- Email: [email protected]
A novel mutation in the PAX3 gene causes Waardenburg syndrome type I in an Iranian family
International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
A novel mutation in the PAX3 gene causes Waardenburg syndrome type I in an Iranian family Nazanin Jalilian a, Mohammad Amin Tabatabaiefar b,c, Mohammad Farhadi d, Tayyeb Bahrami a, Mohammad Reza Noori-Daloii a,* a
Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran Pediatric Inherited Diseases Research Center, Research Institute for Primordial Prevention of Non-communicable Disease, Isfahan University of Medical Sciences, Isfahan, Iran d Department and Research Center of Otolaryngology, Head and Neck Surgery, Hazrat Rasoul Akram Hospital, Iran University of Medical Sciences, Tehran, Iran b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 April 2015 Received in revised form 25 July 2015 Accepted 27 July 2015 Available online 3 August 2015
Objectives: Sensorineural hearing impairment (HI) is one of the most frequent congenital defects, with a prevalence of 1 in 500 among neonates. Although there are over 400 syndromes involving HI, most cases of HI are nonsyndromic (70%), 20% of which follow autosomal dominant mode of inheritance. Waardenburg syndrome (WS) ranks first among autosomal dominant syndromic forms of HI. WS is characterized by sensorineural hearing impairment, pigmentation abnormalities of hair and skin and hypoplastic blue eyes or heterochromia iridis. WS is subdivided into four major types, WS1–WS4. WS1 is diagnosed by the presence of dystopia canthorum and PAX3 is the only gene involved. This study aims to determine the pathogenic mutation in a large Iranian pedigree affected with WS1 in order to further confirm the clinical diagnosis. Methods: In the present study, a family segregating HI was ascertained in a genetic counseling center. Upon clinical inspection, white forelock, dystopia canthorum, broad high nasal root and synophrys, characteristic of WS1 were evident. In order to clarify the genetic etiology and confirm the clinical data, primers were designed to amplify exons and exon–intron boundaries of the responsible gene, PAX3 with 10 exons, followed by the Sanger DNA sequencing method. Results: Genetic analysis of PAX3 revealed a novel mutation in PAX3 (c.1024_1040 del AGCACGATTCCTTCCAA). Our data provide genotype–phenotype correlation for the mutation in PAX3 and WS1 in the studied family, with implications for genetic counseling, which necessitates detailed clinical inspection of HI patients to distinguish syndromic HI from the more common non-syndromic cases. Conclusion: Our results reveal the value of phenotype-directed genetic analysis and could further expand the spectrum of PAX3 mutations. ß 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Waardenburg syndrome type 1 PAX3 Novel mutation Iran
1. Introduction Hearing impairment (HI) is the most frequent sensory disorder [1], with considerable clinical and genetic heterogenity. HI can be syndromic or non-syndromic, inherited in autosomal dominant (AD), autosomal recessive (AR), X-linked or mitochondrial mode of inheritance [2]. Most cases are senseurineural non-syndromic HI
* Corresponding author at: Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Poursina Ave, 16 Azar St. Keshavarz BLVD, 1417613151 Tehran, Iran. Tel.: +98 2188953005; fax: +98 2188953005. E-mail address: [email protected] (M.R. Noori-Daloii). http://dx.doi.org/10.1016/j.ijporl.2015.07.039 0165-5876/ß 2015 Elsevier Ireland Ltd. All rights reserved.
(70%), 20% of which are autosomal dominant non-syndromic HI (ADNSHI) [2]. Waardenburg syndrome (WS) is the most frequent type of autosomal dominant syndromic HI [3]. WS presents with pigmentary disturbances of iris, hair and skin. This condition is further subdivided into four different subtypes (WS1–WS4) based on other associated phenotypes, including dystopia canthorum (DC) in WS1, DC plus upper limb abnormalities in WS3 and hirschsprung disease in WS4. WS1 can be distinguished from WS2 by the presence of DC. However, WS2 patients do not show DC [3,4]. WS type 1 (WS1) and 2 (WS2) are the most common subtypes of the syndrome [5–7]. This syndrome is clinically and genetically heterogeneous and to date, six different genes have been characterized for different subtypes. WS1 is
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
1737
Table 1 PAX3 primers (adapted from Hazen et al.). Exon
Forward primer
Reverse primer
Product length
1 2 3 4 5 6 7 8 9&10
GATGGGAAGAGAAAGTGGTC CCGATGTCGAGCAGTTTCAG TGGGATGTGTTCTGGTCTG AGCCTCCGTCTTTCAGTAC TACGGATTGGTTAGACTTGT TTACTCCTGACAATTCGCCC TGTGCAGAGATAGGTGTGAC TCTCCTGGACAGCTCTTTAA GGTCAGCTCCAGGATCATAT
TGCAGAAAGGAAATCGAGTA CGCACCTTCACAAACCTCAG ACCTCCCAATAGCTGAGATC CGTCAGATCACCAATGTCAG AACAATATGCATCCCTAGTAA GATAGGTACGTTCAGGACAAC TTTGATGAAGCCAGTAGGA GGCATGTGTGGCTTAATCT GCAAATGGAATGTTCTAGCT
788 bp 503 bp 423 bp 450 500 469 586 480 568
caused by heterozygote mutations within the PAX3 gene. To date, more than 100 PAX3 mutations have been recorded (http://www. hgmd.cf.ac.uk/ac/all.php). Here we report a large Iranian WS1 pedigree, ascertained through genetic counseling and thorough clinical evaluations. Molecular investigations showed a novel mutation in the PAX3 transactivation domain. This family showed complete penetrance with extreme phenotype heterogeneity within the family. 2. Materials and methods
(http://www.hgvs.org/). The possible pathogenic effect of the novel variant was checked by the mutation taster. The tertiary structure of normal and mutant protein was predicted using I-TASSER server [9–11]. I-TASSER is a uniform suite for protein structure and function prediction. Exon length, total number of variants and number of pathogenic variants were all obtained using ensemble genome browser and Human Genome Mutaion Database (HGMD). For each exon, density was calculated by dividing the number of variants (total/pathogenic) into exon length.
2.1. Subjects 4. Results The family was ascertained from the center for genetic counseling, Welfare and Rehabilitation organization, Ardebil, Iran. A comprehensive clinical history was taken and audiological, ophthalmological and dermatological examinations were performed. After obtaining informed consent, peripheral blood sample was collected in 0.5 mM EDTA containing tubes. This work was approved by the ethics committee of Tehran University of Medical Sciences. 2.2. Molecular analysis Genomic DNA was extracted from peripheral venous blood using a standard salting out method. Concentration and purity of DNA were measured by Nanodrop (1000-Thermo Scientific) and 50 ng of the genomic DNA was used as template in PCR reactions. The primers to amplify all exons and exon–intron boundaries of PAX3 were adapted from Hazan et al. [8] and are shown in Table 1. PCR conditions are available upon request. The PCR products were then loaded on a 1.5% agarose gel and run for 30 min at 110 V. After DNA staining (GelRed, Biotium) for 20 min, the gels were visualized by a UV light transilluminator (SYNGene, UK). Subsequently, all PCR products were sequenced bidirectionally using ABI3130 automated sequencer (Macrogen-Korea) and analyzed using chromas version 2. The sequence data were compared to RefSeq NM-181457.3. One affected member per family was studied for possible mutations within the PAX3 gene and upon finding a variant, segregation analysis was performed for mutations in the whole family. Fifty healthy controls of the same ethnicity were screened along with the patients using polyacrylamide gel electrophoresis (PAGE). 3. In silico analysis A comprehensive study was performed for the variant. Ensemble.org, dbSNP (http://www.ncbi.hlm.nih.gov/snp) and 1000 genome databases (http://browser.1000genome.org) were investigated. Sequence variant numbering was based on the transcript ENST00000392069 for PAX3. This variant was named according to the guidelines of the human variation society
The Proband III-1 was referred for pre-marital genetic counseling, as she was concerned about the risk of HI in her future children. She had pre-lingual bilateral profound HI with dystopia canthorum, broad nasal root and also synophrys. No iris discoloration or hair hypopigmentation was evident. Careful examinations of skin also showed skin depigmentation. Her father (II:4) had severe HI, DC, heterochromia iridis, hypoplastic blue eyes and synophrys and her younger sister (III:2) had HI, hypoplastic blue eyes, DC and hair hypopigmentation. II:4 and III:2 also showed white depigmented skin patches. HI in the pedigree showed a possible AD mode of inheritance with incomplete penetrance (Fig. 1). Clinical examination of the other two HI members (II:2 and III:7) also revealed the presence of DC, hypoplastic blue eyes, hair hypopigmentation and other minor features of WS. However, the extent and severity of features were variable among the family members. The mean W-index of the affected members equals to 2.53. Thus, diagnosis of WS1 was confirmed and further investigations revealed three generations of WS1 in the pedigree with seven affected members. The pedigree together with detailed clinical features of each member is depicted in Fig. 1. All affected members of pedigree IR-WS-20 carried the mutation c.1024_1040 del AGCACGATTCCTTCCAA in exon 7 of PAX3, while none of the unaffected members and 50 of the ethnicmatched controls tested had this deletion. This 17 base pair deletion results in p.Ser342Profs*62 at the protein level. This variant affects the transactivation domain of the protein. Among the five top models predicted by I-TASSER, the model with the highest C-score was selected for normal and mutant proteins, 0.42 and 0.78, respectively (Fig. 2). The C-score is the estimated global accuracy of the model. C-score > 1.5 indicates a model of correct global topology. Density of pathogenic mutations and also total variants are summarized in Fig. 3. Exons 2, 6 and 5 have the highest density of pathogenic mutations. In the matter of total variants, exons 2, 4 and 6 are among the most mutable regions. In addition, distribution of PAX3 mutations in WS, based on mutation type, is depicted in Fig. 4. Among different mutation types, missense mutations rank first and small deletions and nonsense rank 2nd and 3rd, respectively.
1738
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
Fig. 1. Pedigree of family IR-WS-20. Squares indicate men and circles indicate women. Gray filled represent the presence of features including: broad nasal root, dystopia canthorum and synophrys and black filled quadrants indicate other associated features; upper left: hearing impairment, lower left: skin depigmentation, upper right: pigmentary disturbances of the iris and lower right: hair hypopigmentation.
5. Discussion Hearing impairment (HI) has always been a big challenge in genetic counseling due to the fact that the condition is extremely heterogeneous, both clinically and genetically. Defining the genetic determinant, mode of inheritance and the syndromic/nonsyndromic status are necessary in order to provide an accurate risk estimation [12]. Thus, a detailed family history, in addition to a thorough clinical inspection is mandatory. Accordingly, here we report a WS1 family in a proband with HI and basal expression of WS. The molecular investigations also revealed a pathogenic mutation; hence, this patient has a 50% chance of delivering an affected child.
However, WS1 is thought to have complete penetrance, considering at least one sign [13]; each feature is not completely penetrant and there is obvious variable expression, even among affected members of a family. This clinical heterogeneity within a family has been observed in different reports of different ethnicities. For example, Wildhardt et al. reported an affected girl with PAX3 mutation and DC, synophrys, high nasal bridge, skin depigmentation and bilateral HI, while the maternal grandfather and mother only show early graying [8,14,15]. Pedigree IR-WS-20 represents as a good example of the phenotypic heterogeneity within a family among WS1 cases. In this pedigree, a spectrum of disease symptoms is observed. At one extreme are patients minimally affected and only presenting the basic features (DC,
Fig. 2. Tertiary structure and normal PAX3 and the mutatnt PAX3 found in this study, predicted with I-TASSER.
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
Fig. 3. The graph representing density of pathogenic mutations and total variants of PAX3.
broad high nasal root, and synophrys) while on the other side are patients with the full manifestation (II2, II4 and III7). It is interesting to note that these two extremes in the phenotypic presentation of the same PAX3 mutation form a parent/child relationship, or on the other word, cases minimally affected may give birth to severely affected children. This issue is significant in genetic counseling and risk determination for such pedigrees. PAX3 which belongs to a family of paired-containing proteins is comprised of a homeodomain, a paired domain, an octa peptide and a transactivation (TA) domain [16]. Homeodomain and paired domain are DNA binding domains while octa peptide mediates protein-protein interactions. The Ser/Pro/Thr rich transactivation domain is located at the C-terminus of PAX3. Cao et al. demonstrated that Pax3 TA domain exhibits a central role in regulating the activity of the homeodomain [17]. The mutation found in this study generates a frameshift within the TA domain, hence the resulting PAX3 has disrupted shortened TA domain which might be incompatible with its normal function. In addition, as depicted by comparison of protein tertiary structure of normal and mutant PAX3, this mutation has exerted changes on protein tertiary structure level; which may affect protein function. The mutation we found here fits in the category of small deletions, deleting 17 bp of exon 7. Small deletions are the second most common type of PAX3 mutations reported so far (Fig. 4) and they range in size from 1 to 18 bp deletion, while only a minority of them are in-frame and about one-third of which are longer than 10 bps (www.hgmd.cf.ac.uk/ac/all.php). The variant p.Ser342Profs*62 is located in exon 7. To date, only three WS related mutations have been reported in this exon [13,18,19], and this is the fourth report. About 95% of PAX3 mutations found so far are scattered within exons 2–6, which code for the paired domain and the homeodomain of the protein [13].
Fig. 4. The graph representing distribution of PAX3 mutations in WS, based on mutation type.
1739
As documented in Fig. 3, the density of mutations is highest in exons 2, 6 and 5, respectively, while exon 1, with only one mutation, is the least mutable region. No mutation has been reported in exons 9 and 10. However, Pingault et al. proposed this observation as possible bias of ascertainment since several studies have only considered screening of exons 2–6 [13]. Thus, screening of PAX3 exons can be prioritized in genetic testing, however, since nearly all exons are found to have WSrelated mutations, all exons and intron–exon boundaries must be checked at the final stage when exons of higher priority are not found to harbor mutations. In addition, since deletions/duplications of PAX3 have also been reported [20], and as depicted in Fig. 3, gross deletions make up 11% of PAX3 mutations, upon encountering a WS1 case with no mutations, copy number analysis of PAX3 should be considered. The presented pedigree in this study demonstrates the importance of phenotype directed molecular analysis. Large pedigrees, with multiple affected members, are useful aids in clarifying different aspects of genetic disorders helping with gene discovery, genotype–phenotype correlations and identification of modifier genes. This relatively large pedigree can be further analyzed to find possible modifier genes involved in WS. Conflict of interest None. Acknowledgment We would like to express our gratitude to all participants of this study. This research was supported by Tehran University of Medical Sciences (grant number: 21446). References [1] C.C. Morton, W.E. Nance, Newborn hearing screening – a silent revolution, N. Engl. J. Med. 354 (20) (2006) 2151–2164. [2] R.J.H. Smith, A.E. Shearer, M.S. Hildebrand, G. Van Camp, Deafness and Hereditary Hearing Loss Overview, in: R.A. Pagon, H.H. Ardinger, et al. (Eds.), GeneReviews1 [Internet], University of Washington, Seattle, WA, 1999, [Updated 2014 Jan 9]. [3] A.P. Read, V.E. Newton, Waardenburg syndrome, J. Med. Genet. 34 (8) (1997) 656–665. [4] E. Pardono, Y. van Bever, J. van den Ende, P.C. Havrenne, P. Iughetti, S.R. Maestrelli, et al.,A. Richieri-Costa, P.A. Otto, Waardenburg syndrome: clinical differentiation between types I and II, Am. J. Med. Genet. A 117A (3) (2003) 223–235. [5] F. Silan, C. Zafer, I. Onder, Waardenburg syndrome in the Turkish deaf population, Genet. Couns. 17 (1) (2006) 41–48. [6] M.L. Tamayo, N. Gelvez, M. Rodriguez, S. Florez, C. Varon, D. Medina, et al., Screening program for Waardenburg syndrome in Colombia: clinical definition and phenotypic variability, Am. J. Med. Genet. A 146A (8) (2008) 1026–1031. [7] A. Zaman, R. Capper, W. Baddoo, Waardenburg syndrome: more common than you think! Clin. Otolaryngol. 40 (1) (2015) 44–48. [8] F. Hazan, A.T. Ozturk, H. Adibelli, N. Unal, A. Tukun, A novel missense mutation of the paired box 3 gene in a Turkish family with Waardenburg syndrome type 1, Mol. Vis. 19 (2013) 196–202. [9] A. Roy, A. Kucukural, Y. Zhang, I-TASSER: a unified platform for automated protein structure and function prediction, Nat. Protoc. 5 (4) (2010) 725–738. [10] J. Yang, R. Yan, A. Roy, D. Xu, J. Poisson, Y. Zhang, The I-TASSER Suite: protein structure and function prediction, Nat. Methods 12 (1) (2015) 7–8. [11] Y. Zhang, I-TASSER server for protein 3D structure prediction, BMC Bioinf. 9 (2008) 40. [12] N. Hilgert, R.J. Smith, G. Van Camp, Forty-six genes causing nonsyndromic hearing impairment: which ones should be analyzed in DNA diagnostics? Mutat. Res. 681 (2–3) (2009) 189–196. [13] V. Pingault, D. Ente, F. Dastot-Le Moal, M. Goossens, S. Marlin, N. Bondurand, Review and update of mutations causing Waardenburg syndrome, Hum. Mutat. 31 (4) (2010) 391–406. [14] G. Wildhardt, B. Zirn, L.M. Graul-Neumann, J. Wechtenbruch, M. Suckfull, A. Buske, et al.,C. Kubisch, G. Strobl-Wildemann, O. Bartsch, Spectrum of novel mutations found in Waardenburg syndrome types 1 and 2: implications for molecular genetic diagnostics, BMJ Open 3 (3) (2013). [15] J. Wang, S. Li, X. Xiao, P. Wang, X. Guo, Q. Zhang, PAX3 mutations and clinical characteristics in Chinese patients with Waardenburg syndrome type 1, Mol. Vis. 16 (2010) 1146–1153.
1740
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
[16] A.K. Lalwani, J.R. Brister, J. Fex, K.M. Grundfast, B. Ploplis, T.B. San Agustin, et al., Further elucidation of the genomic structure of PAX3, and identification of two different point mutations within the PAX3 homeobox that cause Waardenburg syndrome type 1 in two families, Am. J. Hum. Genet. 56 (1) (1995) 75–83. [17] Y. Cao, C. Wang, The COOH-terminal transactivation domain plays a key role in regulating the in vitro and in vivo function of Pax3 homeodomain, J. Biol. Chem. 275 (13) (2000) 9854–9862.
[18] C.T. Baldwin, C.F. Hoth, R.A. Macina, A. Milunsky, Mutations in PAX3 that cause Waardenburg syndrome type I: ten new mutations and review of the literature, Am. J. Med. Genet. 58 (2) (1995) 115–122. [19] M.L. Carey, T.B. Friedman, J.H. Asher Jr., J.W. Innis, Septo-optic dysplasia and WS1 in the proband of a WS1 family segregating for a novel mutation in PAX3 exon 7, J. Med. Genet. 35 (3) (1998) 248–250. [20] J.M. Milunsky, T.A. Maher, M. Ito, A. Milunsky, The value of MLPA in Waardenburg syndrome, Genet. Test 11 (2) (2007) 179–182.
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
A novel mutation in the PAX3 gene causes Waardenburg syndrome type I in an Iranian family Nazanin Jalilian a, Mohammad Amin Tabatabaiefar b,c, Mohammad Farhadi d, Tayyeb Bahrami a, Mohammad Reza Noori-Daloii a,* a
Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran Pediatric Inherited Diseases Research Center, Research Institute for Primordial Prevention of Non-communicable Disease, Isfahan University of Medical Sciences, Isfahan, Iran d Department and Research Center of Otolaryngology, Head and Neck Surgery, Hazrat Rasoul Akram Hospital, Iran University of Medical Sciences, Tehran, Iran b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 April 2015 Received in revised form 25 July 2015 Accepted 27 July 2015 Available online 3 August 2015
Objectives: Sensorineural hearing impairment (HI) is one of the most frequent congenital defects, with a prevalence of 1 in 500 among neonates. Although there are over 400 syndromes involving HI, most cases of HI are nonsyndromic (70%), 20% of which follow autosomal dominant mode of inheritance. Waardenburg syndrome (WS) ranks first among autosomal dominant syndromic forms of HI. WS is characterized by sensorineural hearing impairment, pigmentation abnormalities of hair and skin and hypoplastic blue eyes or heterochromia iridis. WS is subdivided into four major types, WS1–WS4. WS1 is diagnosed by the presence of dystopia canthorum and PAX3 is the only gene involved. This study aims to determine the pathogenic mutation in a large Iranian pedigree affected with WS1 in order to further confirm the clinical diagnosis. Methods: In the present study, a family segregating HI was ascertained in a genetic counseling center. Upon clinical inspection, white forelock, dystopia canthorum, broad high nasal root and synophrys, characteristic of WS1 were evident. In order to clarify the genetic etiology and confirm the clinical data, primers were designed to amplify exons and exon–intron boundaries of the responsible gene, PAX3 with 10 exons, followed by the Sanger DNA sequencing method. Results: Genetic analysis of PAX3 revealed a novel mutation in PAX3 (c.1024_1040 del AGCACGATTCCTTCCAA). Our data provide genotype–phenotype correlation for the mutation in PAX3 and WS1 in the studied family, with implications for genetic counseling, which necessitates detailed clinical inspection of HI patients to distinguish syndromic HI from the more common non-syndromic cases. Conclusion: Our results reveal the value of phenotype-directed genetic analysis and could further expand the spectrum of PAX3 mutations. ß 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Waardenburg syndrome type 1 PAX3 Novel mutation Iran
1. Introduction Hearing impairment (HI) is the most frequent sensory disorder [1], with considerable clinical and genetic heterogenity. HI can be syndromic or non-syndromic, inherited in autosomal dominant (AD), autosomal recessive (AR), X-linked or mitochondrial mode of inheritance [2]. Most cases are senseurineural non-syndromic HI
* Corresponding author at: Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Poursina Ave, 16 Azar St. Keshavarz BLVD, 1417613151 Tehran, Iran. Tel.: +98 2188953005; fax: +98 2188953005. E-mail address: [email protected] (M.R. Noori-Daloii). http://dx.doi.org/10.1016/j.ijporl.2015.07.039 0165-5876/ß 2015 Elsevier Ireland Ltd. All rights reserved.
(70%), 20% of which are autosomal dominant non-syndromic HI (ADNSHI) [2]. Waardenburg syndrome (WS) is the most frequent type of autosomal dominant syndromic HI [3]. WS presents with pigmentary disturbances of iris, hair and skin. This condition is further subdivided into four different subtypes (WS1–WS4) based on other associated phenotypes, including dystopia canthorum (DC) in WS1, DC plus upper limb abnormalities in WS3 and hirschsprung disease in WS4. WS1 can be distinguished from WS2 by the presence of DC. However, WS2 patients do not show DC [3,4]. WS type 1 (WS1) and 2 (WS2) are the most common subtypes of the syndrome [5–7]. This syndrome is clinically and genetically heterogeneous and to date, six different genes have been characterized for different subtypes. WS1 is
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
1737
Table 1 PAX3 primers (adapted from Hazen et al.). Exon
Forward primer
Reverse primer
Product length
1 2 3 4 5 6 7 8 9&10
GATGGGAAGAGAAAGTGGTC CCGATGTCGAGCAGTTTCAG TGGGATGTGTTCTGGTCTG AGCCTCCGTCTTTCAGTAC TACGGATTGGTTAGACTTGT TTACTCCTGACAATTCGCCC TGTGCAGAGATAGGTGTGAC TCTCCTGGACAGCTCTTTAA GGTCAGCTCCAGGATCATAT
TGCAGAAAGGAAATCGAGTA CGCACCTTCACAAACCTCAG ACCTCCCAATAGCTGAGATC CGTCAGATCACCAATGTCAG AACAATATGCATCCCTAGTAA GATAGGTACGTTCAGGACAAC TTTGATGAAGCCAGTAGGA GGCATGTGTGGCTTAATCT GCAAATGGAATGTTCTAGCT
788 bp 503 bp 423 bp 450 500 469 586 480 568
caused by heterozygote mutations within the PAX3 gene. To date, more than 100 PAX3 mutations have been recorded (http://www. hgmd.cf.ac.uk/ac/all.php). Here we report a large Iranian WS1 pedigree, ascertained through genetic counseling and thorough clinical evaluations. Molecular investigations showed a novel mutation in the PAX3 transactivation domain. This family showed complete penetrance with extreme phenotype heterogeneity within the family. 2. Materials and methods
(http://www.hgvs.org/). The possible pathogenic effect of the novel variant was checked by the mutation taster. The tertiary structure of normal and mutant protein was predicted using I-TASSER server [9–11]. I-TASSER is a uniform suite for protein structure and function prediction. Exon length, total number of variants and number of pathogenic variants were all obtained using ensemble genome browser and Human Genome Mutaion Database (HGMD). For each exon, density was calculated by dividing the number of variants (total/pathogenic) into exon length.
2.1. Subjects 4. Results The family was ascertained from the center for genetic counseling, Welfare and Rehabilitation organization, Ardebil, Iran. A comprehensive clinical history was taken and audiological, ophthalmological and dermatological examinations were performed. After obtaining informed consent, peripheral blood sample was collected in 0.5 mM EDTA containing tubes. This work was approved by the ethics committee of Tehran University of Medical Sciences. 2.2. Molecular analysis Genomic DNA was extracted from peripheral venous blood using a standard salting out method. Concentration and purity of DNA were measured by Nanodrop (1000-Thermo Scientific) and 50 ng of the genomic DNA was used as template in PCR reactions. The primers to amplify all exons and exon–intron boundaries of PAX3 were adapted from Hazan et al. [8] and are shown in Table 1. PCR conditions are available upon request. The PCR products were then loaded on a 1.5% agarose gel and run for 30 min at 110 V. After DNA staining (GelRed, Biotium) for 20 min, the gels were visualized by a UV light transilluminator (SYNGene, UK). Subsequently, all PCR products were sequenced bidirectionally using ABI3130 automated sequencer (Macrogen-Korea) and analyzed using chromas version 2. The sequence data were compared to RefSeq NM-181457.3. One affected member per family was studied for possible mutations within the PAX3 gene and upon finding a variant, segregation analysis was performed for mutations in the whole family. Fifty healthy controls of the same ethnicity were screened along with the patients using polyacrylamide gel electrophoresis (PAGE). 3. In silico analysis A comprehensive study was performed for the variant. Ensemble.org, dbSNP (http://www.ncbi.hlm.nih.gov/snp) and 1000 genome databases (http://browser.1000genome.org) were investigated. Sequence variant numbering was based on the transcript ENST00000392069 for PAX3. This variant was named according to the guidelines of the human variation society
The Proband III-1 was referred for pre-marital genetic counseling, as she was concerned about the risk of HI in her future children. She had pre-lingual bilateral profound HI with dystopia canthorum, broad nasal root and also synophrys. No iris discoloration or hair hypopigmentation was evident. Careful examinations of skin also showed skin depigmentation. Her father (II:4) had severe HI, DC, heterochromia iridis, hypoplastic blue eyes and synophrys and her younger sister (III:2) had HI, hypoplastic blue eyes, DC and hair hypopigmentation. II:4 and III:2 also showed white depigmented skin patches. HI in the pedigree showed a possible AD mode of inheritance with incomplete penetrance (Fig. 1). Clinical examination of the other two HI members (II:2 and III:7) also revealed the presence of DC, hypoplastic blue eyes, hair hypopigmentation and other minor features of WS. However, the extent and severity of features were variable among the family members. The mean W-index of the affected members equals to 2.53. Thus, diagnosis of WS1 was confirmed and further investigations revealed three generations of WS1 in the pedigree with seven affected members. The pedigree together with detailed clinical features of each member is depicted in Fig. 1. All affected members of pedigree IR-WS-20 carried the mutation c.1024_1040 del AGCACGATTCCTTCCAA in exon 7 of PAX3, while none of the unaffected members and 50 of the ethnicmatched controls tested had this deletion. This 17 base pair deletion results in p.Ser342Profs*62 at the protein level. This variant affects the transactivation domain of the protein. Among the five top models predicted by I-TASSER, the model with the highest C-score was selected for normal and mutant proteins, 0.42 and 0.78, respectively (Fig. 2). The C-score is the estimated global accuracy of the model. C-score > 1.5 indicates a model of correct global topology. Density of pathogenic mutations and also total variants are summarized in Fig. 3. Exons 2, 6 and 5 have the highest density of pathogenic mutations. In the matter of total variants, exons 2, 4 and 6 are among the most mutable regions. In addition, distribution of PAX3 mutations in WS, based on mutation type, is depicted in Fig. 4. Among different mutation types, missense mutations rank first and small deletions and nonsense rank 2nd and 3rd, respectively.
1738
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
Fig. 1. Pedigree of family IR-WS-20. Squares indicate men and circles indicate women. Gray filled represent the presence of features including: broad nasal root, dystopia canthorum and synophrys and black filled quadrants indicate other associated features; upper left: hearing impairment, lower left: skin depigmentation, upper right: pigmentary disturbances of the iris and lower right: hair hypopigmentation.
5. Discussion Hearing impairment (HI) has always been a big challenge in genetic counseling due to the fact that the condition is extremely heterogeneous, both clinically and genetically. Defining the genetic determinant, mode of inheritance and the syndromic/nonsyndromic status are necessary in order to provide an accurate risk estimation [12]. Thus, a detailed family history, in addition to a thorough clinical inspection is mandatory. Accordingly, here we report a WS1 family in a proband with HI and basal expression of WS. The molecular investigations also revealed a pathogenic mutation; hence, this patient has a 50% chance of delivering an affected child.
However, WS1 is thought to have complete penetrance, considering at least one sign [13]; each feature is not completely penetrant and there is obvious variable expression, even among affected members of a family. This clinical heterogeneity within a family has been observed in different reports of different ethnicities. For example, Wildhardt et al. reported an affected girl with PAX3 mutation and DC, synophrys, high nasal bridge, skin depigmentation and bilateral HI, while the maternal grandfather and mother only show early graying [8,14,15]. Pedigree IR-WS-20 represents as a good example of the phenotypic heterogeneity within a family among WS1 cases. In this pedigree, a spectrum of disease symptoms is observed. At one extreme are patients minimally affected and only presenting the basic features (DC,
Fig. 2. Tertiary structure and normal PAX3 and the mutatnt PAX3 found in this study, predicted with I-TASSER.
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
Fig. 3. The graph representing density of pathogenic mutations and total variants of PAX3.
broad high nasal root, and synophrys) while on the other side are patients with the full manifestation (II2, II4 and III7). It is interesting to note that these two extremes in the phenotypic presentation of the same PAX3 mutation form a parent/child relationship, or on the other word, cases minimally affected may give birth to severely affected children. This issue is significant in genetic counseling and risk determination for such pedigrees. PAX3 which belongs to a family of paired-containing proteins is comprised of a homeodomain, a paired domain, an octa peptide and a transactivation (TA) domain [16]. Homeodomain and paired domain are DNA binding domains while octa peptide mediates protein-protein interactions. The Ser/Pro/Thr rich transactivation domain is located at the C-terminus of PAX3. Cao et al. demonstrated that Pax3 TA domain exhibits a central role in regulating the activity of the homeodomain [17]. The mutation found in this study generates a frameshift within the TA domain, hence the resulting PAX3 has disrupted shortened TA domain which might be incompatible with its normal function. In addition, as depicted by comparison of protein tertiary structure of normal and mutant PAX3, this mutation has exerted changes on protein tertiary structure level; which may affect protein function. The mutation we found here fits in the category of small deletions, deleting 17 bp of exon 7. Small deletions are the second most common type of PAX3 mutations reported so far (Fig. 4) and they range in size from 1 to 18 bp deletion, while only a minority of them are in-frame and about one-third of which are longer than 10 bps (www.hgmd.cf.ac.uk/ac/all.php). The variant p.Ser342Profs*62 is located in exon 7. To date, only three WS related mutations have been reported in this exon [13,18,19], and this is the fourth report. About 95% of PAX3 mutations found so far are scattered within exons 2–6, which code for the paired domain and the homeodomain of the protein [13].
Fig. 4. The graph representing distribution of PAX3 mutations in WS, based on mutation type.
1739
As documented in Fig. 3, the density of mutations is highest in exons 2, 6 and 5, respectively, while exon 1, with only one mutation, is the least mutable region. No mutation has been reported in exons 9 and 10. However, Pingault et al. proposed this observation as possible bias of ascertainment since several studies have only considered screening of exons 2–6 [13]. Thus, screening of PAX3 exons can be prioritized in genetic testing, however, since nearly all exons are found to have WSrelated mutations, all exons and intron–exon boundaries must be checked at the final stage when exons of higher priority are not found to harbor mutations. In addition, since deletions/duplications of PAX3 have also been reported [20], and as depicted in Fig. 3, gross deletions make up 11% of PAX3 mutations, upon encountering a WS1 case with no mutations, copy number analysis of PAX3 should be considered. The presented pedigree in this study demonstrates the importance of phenotype directed molecular analysis. Large pedigrees, with multiple affected members, are useful aids in clarifying different aspects of genetic disorders helping with gene discovery, genotype–phenotype correlations and identification of modifier genes. This relatively large pedigree can be further analyzed to find possible modifier genes involved in WS. Conflict of interest None. Acknowledgment We would like to express our gratitude to all participants of this study. This research was supported by Tehran University of Medical Sciences (grant number: 21446). References [1] C.C. Morton, W.E. Nance, Newborn hearing screening – a silent revolution, N. Engl. J. Med. 354 (20) (2006) 2151–2164. [2] R.J.H. Smith, A.E. Shearer, M.S. Hildebrand, G. Van Camp, Deafness and Hereditary Hearing Loss Overview, in: R.A. Pagon, H.H. Ardinger, et al. (Eds.), GeneReviews1 [Internet], University of Washington, Seattle, WA, 1999, [Updated 2014 Jan 9]. [3] A.P. Read, V.E. Newton, Waardenburg syndrome, J. Med. Genet. 34 (8) (1997) 656–665. [4] E. Pardono, Y. van Bever, J. van den Ende, P.C. Havrenne, P. Iughetti, S.R. Maestrelli, et al.,A. Richieri-Costa, P.A. Otto, Waardenburg syndrome: clinical differentiation between types I and II, Am. J. Med. Genet. A 117A (3) (2003) 223–235. [5] F. Silan, C. Zafer, I. Onder, Waardenburg syndrome in the Turkish deaf population, Genet. Couns. 17 (1) (2006) 41–48. [6] M.L. Tamayo, N. Gelvez, M. Rodriguez, S. Florez, C. Varon, D. Medina, et al., Screening program for Waardenburg syndrome in Colombia: clinical definition and phenotypic variability, Am. J. Med. Genet. A 146A (8) (2008) 1026–1031. [7] A. Zaman, R. Capper, W. Baddoo, Waardenburg syndrome: more common than you think! Clin. Otolaryngol. 40 (1) (2015) 44–48. [8] F. Hazan, A.T. Ozturk, H. Adibelli, N. Unal, A. Tukun, A novel missense mutation of the paired box 3 gene in a Turkish family with Waardenburg syndrome type 1, Mol. Vis. 19 (2013) 196–202. [9] A. Roy, A. Kucukural, Y. Zhang, I-TASSER: a unified platform for automated protein structure and function prediction, Nat. Protoc. 5 (4) (2010) 725–738. [10] J. Yang, R. Yan, A. Roy, D. Xu, J. Poisson, Y. Zhang, The I-TASSER Suite: protein structure and function prediction, Nat. Methods 12 (1) (2015) 7–8. [11] Y. Zhang, I-TASSER server for protein 3D structure prediction, BMC Bioinf. 9 (2008) 40. [12] N. Hilgert, R.J. Smith, G. Van Camp, Forty-six genes causing nonsyndromic hearing impairment: which ones should be analyzed in DNA diagnostics? Mutat. Res. 681 (2–3) (2009) 189–196. [13] V. Pingault, D. Ente, F. Dastot-Le Moal, M. Goossens, S. Marlin, N. Bondurand, Review and update of mutations causing Waardenburg syndrome, Hum. Mutat. 31 (4) (2010) 391–406. [14] G. Wildhardt, B. Zirn, L.M. Graul-Neumann, J. Wechtenbruch, M. Suckfull, A. Buske, et al.,C. Kubisch, G. Strobl-Wildemann, O. Bartsch, Spectrum of novel mutations found in Waardenburg syndrome types 1 and 2: implications for molecular genetic diagnostics, BMJ Open 3 (3) (2013). [15] J. Wang, S. Li, X. Xiao, P. Wang, X. Guo, Q. Zhang, PAX3 mutations and clinical characteristics in Chinese patients with Waardenburg syndrome type 1, Mol. Vis. 16 (2010) 1146–1153.
1740
N. Jalilian et al. / International Journal of Pediatric Otorhinolaryngology 79 (2015) 1736–1740
[16] A.K. Lalwani, J.R. Brister, J. Fex, K.M. Grundfast, B. Ploplis, T.B. San Agustin, et al., Further elucidation of the genomic structure of PAX3, and identification of two different point mutations within the PAX3 homeobox that cause Waardenburg syndrome type 1 in two families, Am. J. Hum. Genet. 56 (1) (1995) 75–83. [17] Y. Cao, C. Wang, The COOH-terminal transactivation domain plays a key role in regulating the in vitro and in vivo function of Pax3 homeodomain, J. Biol. Chem. 275 (13) (2000) 9854–9862.
[18] C.T. Baldwin, C.F. Hoth, R.A. Macina, A. Milunsky, Mutations in PAX3 that cause Waardenburg syndrome type I: ten new mutations and review of the literature, Am. J. Med. Genet. 58 (2) (1995) 115–122. [19] M.L. Carey, T.B. Friedman, J.H. Asher Jr., J.W. Innis, Septo-optic dysplasia and WS1 in the proband of a WS1 family segregating for a novel mutation in PAX3 exon 7, J. Med. Genet. 35 (3) (1998) 248–250. [20] J.M. Milunsky, T.A. Maher, M. Ito, A. Milunsky, The value of MLPA in Waardenburg syndrome, Genet. Test 11 (2) (2007) 179–182.