A novel multiplex RT-PCR for identification of VP6 subgroups of human and porcine rotaviruses

Journal of Virological Methods 168 (2010) 191–196

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Protocols

A novel multiplex RT-PCR for identification of VP6 subgroups of human and porcine rotaviruses Aksara Thongprachum a,c , Natthawan Chaimongkol a , Pattara Khamrin b , Chansom Pantip a , Masashi Mizuguchi c , Hiroshi Ushijima b , Niwat Maneekarn a,∗ a b c

Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand Aino Health Science Center, Aino University, Tokyo, Japan Department of Developmental Medical Sciences, Institute of International Health, Graduate School of Medicine, University of Tokyo, Tokyo, Japan

a b s t r a c t Article history: Received 8 March 2010 Received in revised form 12 May 2010 Accepted 13 May 2010 Available online 28 May 2010 Keywords: Human rotavirus Porcine rotavirus Subgroup Genogroup Multiplex RT-PCR Monoplex RT-PCR

VP6 protein antigens allow classification of rotaviruses into at least four subgroups, depending on the presence or absence of SG-specific epitopes: SG I, SG II, SG (I + II), and SG non-(I + II). However, MAbs against epitopes on the VP6 protein of human and porcine rotaviruses, sometimes, do not recognize SGspecific epitopes or recognize irrelevant-SG epitopes and therefore result in the incorrect assignment of subgroups. In order to solve this problem, a novel multiplex RT-PCR was developed as an alternative tool to identify VP6 genogroups using newly designed primers which are specific for genogroup I or II. The sensitivity and specificity of the newly developed multiplex RT-PCR method was evaluated by testing with human and porcine rotaviruses of known SG I, SG II, SG (I + II), and SG non-(I + II) strains in comparison with monoplex RT-PCR and VP6 sequence analysis. The results show that the genogroups of both human and porcine rotaviruses as determined by the new multiplex RT-PCR method were in 100% agreement with those determined by monoplex RT-PCR and VP6 sequence analysis. The method was shown to be specific, sensitive, less-time consuming, and successful in genogrouping clinical isolates of rotaviruses circulating in children and piglets with acute diarrhea. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Rotaviruses are the major cause of severe gastroenteritis in young children and young animals worldwide. Rotaviruses are a triple-layered particle of the Reoviridae family which are classified into groups (A–E) and subgroups (SG) according to the presence of epitopes on the middle-layered VP6 protein (Estes, 2001; Kapikian et al., 2001). Among them, group A rotavirus has been recognized as the most important group due to its highest prevalence and pathogenesis in human and various animal species (Gouvea et al., 1994; Estes, 2001). Two monoclonal antibodies (MAbs) that react specifically with subgroup I (SG I) (MAb 255/60) or subgroup II (SG II) (MAb 631/9) rotavirus strains were developed in early 1980s (Greenberg et al., 1983; Taniguchi et al., 1984) and have been used widely to characterize human and animal rotavirus strains (Kapikian and Chanock, 1996). The VP6 protein antigens allow the classification of these viruses into four subgroups: SG I, SG II, SG (I + II), and SG non-(I + II) depending on the presence or absence of SG-specific epitopes (Estes and Cohen, 1989; Hoshino et al., 1987;

∗ Corresponding author. Tel.: +66 53 945332; fax: +66 53 217144. E-mail address: [email protected] (N. Maneekarn). 0166-0934/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2010.05.013

Gorziglia et al., 1988; Iturriza-Gómara et al., 2002). Subgrouping of rotaviruses by enzyme-linked immunosorbent assays (ELISAs) using SG-specific MAbs has been used extensively for epidemiological studies (Greenberg et al., 1983; Taniguchi et al., 1984). Most human rotaviruses belong to SG II, while animal rotaviruses belong to SG I (Gorziglia et al., 1988; Ito et al., 1997; Tang et al., 1997; Thongprachum et al., 2009). The unreliability of serological methods for subgrouping rotaviruses using SG-specific MAbs is a well-recognized problem. A study of human and porcine rotavirus strains circulating in children and in piglets with acute gastroenteritis in Chiang Mai has also revealed viruses with SG I, SG II, SG (I + II), and SG non-(I + II) specificities (Thongprachum et al., 2009). It is well established that accumulation of point mutations in the VP6 gene may lead to a change of amino acid residue in the VP6 protein, particularly on the epitope regions, thus making the virus unrecognizable by corresponding SG-specific MAbs. Recently, deduced amino acid sequences of human and porcine rotavirus strains with SG (I + II) and SG non-(I + II), were analyzed in comparison with those of SG I and SG II specificities. The data revealed that some human rotavirus strains were misidentified using MAbs; for example, strains which VP6 sequence analysis identified as genogroup II were misidentified as SG I and SG non-(I + II) by SG-specific MAbs. A similar phenomenon was observed in subgrouping of porcine

192

A. Thongprachum et al. / Journal of Virological Methods 168 (2010) 191–196

rotaviruses; for instance, strains which VP6 sequence analysis identified as genogroup I were misidentified as SG II, SG (I + II), and SG non-(I + II) strains by SG-specific MAbs (Thongprachum et al., 2009). Based on these findings, it was interesting to develop a multiplex RT-PCR as an alternative method to identify genogroups of human and porcine rotaviruses. 2. Materials and methods 2.1. Clinical samples and rotavirus strains This study includes 27 strains of human rotaviruses from the stool samples of children hospitalized with acute gastroenteritis in Chiang Mai, Thailand between May 2000 and December 2002. Of these, 3 were SG I, 21 were SG II, and 3 were SG non-(I + II) rotavirus strains. Additionally, 47 strains of human rotaviruses from pediatric patients in the year 2007 were also included in this study to evaluate the RT-PCR method developed in the present study. Furthermore, 49 strains of porcine rotaviruses isolated from diarrheic piglets during the period of June 2000 to July 2003 from 6 different farms located in Chiang Mai, Thailand, were also included in this study. Among 49 strains of porcine rotaviruses, 4 were SG I, 3 were SG II, 24 were SG (I + II), and 18 were SG non-(I + II) rotavirus strains. 2.2. VP6 nucleotide sequencing The VP6 full-length PCR products of human and porcine rotaviruses were gel-purified with QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany). The purified products were sequenced in both directions using the BigDye Terminator Cycle Sequencing Reaction Kit (Applied Biosystems, Foster City, CA, USA) on an automated sequencer (ABI 3100; Applied Biosystems). The VP6-F or VP6-R was used as a sequencing primer. 2.3. Designing oligonucleotide primers for VP6 genogrouping The following reference sequences of SG I and SG II strains of human and porcine rotaviruses were used as the query sequences for blast alignment: S2 (DQ870488) and 1076 (D00325) for VP6 SG I human rotaviruses; TK159 (AY661888), RV3 (U04741), 116E (U85998), E210 (U36240), and Wa (K02086) for VP6 SG II human rotaviruses; OSU (AF317123), 4F (L29184), 4S (L29186), A131 (AF317124), A253 (AF317122), YM (X69487), and JL94 (AY538664) for VP6 SG I porcine rotaviruses; Gottfried (D00326) for VP6 SG II porcine rotavirus. In addition, the VP6 nucleotide sequences of human and porcine rotaviruses available in the GenBank database were also included in this analysis. Of these, 3 VP6 sequences of SG I human rotaviruses, 25 VP6 sequences of SG II human rotaviruses, 47 VP6 sequences of SG I porcine rotaviruses, and 2 VP6 sequences of SG II porcine rotaviruses were selected for comparative analyses. The obvious strategy for designing primers specific for SG I or SG II rotaviruses was to look for the conserved regions within known sequences of VP6 gene with SG I or SG II specificity of those rotaviruses. After these conserved sequences were determined, they were used as the primer sequences and aligned against the known sequences of each VP6 subgroup and also used as queries in blast alignments. There are a large number of software packages available to perform structurallybased alignments, some of which are linked to the World Wide Web, for example http://primer3.sourceforge.net/ or http://www. basic.northwestern.edu. The program shifted along the sequence to evaluating chunks of the specified primer length based on the following criteria: melting temperature, GC content, and interactions with self and other primers. The specificity of the primer

was checked by doing BLASTN search which revealed significant similarity to only each of the subgroup sequences. 2.4. VP6 genogrouping by monoplex and multiplex RT-PCR Viral dsRNA was extracted from 20% fecal suspension with QIAamp Viral RNA Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s protocol. Before performing reverse transcription (RT), a mixture of 10 ␮l of viral RNA extract and 1 ␮l of 50% dimethyl sulfoxide (DMSO) was heated at 95 ◦ C for 5 min to denature the dsRNA of the viral genome and then chilled immediately on ice. For RT reaction, viral RNA was transcribed reversely according to the manufacturer’s instruction (Fermentas, Vilnius, Lithuania). Briefly, the denatured RNA (10 ␮l) was added into 10 ␮l of RT mixture containing 3.9 ␮l of RNase free water, 3.0 ␮l of 5× reaction buffer (Fermentas, Vilnius, Lithuania), 0.4 ␮l of 20 ␮M each of forward and reverse primers (VP6-F and VP6-R; Table 2), 0.8 ␮l of 10 mM dNTPs mix (10 mM of each dNTPs), 0.5 ␮l of 1 U/␮l RNase inhibitor (Invitrogen, Carlsbad, CA, USA), and 1 ␮l of 200 units/␮l of RevertAidTM M-MuLV reverse transcriptase (Fermentas, Vilnius, Lithuania). The full-length of the VP6 gene was reversely transcribed at 42 ◦ C for 1 h and then heated at 70 ◦ C for 10 min to denature the RT enzyme. For monoplex RT-PCR of human rotaviruses, 2.5 ␮l of cDNA template from RT reaction was added to 22.5 ␮l of a mixture containing 17.75 ␮l of RNase free water, 2.5 ␮l of 10× PCR buffer, 0.75 ␮l of 50 mM MgCl2 (Invitrogen, Carlsbad, CA, USA), 0.5 ␮l of 10 mM dNTPs mix, 0.4 ␮l each of 20 ␮M of forward primer (VP6-F), reverse primer HG1-R (Table 2) for amplification of VP6 genogroup I or 0.4 ␮l of 20 ␮M of reverse primer HG2-R for amplification of VP6 genogroup II, and 0.2 ␮l of Taq polymerase (5 unit/␮l, Invitrogen, Carlsbad, CA, USA). Then, PCR amplification was performed under the following thermocycling conditions: 30 cycles of 94 ◦ C for 45 s, 50 ◦ C for 30 s, 72 ◦ C for 30 s, and a final extension step at 72 ◦ C for 10 min in a mastercycler (Eppendorf, Westbury, NY, USA). For multiplex RT-PCR, the VP6 gene of human rotaviruses with genogroup I or II specificity was amplified with a combination of specific primers VP6-F, HG1-R, and HG2-R (Table 2). A suitable PCR condition was as follows: 2.5 ␮l of cDNA template from RT reaction was added to 22.5 ␮l of a mixture containing 17.55 ␮l of RNase free water, 2.5 ␮l of 10× PCR buffer, 0.75 ␮l of 50 mM MgCl2 (Invitrogen, Carlsbad, CA, USA), 0.5 ␮l of 10 mM dNTPs mix, 0.4 ␮l of 20 ␮M forward primer (VP6-F), 0.2 ␮l of 20 ␮M HG1-R reverse primer, 0.4 ␮l of 20 ␮M HG2-R reverse primer (Table 2), and 0.2 ␮l of Taq polymerase (5 unit/␮l, Invitrogen, Carlsbad, CA, USA). Then, PCR amplification was performed under the following thermocycling conditions: 30 cycles of 94 ◦ C for 45 s, 50 ◦ C for 30 s, 72 ◦ C for 30 s, and a final extension step at 72 ◦ C for 10 min in a mastercycler (Eppendorf, Westbury, NY, USA). For the monoplex RT-PCR of porcine rotaviruses, the same protocol as the monoplex RT-PCR of human rotaviruses was used, except that cDNA template from RT reaction of porcine rotavirus, reverse primers PG1-R and PG2-R (Table 2) were used instead of HG1-R and HG2-R reverse primers. In addition, primer-annealing temperature of 45 ◦ C for 30 s and primer extension at 72 ◦ C for 40 s were used for VP6 genogrouping of porcine rotaviruses. For the multiplex RT-PCR, the VP6 gene of porcine rotaviruses with genogroup I or II specificity was amplified using the combination of specific primers VP6-F, PG1-R, and PG2-R (Table 2). Again, the same protocol as the multiplex RT-PCR of human rotaviruses was used, except that cDNA template from RT reaction of porcine rotavirus, PG1-R and PG2-R reverse primers (Table 2) were used instead of HG1-R and HG2-R reverse primers. Additionally, the concentration of PG1-R used in VP6 genogrouping of porcine rotavirus was twice as high (0.4 ␮l of 20 ␮M) as those of HG1-R (0.2 ␮l of 20 ␮M). Furthermore, primer-annealing temperature of 45 ◦ C for

A. Thongprachum et al. / Journal of Virological Methods 168 (2010) 191–196

193

Table 1 Human and porcine rotavirus strains with different VP6 genogroups and subgroups (Thongprachum et al., 2009). Human rotaviruses

Porcine rotaviruses a

Strain

Accession number

VP6 genogroup

VP6 subgroup

Strain

Accession number

VP6 genogroupa

VP6 subgroup

CMH171/01 CMH190/01 CMH5/00 CMH77/00 CMH8/01 CMH16/01 CMH37/01 CMH52/01 CMH101/01 CMH127/01 CMH142/01 CMH151/01 CMH187/01 CMH202/01 CMH4/02 CMH9/02 CMH38/02 CMH49/02 CMH55/02 CMH66/02 CMH71/02 CMH82/02 CMH85/02 CMH95/02 CMH150/01 CMH185/01 CMH186/01

EU372725 EU372726 EU372724 EU372727 EU372728 EU372729 EU372730 EU372731 EU372732 EU372733 EU372734 EU372735 EU372736 EU372737 EU372738 EU372739 EU372740 EU372741 EU372742 EU372743 EU372744 EU372745 EU372746 EU372747 EU372748 EU372749 EU372750

I I II II II II II II II II II II II II II II II II II II II II II II II II II

I I I II II II II II II II II II II II II II II II II II II II II II Non-(I + II) Non-(I + II) Non-(I + II)

CMP39/00 CMP25/01 CMP33/01 CMP34/01 CMP127/01 CMP52/01 CMP53/01 CMP66/01 CMP73/01 CMP16/02 CMP17/02 CMP39/02 CMP40/02 CMP54/02 CMP57/02 CMP64/02 CMP65/02 CMP67/02 CMP68/02 CMP95/02 CMP96/02 CMP104/02 CMP107/02 CMP109/02 CMP113/02 CMP3/03 CMP6/03 CMP8/03 CMP10/03 CMP34/00 CMP 12/01 CMP27/01 CMP29/01 CMP31/01 CMP46/01 CMP55/01 CMP56/01 CMP74/01 CMP82/01 CMP90/01 CMP105/01 CMP66/02 CMP83/02 CMP86/02 CMP11/03 CMP12/03 CMP16/03 CMP100/01 CMP101/01

EU372751 EU372752 EU372753 EU372754 EU372757 EU372758 EU372759 EU372760 EU372761 EU372762 EU372763 EU372764 EU372765 EU372766 EU372767 EU372768 EU372769 EU372770 EU372771 EU372772 EU372773 EU372774 EU372775 EU372776 EU372777 EU372778 EU372779 EU372780 EU372781 EU372782 EU372783 EU372784 EU372785 EU372786 EU372787 EU372788 EU372789 EU372790 EU372791 EU372792 EU372793 EU372794 EU372795 EU372796 EU372797 EU372798 EU372799 EU372755 EU372756

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II II

I I I I II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II I + II Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) Non-(I + II) II II

a The VP6 genogroups were assigned based on VP6 nucleotide sequences while the VP6 subgroups were assigned based on reactivity of rotavirus strains to monoclonal antibodies specific for SG I or SG II.

30 s and primer extension at 72 ◦ C for 40 s were used for VP6 genogrouping of porcine rotaviruses.

3. Results 3.1. Misidentification of VP6 subgroups of human and porcine rotaviruses by MAbs VP6 protein antigens allow the classification of human rotaviruses into four subgroups, depending on the presence or absence of SG-specific epitopes recognized by MAbs used in those previous studies: SG I, SG II, SG (I + II), and SG non-(I + II) (Hoshino et al., 1987; Gorziglia et al., 1988; Estes and Cohen, 1989; Urasawa et al., 1990; Iturriza-Gómara et al., 2002). We have also demonstrated previously that identifying VP6 subgroups of human and porcine rotaviruses using MAbs against SG I or SG II epitopes can sometimes result in the incorrect assignment of

VP6 subgroups (Thongprachum et al., 2009). As shown in Table 1, human rotavirus strain CMH5/00 was misidentified as SG I and CMH150/01, CMH185/01, and CMH186/01 were misidentified as SG non-(I + II) using MAbs; in fact, they all were genogroup II as identified by VP6 sequence analysis (Thongprachum et al., 2009). Similarly, porcine rotaviruses of genogroup I as identified by VP6 sequence analysis were misidentified as SG II, SG (I + II), and SG non-(I + II) using MAbs (Table 1). In the present study, these human and porcine rotavirus strains together with 47 additional strains of human rotavirus from the year 2007 were used to develop and evaluate the monoplex and multiplex RT-PCR methods in this study. 3.2. Newly developed primers for VP6 genogrouping of human and porcine rotaviruses The consensus primers, VP6-F and VP6-R, for amplification of the VP6 gene of human rotaviruses with the PCR product size of 1356 bp

194

A. Thongprachum et al. / Journal of Virological Methods 168 (2010) 191–196

Table 2 Primers for VP6 genogrouping of human and porcine rotaviruses. Specificity

Primer

Polarity

Sequence (5 –3 )a

Nucleotide position

PCR product size

References

Rotaviruses (Consensus)

VP6-F VP6-R

+ −

GGCTTTTAAACGAAGTCTTC GGTCACATCCTCTCACTA

1–20 1356–1339

1356

Shen et al. (1994) Shen et al. (1994)

Human rotavirus Genogroup I Genogroup II

HG1-R HG2-R

− −

GAAATGTAAAACCTGTTC CTACTCCATTTCTTTGAGAC

480–463 351–332

480 351

Newly designed in this study

Porcine rotavirus Genogroup I Genogroup II

PG1-R PG2-R

− −

AAGYAGTACCAAGTAATC GTGCGCGTCTAAGTTGGACAAT

232–215 676–655

232 676

Newly designed in this study

a

Abbreviation Y = C or T.

Fig. 1. Diagrammatic representation of VP6 gene, primer binding regions, and expected PCR product sizes of VP6 genogroup I- and II-specific fragments of human and porcine rotaviruses.

were described previously by Shen et al. (1994) (Table 2). The same region on the VP6 sequence of porcine rotaviruses was also conserved and identical to those of human rotaviruses. In the present study, primers VP6-F and VP6-R were therefore used for amplification of the VP6 genes of both human and porcine rotaviruses. Based on the VP6 reference sequences of human and porcine rotaviruses with SG I and SG II specificities available in the GenBank database together with the VP6 sequences of human and porcine rotaviruses determined in our laboratory, primers specific for genogroup I and genogroup II of human and porcine rotaviruses were developed. The primer sequences which were newly developed in this study and their characteristics are listed in Table 2.

3.3. Strategy for the development of monoplex and multiplex RT-PC for VP6 genogrouping The conceptual principle of the method was to use the primers specific for either genogroup I or II in the PCR reaction to generate PCR products with difference in size. The VP6 consensus primer, VP6-F, which possessed a plus polarity, was used as a forward primer in combination with the reverse primer(s) of minus polarity developed in the present study which were specific for genogroup I or II rotaviruses. For monoplex RT-PCR, either genogroup I- or II-specific primer was used in the PCR reaction together with a consensus VP6-F primer. For multiplex RT-PCR, both primers, genogroup I- and II-specific primers, were added together with a consensus VP6-F primer in the same PCR reaction mixture. Diagrammatic representation of VP6

gene, primer binding regions, and expected PCR product sizes of VP6 genogroup I- and II-specific fragments of human and porcine rotaviruses is depicted in Fig. 1.

3.4. VP6 genogrouping of human and porcine rotaviruses by monoplex and multiplex RT-PCR A total of 74 rotavirus strains from stool samples of pediatric patients were tested to determine for their VP6 genogroups by monoplex and multiplex RT-PCR. Among 74 stool samples, 27 were collected between May 2000 and December 2002, and 47 were collected between January and December 2007. Of the 27 samples from 2000 to 2002, 2 were VP6 genogroup I and 25 were VP6 genogroup II; of the 47 samples of 2007, 9 were genogroup I and 38 were genogroup II. The results generated by monoplex RT-PCR were in 100% agreement with those of the multiplex RT-PCR. For porcine rotaviruses, 49 fecal samples collected from diarrheic piglets between June 2000 and July 2003 were tested by monoplex and multiplex RT-PCR. It was found that 47 were VP6 genogroup I and 2 were VP6 genogroup II. Again, the results obtained by monoplex and multiplex RT-PCR were in 100% agreement. The agarose gel electrophoresis showing the PCR product fragments of VP6 of genogroups I and II of the representative strains of human rotaviruses and porcine rotaviruses are depicted in Figs. 2 and 3, respectively. Assignments of VP6 genogroups determined by monoplex and multiplex RT-PCR were based solely on the sizes of PCR products, 480 bp and 351 bp for human rotavirus and 232 bp and 676 bp for porcine rotavirus genogroups I and II, respectively. To confirm the

A. Thongprachum et al. / Journal of Virological Methods 168 (2010) 191–196

195

Fig. 2. Agarose gel electrophoresis demonstrating the expected PCR product sizes of VP6 fragments of genogroup I (480 bp) and genogroup II (351 bp) of human rotaviruses. (A) Monoplex RT-PCR. Lanes 2–6, primers specific for genogroup I and lanes 7–11, primers specific for genogroup II were used. (B) Multiplex RT-PCR. Lanes 2–6, primers specific for genogroups I and II were added in the same reaction.

PCR products of VP6 genogroup I- or II-specific fragments, those PCR products were sequenced and the sequences were compared to those of corresponding reference strains. The results revealed that the PCR products generated by monoplex and multiplex RT-PCR belonged to VP6 genogroups I and II as expected (data not shown). 3.5. Concordance of VP6 genogroups determined by RT-PCR and by VP6 nucleotide sequencing Although the results of VP6 genogrouping of both human and porcine rotaviruses by monoplex and multiplex RT-PCR were in 100% agreement, the gold standard for evaluating the RT-PCR method developed in the present study was a nucleotide sequencing of full-length VP gene. The full-length VP6 of 30 human rotavirus representatives and 49 strains of porcine rotaviruses were amplified and sequenced (Thongprachum et al., 2009). The VP6 genogroups were assigned based on the nucleotide sequence similarity with those of the reference strains available in the GenBank database. The results of VP6 genogroups determined by nucleotide sequence analysis were 100% in concordance with those by RT-PCR (data not shown). 4. Discussion Although MAbs have been developed and used widely to characterize rotavirus subgroups (SG) for more than two decades (Greenberg et al., 1983; Taniguchi et al., 1984), they have some inherent limitations. It is well established that accumulation of point mutations in the VP6 gene may lead to an alteration of the amino acid sequence in the VP6 protein, particularly on the epi-

topes that recognized by MAbs, resulting in nontyepable strains of rotaviruses. In fact, several studies have reported that some rotavirus strains react poorly to MAbs against VP6 subgroup antigens, some react to both SG I and SG II MAbs, and many rotavirus strains do not reactive to the MAbs which are currently available on the market. Based on characterization of VP6 protein using MAbs, rotaviruses can be divided into at least four subgroups, namely SG I, SG II, SG (I + II), and SG non-(I + II), depending on the presence or absence of specific epitopes that can be recognized by MAbs used in those studies (Gorziglia et al., 1988; Hoshino et al., 1987; Iturriza-Gómara et al., 2002). Most recently, full-length VP6 amino acid sequences of human and porcine rotaviruses with SG (I + II) and SG non-(I + II) have been analyzed in comparison with those of SG I and SG II strains (Thongprachum et al., 2009). It was found that human rotaviruses with SG non-(I + II) shared a very high degree of amino acid sequence identity (97.2–99.7%) with those of SG II. The deduced amino acid sequences of human rotavirus strains determined serologically as SG non-(I + II) were indistinguishable from those of SG II and were assigned as SG II strains. Similar findings have been observed in porcine rotaviruses. Viruses with SG (I + II) and SG non(I + II) share very high degree of amino acid sequence identity with SG I at 96.4–100% and 94.7–99.7%, respectively, and therefore were assigned as SG I strains. These findings suggest that VP6 subgrouping of rotaviruses by serological method, based on the reactivity of SG-specific MAbs with VP6 protein of the virus, is unreliable. Conceivably, there is an urgent need to develop an alternative reliable method with a different approach to identifying rotavirus genogroups.

Fig. 3. Agarose gel electrophoresis demonstrating the expected PCR product sizes of VP6 fragments of genogroup I (232 bp) and genogroup II (676 bp) of porcine rotaviruses. (A) Monoplex RT-PCR. Lanes 2–6, primers specific for genogroup I and lanes 7–11, primers specific for genogroup II were used. (B) Multiplex RT-PCR. Lanes 2–6, primers specific for genogroups I and II were added in the same reaction.

196

A. Thongprachum et al. / Journal of Virological Methods 168 (2010) 191–196

Multiplex RT-PCR has been developed and used successfully for G-genotyping (VP7) and P-genotyping (VP4) of rotaviruses (Gouvea et al., 1990; Gentsch et al., 1992). In the present study, the monoplex and multiplex RT-PCR methods for VP6 genogrouping of human and porcine rotaviruses have been developed. The primers specific for VP6 of human and of porcine rotaviruses have been newly designed and evaluated by testing with clinical isolates of rotaviruses from pediatric patients and from diarrheic piglets from 2000 to 2003 and those currently circulated in 2007 in Chiang Mai, Thailand. The primers specific for VP6 of human rotaviruses reported in the present study are different from those reported by Wang et al. (2007) and Lin et al. (2008) in several points, including primer sequences, primer binding sites, and the PCR product sizes of VP6 fragments generated by those primers. Additionally, the primers specific for the VP6 of porcine rotaviruses have also been described for the first time in the present study. One advantage of the new primers is that they possess a minus sense which can be used as a reverse primer in combination with the plus sense forward primer (VP6-F) reported previously (Shen et al., 1994), which is highly conserved among rotaviruses of both human and porcine origins. The efficacy of the multiplex RT-PCR and the specificity of the newly designed primers have been evaluated by testing with local strains of rotaviruses from humans and piglets in Chiang Mai in comparison with a gold standard method, VP6 nucleotide sequence analysis, and with monoplex RT-PCR as well. The genogroups of both human and porcine rotaviruses as determined by monoplex and multiplex RT-PCR were in 100% agreement with those determined by VP6 nucleotide sequence analysis. These findings clearly suggest that monoplex and multiplex RT-PCR assays reported in the present study are rapid and cost-effective methods to identify VP6 genogroups of human and porcine rotaviruses. Additionally, the methods are successfully subgrouping the clinical isolates of human and porcine rotaviruses circulating in Chiang Mai, Thailand, and probably in other countries as well. Acknowledgements The study received financial support from the Endowment Fund for Medical Research, the Faculty of Medicine, Chiang Mai University. Presentation of this work at the 10th International Symposium on Double-Stranded RNA viruses, 21st to 25th June 2009 at Hamilton Island, Great Barrier Reef, Australia, was also supported by Chiang Mai University. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jviromet.2010.05.013.

References Estes, M.K., 2001. Rotavirus and their replication. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Martin, M.A., Lamb, R.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, pp. 1747–1785. Estes, M.K., Cohen, J., 1989. Rotavirus gene structure and function. Microbiol. Rev. 53, 410–449. Gentsch, J.R., Glass, R.I., Woods, P., Gouvea, V., Gorziglia, M., Flores, J., Das, B.K., Bhan, M.K., 1992. Identification of group A rotavirus gene 4 types by polymerase chain reaction. J. Clin. Microbiol. 30, 1365–1373. Greenberg, H., McAuliffe, V., Valdesuso, J., 1983. Serological analysis of subgroup protein of rotavirus: using monoclonal antibodies. Infect. Immunol. 39, 91–99. Gorziglia, M., Hoshino, Y., Nishikawa, K., Maloy, W.L., Jones, R.W., Kapikian, A.Z., Chanock, R.M., 1988. Comparative sequence analysis of the genomic segment 6 of four rotaviruses each with a different subgroup specificity. J. Gen. Virol. 69, 1659–1669. Gouvea, V., Glass, R.I., Woods, P., Taniguchi, K., Clark, H.F., Forrester, B., Fang, Z.Y., 1990. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J. Clin. Microbiol. 28, 276–282. Gouvea, V., Santos, N., Timenetsky, C.M., 1994. Identification of bovine and porcine rotavirus G types by PCR. J. Cin. Microbiol. 32, 1338–1340. Hoshino, Y., Gorziglia, M., Valdesuso, J., Askaa, J., Glass, R.I., Kapikian, A.Z., 1987. An equine rotavirus (FI-14 strain) which bears both subgroup I and subgroup II specificities on its VP6. Virology 157, 488–496. Ito, H., Minamoto, N., Hiraga, S., Sugiyama, M., 1997. Sequence analysis of the VP6 gene in group A turkey and chicken rotaviruses. Virus Res. 47, 79–83. Iturriza-Gómara, M., Wong, C., Blome, S., Desselberger, U., Gray, J., 2002. Molecular characterization of VP6 genes of human rotavirus isolates: correlation of genogroups with subgroups and evidence of independent segregation. J. Virol. 76, 6596–6601. Kapikian, A.Z., Chanock, R.M., 1996. Rotavirus. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, 3rd ed. Lippincott William & Wilkins, Philadelphia, pp. 1657–1707. Kapikian, A.Z., Hoshino, Y., Chanock, R.M., 2001. Rotaviruses. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Strais, S.E. (Eds.), Fields Virology, 4th ed. Lippincott William & Wilkins, Philadelphia, pp. 1787–1833. Lin, Y.P., Kao, C.L., Chang, S.Y., Taniguchi, K., Hung, P.Y., Lin, H.C., Huang, L.M., Huang, H.H., Yang, J.Y., Lee, C.N., 2008. Determination of human rotavirus VP6 genogroups I and II by reverse transcription-PCR. J. Clin. Microbiol. 46, 3330–3337. Shen, S., Burke, B., Desselberger, U., 1994. Rearrangement of the VP6 gene of a group A rotavirus in combination with a point mutation affecting trimer stability. J. Virol. 68, 1682–1688. Tang, B., Gillbert, J.M., Matsui, S.M., Greenberg, H.B., 1997. Comparison of the rotavirus gene 6 from different species by sequence analysis and localization of subgroup-specific epitopes using site-directed muta-genesis. Virology 237, 89–96. Taniguchi, K., Urasawa, T., Urasawa, S., Yasuhara, T., 1984. Production of subgroupspecific monoclonal antibodies against human rotaviruses and their application to an enzyme-linked immunosorbent assay for subgroup determination. J. Med. Virol. 14, 115–125. Thongprachum, A., Khamrin, P., Saekhow, P., Pantip, C., Peerakome, S., Ushijima, H., Maneekarn, N., 2009. Analysis of the VP6 gene of human and porcine group A rotavirus strains with unusual subgroup specificities. J. Med. Virol. 81, 183–191. Urasawa, T., Taniguchi, K., Kobayashi, N., Wakasugi, F., Oishi, I., Minekawa, Y., Oseto, M., Ahmed, M.U., Urasawa, S., 1990. Antigenic and genetic analyses of human rotavirus with dual subgroup specificity. J. Clin. Microbiol. 28, 2837–2841. Wang, Y.H., Kobayashi, N., Zhou, D.J., Yang, Z.Q., Zhou, X., Peng, J.S., Zhu, Z.R., Zhao, D.F., Liu, M.Q., Gong, J., 2007. Molecular epidemiologic analysis of group A rotaviruses in adults and children with diarrhea in Wuhan city, China, 2000–2006. Arch. Virol. 152, 669–685.