIP-AS1 mainly distributed in the cytoplasm of Huh7 and Hep3B cells, indicating that HHIP-AS1 may involve in post-transcriptional regulation. Recently, it has been reported that antisense lncRNA could associate with its sense RNA and increase its stability [15,16]. To validate the association between HHIP-AS1 and its sense RNA, hedgehog-interacting protein (HHIP), we incubated biotin-labeled HHIP-AS1 with Huh7 or Hep3B cell extracts and performed RNA pull-down assay, followed by qRT-PCR detection. We identified a significant interaction between HHIP-AS1 and HHIP mRNA (Fig. 3B). For further confirmation, we performed MS2RIP to pull down endogenous HHIP mRNA associated with HHIPAS1. It was demonstrated that the HHIP-AS1 RIP was significantly enriched for HHIP mRNA compared to the empty vector, IgG, or GAPDH mRNA, which did not have a complementary region with HHIP-AS1 (Fig. 3C). To detect whether HHIP-AS1 influenced the expression of HHIP, qRT-PCR and Western blot assays were carried out. We observed that HHIP-AS1-depleted Huh7 cells showed consistent reduction in the mRNA and protein levels of HHIP (Fig. 3D and E), whereas overexpression of HHIP-AS1 upregulated HHIP expression in Hep3B cells (Fig. 3F and G). Moreover, we treated control and HHIP-AS1silenced Huh-7 cells with an RNA synthesis inhibitor a-amanitin, collected samples at several time points, and detected the degradation of HHIP mRNA levels via performing qRT-PCR analyses. Huh7 cells with HHIP-AS1 knockdown exhibited a significantly shorter half-life of HHIP mRNA compared to control cells (Fig. 3H). Conversely, ectopic expression of HHIP-AS1 elongated the half-life of HHIP mRNA in Hep3B cells (Fig. 3I). Together, our findings suggest that HHIP-AS1 interacts with and stabilizes HHIP mRNA.
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
4
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 2. HHIP-AS1 suppresses HCC cell proliferation, migration and invasion A. The qRT-PCR analysis of 5 different HCC cell lines. B. The relative expression of HHIP-AS1 in control and HHIP-AS1-silenced Huh7 cells was detected by qRT-PCR.C. The relative expression of HHIP-AS1 in control and HHIP-AS1-overexpressed Hep3B cells was detected by qRT-PCR.D. The proliferation of HHIP-AS1 in control and HHIP-AS1-silenced Huh7 cells was determined by CCK-8 assay.E. The colony formation of HHIP-AS1 in control and HHIP-AS1-silenced Huh7 cells.F. The proliferation of HHIP-AS1 in control and HHIP-AS1overexpressed Hep3B cells was determined by CCK-8 assay.G. The colony formation of HHIP-AS1 in control and HHIP-AS1-overexpressed Hep3B cells.H. Apoptosis was assayed by flow cytometry in control and HHIP-AS1-silenced Huh7 cells.I. Apoptosis was assayed by flow cytometry in control and HHIP-AS1-overexpressed Hep3B cells.J. Caspase-3 activity of control and HHIP-AS1-silenced Huh7 cells was assayed.K. Caspase-3 activity of control and HHIP-AS1-overexpressed Hep3B cells was assayed.L. The transwell assay was conducted to detect the effect of HHIP-AS1 knockdown on migration and invasion in Huh7 cells. The represent images were shown in Supplemental Fig. 1C. M. The transwell assay was conducted to detect the effect of HHIP-AS1 overexpression on migration and invasion in Hep3B cells. The represent images were shown in Supplemental Fig. 1D.*p < 0.05, **p < 0.01.
3.5. HHIP-AS1 stabilizes HHIP mRNA through HuR Recent studies reported that lncRNAs affected the stability of their interacting RNAs via recruiting RNA-binding proteins (RBPs), such as HuR, IGF2BP1 and AUF1 [15,17]. We performed RNAimmunoprecipitation (RIP) assay using HuR, IGF2BP1 or AUF1 antibody followed by qRT-PCR to evaluate the interaction of HuR,
IGF2BP1 or AUF1 with TTIP-AS1 and TTIP mRNA in control and HHIP-AS1-silenced Huh7 cells. The results demonstrated that only HuR interacted with HHIP-AS1 and HHIP mRNA, and this interaction was significantly attenuated by HHIP-AS1 knockdown (Fig. 4A). In contrast, Hep3B cells with HHIP-AS1 overexpression showed markedly enhanced the interaction between HuR and HHIP-AS1 or HHIP mRNA (Fig. 4B). In addition, knockdown of HuR in HHIP-AS1-
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. HHIP-AS1 stabilizes HHIP mRNA A. The cellular location of HHIP-AS1 in Huh7 and Hep3B cells.B. Cell lysates from Huh7 and Hep3B cells were incubated with biotin-labeled HHIP-AS1; after pull-down, HHIP mRNA was detected by qRT-PCR. C. Left: The schematic diagram of MS2-RIP assay was shown. Right: MS2-RIP followed by qRT-PCR to detect endogenous HHIP mRNA associated with HHIP-AS1 in Huh7 and Hep3B cells.D. The mRNA levels of HHIP in control and HHIP-AS1-silenced Huh7 cells were tested by qRT-PCR.E. The protein levels of HHIP in control and HHIP-AS1-silenced Huh7 cells were tested by Western blot.F. The mRNA levels of HHIP in control and HHIP-AS1-overexpressed Hep3B cells were tested by qRT-PCR.G. The protein levels of HHIP in control and HHIP-AS1-overexpressed Hep3B cells were tested by Western blot.H. The stability of HHIP mRNA over time was measured by qRT-PCR relative to time 0 after blocking new RNA synthesis with a-amanitin (50 mM) in control and HHIP-AS1-silenced Huh7 cells and normalized to 18S rRNA (a product of RNA polymerase I that is unchanged by a-amanitin).I. The stability of HHIP mRNA over time was measured by qRT-PCR relative to time 0 after blocking new RNA synthesis with a-amanitin (50 mM) in control and HHIP-AS1-overexpressed Hep3B cells and normalized to 18S rRNA.*p < 0.05, **p < 0.01, ***p < 0.001.
overexpressed Hep3B cells abolished the upregulation of HHIP mRNA and protein levels (Fig. 4C and D). Taken together, we conclude that HHIP-AS1 facilitates HHIP mRNA stability by promoting HuR binding to HHIP mRNA. 3.6. HHIP-AS1 exerts suppressive effects via HHIP Finally, rescue experiments were conducted to assess whether HHIP-AS1 exerted suppressive effects via HHIP. We knocked down the HHIP expression in HHIP-AS1-overexpressed Hep3B cells. The results showed that downregulation of HHIP rescued the proliferative, migratory and invasive abilities reduced by HHIP-AS1
overexpression in Hep3B cells (Fig. 4E and F). To further reveal the pathological correlation between HHIP-AS1 and HHIP expression in HCC, the expression levels of HHIP mRNA in HCC and normal liver tissues were detected. It was observed that HHIP expression was decreased in HCC tissues (Fig. 4G). Moreover, HHIP-AS1 and HHIP mRNA levels showed significant positive correlation with each other in HCC tissues (Fig. 4H). Together, these results demonstrate that HHIP-AS1 exerts its function via regulating HHIP expression. 4. Discussion Increasing evidence has indicated a crucial role of lncRNAs in
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
6
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. HHIP-AS1 stabilizes HHIP mRNA through HuR. A. RIP followed by qRT-PCR assay was performed used IgG, HuR, IGF2BP1 or AUF1 antibodies in control and HHIP-AS1-silenced Huh7 cells. B. RIP followed by qRT-PCR assay was performed used IgG, HuR, IGF2BP1 or AUF1 antibodies in control and HHIP-AS1-overexpressed Hep3B cells. C. HuR expression was knocked down in HHIP-AS1-overexpressed Hep3B cells, and then the HHIP mRNA level was detected by qRT-PCR.D. HuR expression was knocked down in HHIP-AS1-overexpressed Hep3B cells, and then the HHIP protein level was detected by Western blot. E. Depletion of HHIP expression abolished the HHIP-AS1-mediated suppression of proliferation in Hep3B cells. F. Depletion of HHIP expression abolished the HHIP-AS1-mediated suppression of migration and invasion in Hep3B cells. G. The qRT-PCR analysis of 60 pairs of HCC tissues and adjacent normal liver tissues. H. The correlation between HHIP-AS1 and HHIP mRNA levels was measured via Pearson correlation analysis.*p < 0.05, **p < 0.01.
regulating development and progression of human cancers [18]. Our study is the first to reveal the functional roles and underlying mechanism of HHIP-AS1 in HCC. Here, we found that HHIP-AS1 levels were significantly downregulated in HCC tissues. Decreased expression of HHIP-AS1 correlated with larger tumor size, metastasis, and advanced TNM stage, and also predicted worse overall survival rate of HCC patients. Through overexpression and knockdown experiments, the biological function of HHIP-AS1 was identified to suppress HCC cell proliferation, migration and invasion, while promote apoptosis. These findings suggest that downregulation of HHIP-AS1 expression contributes to HCC progression. Recently, it was demonstrated that lncRNAs are capable to
associate with RBPs and elevate the stability of target mRNAs. For instance, CASC9 enhances TGFb2 mRNA stability via interaction with CPSF3, thus inducing tumor growth and metastasis in colorectal cancer [19]. LINC01093 directly binds IGF2BP1 and interrupts its interaction with oncogene GLI1 mRNA, which induces degradation of GLI1 mRNA and inhibits HCC cell proliferation and metastasis [17]. LncRNA-Assisted Stabilization of Transcripts (LAST) is shown to promote CCND1 mRNA stability via cooperating with CNBP to bind to the 50 UTR of CCND1 mRNA [20]. In osteosarcoma cells, lncRNA B4GALT1-AS1 recruits HuR to stabilize YAP mRNA and thus facilitate its transcriptional activity [21]. Here, we identified HHIP mRNA as a direct target of HHIP-AS1. The results of RNA pull-
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
down and MS2-RIP assay demonstrated that HHIP-AS1 directly associated with HHIP mRNA. Moreover, we observed that HHIP-AS1 increased the stability of HHIP-mRNA through enhancing the interaction between HHIP-mRNA and HuR. Natural antisense transcripts (NATs) are widely expressed in the human cells, and on an average ~38% of genomic loci in cancer cells express sense: antisense pairs. Similar to our findings, some NATs are shown to affect the expression of their sense partners [22]. In head-neck squamous cell carcinoma, WW domain containing transcription regulator 1 antisense RNA 1 (WWTR1-AS1) promotes cell proliferation and metastasis by regulating WWTR1 mRNA stability [23]. The antisense lncRNA of MACC1 (MACC1-AS1) stabilizes MACC1 mRNA and upregulates MACC1 expression in gastric cancer cells [24]. MAPTAS1, the antisense RNA of MAPT, can protect the MAPT mRNA from degradation in breast cancer cells [25]. Combined with these studies, our research highlighted the importance of the antisense lncRNAs-mediated posttranscriptional regulation of mRNAs in tumor development and progression. Abnormal activation of the hedgehog signaling pathway is one pivotal cause of the cancer initiation and progression [26]. HHIP is a negative regulator of the hedgehog signaling pathway and exhibit suppressive effects in cancers. Downregulation of HHIP has been found in human cancers, such as gastric cancer and glioblastoma [27e29]. However, the regulatory mechanism of HHIP expression in cancer remains unclear. Previous studies reported that loss of HHIP expression in cancers was due to DNA hypermethylation [27,28]. Our current study reveals a novel mechanism by which HHIP expression was regulated by HHIP-AS1 in a posttranscriptional manner. We suspected that HHIP-AS1 may modulate hedgehog signaling pathway via HHIP, which needs further exploration. In summary, our research identified HHIP-AS1 as a tumor suppressor in regulating malignant behaviors of HCC cells. As a direct target of HHIP-AS1, HHIP mediates the roles of HHIP-AS1 in HCC cell proliferation, migration and invasion, suggesting that HHIPAS1-HHIP axis has potential use in HCC treatment. Availability of data and materials The datasets used during this research are available. Authors’ contributions Changwen Bo, Xiuli Li, Li He and Sujing Zhang performed all the experiments. Na Li and Yonghui An designed this study and write the manuscript. Declaration of competing interest None. Acknowledgements The research was supported by The Funding of Key Research and Development Program of Hebei Province (No. 19277733D). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.137. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, CA A Cancer J. Clin. 65 (2015) (2012) 87e108.
7
[2] Y.N. Zhao, Y.Q. Zhang, J.Z. Ye, X. Liu, H.Z. Yang, F.Y. Cong, B.D. Xiang, F.X. Wu, L. Ma, L.Q. Li, H.H. Ye, Hepatic resection versus transarterial chemoembolization for patients with Barcelona Clinic Liver Cancer intermediate stage Child-Pugh A hepatocellular carcinoma, Exp. Ther. Med. 12 (2016) 3813e3819. [3] H. Shi, Y. Xu, X. Yi, D. Fang, X. Hou, Current research progress on long noncoding RNAs associated with hepatocellular carcinoma, Anal. Cell Pathol. (2019) (2019), 1534607. [4] S.A. Pirogov, V.A. Gvozdev, M.S. Klenov, Long noncoding RNAs and stress response in the nucleolus, Cells 8 (2019). [5] Y. Wu, A. Shao, L. Wang, K. Hu, C. Yu, C. Pan, S. Zhang, The role of lncRNAs in the distant metastasis of breast cancer, Front. Oncol. 9 (2019) 407. [6] A. Mongelli, F. Martelli, A. Farsetti, C. Gaetano, The dark that matters: long non-coding RNAs as master regulators of cellular metabolism in noncommunicable diseases, Front. Physiol. 10 (2019) 369. [7] C.R. Xie, F. Wang, S. Zhang, F.Q. Wang, S. Zheng, Z. Li, J. Lv, H.Q. Qi, Q.L. Fang, X.M. Wang, Z.Y. Yin, Long noncoding RNA HCAL facilitates the growth and metastasis of hepatocellular carcinoma by acting as a ceRNA of LAPTM4B, Mol. Ther. Nucleic Acids 9 (2017) 440e451. [8] H. Xiong, Z. Ni, J. He, S. Jiang, X. Li, J. He, W. Gong, L. Zheng, S. Chen, B. Li, N. Zhang, X. Lyu, G. Huang, B. Chen, Y. Zhang, F. He, LncRNA HULC triggers autophagy via stabilizing Sirt1 and attenuates the chemosensitivity of HCC cells, Oncogene 36 (2017) 3528e3540. [9] Z. Yu, H. Zhao, X. Feng, H. Li, C. Qiu, X. Yi, H. Tang, J. Zhang, Long non-coding RNA FENDRR acts as a miR-423-5p sponge to suppress the treg-mediated immune escape of hepatocellular carcinoma cells, Mol. Ther. Nucleic Acids 17 (2019) 516e529. [10] S.X. Yuan, J. Wang, F. Yang, Q.F. Tao, J. Zhang, L.L. Wang, Y. Yang, H. Liu, Z.G. Wang, Q.G. Xu, J. Fan, L. Liu, S.H. Sun, W.P. Zhou, Long noncoding RNA DANCR increases stemness features of hepatocellular carcinoma by derepression of CTNNB1, Hepatology 63 (2016) 499e511. [11] J.F. Chen, P. Wu, R. Xia, J. Yang, X.Y. Huo, D.Y. Gu, C.J. Tang, W. De, F. Yang, STAT3-induced lncRNA HAGLROS overexpression contributes to the malignant progression of gastric cancer cells via mTOR signal-mediated inhibition of autophagy, Mol. Cancer 17 (2018) 6. [12] F. Liu, J.H. Yuan, J.F. Huang, F. Yang, T.T. Wang, J.Z. Ma, L. Zhang, C.C. Zhou, F. Wang, J. Yu, W.P. Zhou, S.H. Sun, Long noncoding RNA FTX inhibits hepatocellular carcinoma proliferation and metastasis by binding MCM2 and miR374a, Oncogene 35 (2016) 5422e5434. [13] J.F. Huang, H.Y. Jiang, H. Cai, Y. Liu, Y.Q. Zhu, S.S. Lin, T.T. Hu, T.T. Wang, W.J. Yang, B. Xiao, S.H. Sun, L.Y. Ma, H.R. Yin, F. Wang, Genome-wide screening identifies oncofetal lncRNA Ptn-dt promoting the proliferation of hepatocellular carcinoma cells by regulating the Ptn receptor, Oncogene 38 (2019) 3428e3445. [14] Q. Pan, X. Long, L. Song, D. Zhao, X. Li, D. Li, M. Li, J. Zhou, X. Tang, H. Ren, K. Ding, Transcriptome sequencing identified hub genes for hepatocellular carcinoma by weighted-gene co-expression analysis, Oncotarget 7 (2016) 38487e38499. [15] M. Jadaliha, O. Gholamalamdari, W. Tang, Y. Zhang, A. Petracovici, Q. Hao, A. Tariq, T.G. Kim, S.E. Holton, D.K. Singh, X.L. Li, S.M. Freier, S. Ambs, R. Bhargava, A. Lal, S.G. Prasanth, J. Ma, K.V. Prasanth, A natural antisense lncRNA controls breast cancer progression by promoting tumor suppressor gene mRNA stability, PLoS Genet. 14 (2018), e1007802. [16] J. Hu, Y. Qian, L. Peng, L. Ma, T. Qiu, Y. Liu, X. Li, X. Chen, Long noncoding RNA EGFR-AS1 promotes cell proliferation by increasing EGFR mRNA stability in gastric cancer, Cell. Physiol. Biochem. 49 (2018) 322e334. [17] J. He, Q. Zuo, B. Hu, H. Jin, C. Wang, Z. Cheng, X. Deng, C. Yang, H. Ruan, C. Yu, F. Zhao, M. Yao, J. Fang, J. Gu, J. Zhou, J. Fan, W. Qin, X.R. Yang, H. Wang, A novel, liver-specific long noncoding RNA LINC01093 suppresses HCC progression by interaction with IGF2BP1 to facilitate decay of GLI1 mRNA, Cancer Lett. 450 (2019) 98e109. [18] J. Li, Z. Li, W. Zheng, X. Li, Z. Wang, Y. Cui, X. Jiang, LncRNA-ATB, An indispensable cancer-related long noncoding RNA, Cell Prolif 50 (2017). [19] K. Luo, J. Geng, Q. Zhang, Y. Xu, X. Zhou, Z. Huang, K.Q. Shi, C. Pan, J. Wu, LncRNA CASC9 interacts with CPSF3 to regulate TGF-beta signaling in colorectal cancer, J. Exp. Clin. Cancer Res. 38 (2019) 249. [20] L. Cao, P. Zhang, J. Li, M. Wu, LAST, a c-Myc-inducible long noncoding RNA, cooperates with CNBP to promote CCND1 mRNA stability in human cells, Elife 6 (2017). [21] Z. Li, Y. Wang, R. Hu, R. Xu, W. Xu, LncRNA B4GALT1-AS1 recruits HuR to promote osteosarcoma cells stemness and migration via enhancing YAP transcriptional activity, Cell Prolif 51 (2018), e12504. [22] O.A. Balbin, R. Malik, S.M. Dhanasekaran, J.R. Prensner, X. Cao, Y.M. Wu, D. Robinson, R. Wang, G. Chen, D.G. Beer, A.I. Nesvizhskii, A.M. Chinnaiyan, The landscape of antisense gene expression in human cancers, Genome Res. 25 (2015) 1068e1079. [23] J. Li, Z. Li, Y. Wu, P. Diao, W. Zhang, Y. Wang, J. Yang, J. Cheng, Overexpression of lncRNA WWTR1-AS1 associates with tumor aggressiveness and unfavorable survival in head-neck squamous cell carcinoma, J. Cell. Biochem. 120 (10) (2019 Oct) 18266e18277. [24] Y. Zhao, Y. Liu, L. Lin, Q. Huang, W. He, S. Zhang, S. Dong, Z. Wen, J. Rao, W. Liao, M. Shi, The lncRNA MACC1-AS1 promotes gastric cancer cell metabolic plasticity via AMPK/Lin28 mediated mRNA stability of MACC1, Mol. Cancer 17 (2018) 69. [25] Y. Pan, Y. Pan, Y. Cheng, F. Yang, Z. Yao, O. Wang, Knockdown of LncRNA
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137
8
C. Bo et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
MAPT-AS1 inhibites proliferation and migration and sensitizes cancer cells to paclitaxel by regulating MAPT expression in ER-negative breast cancers, Cell Biosci. 8 (2018) 7. [26] A. Dimou, A. Bamias, H. Gogas, K. Syrigos, Inhibition of the Hedgehog pathway in lung cancer, Lung Cancer 133 (2019) 56e61. [27] Y. Song, Y. Zuo, Occurrence of HHIP gene CpG island methylation in gastric cancer, Oncol. Lett. 8 (2014) 2340e2344.
[28] Y. Zuo, Y. Lv, X. Qian, S. Wang, Z. Chen, Q. Jiang, C. Cao, Y. Song, Inhibition of HHIP promoter methylation suppresses human gastric cancer cell proliferation and migration, Cell. Physiol. Biochem. 45 (2018) 1840e1850. [29] L. Chang, P. Zhang, D. Zhao, H. Liu, Q. Wang, C. Li, W. Du, X. Liu, H. Zhang, Z. Zhang, C. Jiang, The hedgehog antagonist HHIP as a favorable prognosticator in glioblastoma, Tumour Biol. 37 (2016) 3979e3986.
Please cite this article as: C. Bo et al., A novel long noncoding RNA HHIP-AS1 suppresses hepatocellular carcinoma progression through stabilizing HHIP mRNA, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.137