A novel one-step method for targeted multiplication of DNA fragments from the Escherichia coli chromosome mediated by coordinated functioning of λ and φ80 bacteriophage recombination systems

Journal Pre-proof A novel one-step method for targeted multiplication of DNA fragments from the Escherichia coli chromosome mediated by coordinated functioning of λ and φ80 bacteriophage recombination systems

O. Igonina, V. Samsonov, A. Ublinskaya, Hook Ch, E. Malykh, E. Kozaeva, E. Sycheva, N. Stoynova PII:

S0167-7012(19)31147-9

DOI:

https://doi.org/10.1016/j.mimet.2020.105842

Reference:

MIMET 105842

To appear in:

Journal of Microbiological Methods

Received date:

18 December 2019

Revised date:

14 January 2020

Accepted date:

15 January 2020

Please cite this article as: O. Igonina, V. Samsonov, A. Ublinskaya, et al., A novel one-step method for targeted multiplication of DNA fragments from the Escherichia coli chromosome mediated by coordinated functioning of λ and φ80 bacteriophage recombination systems, Journal of Microbiological Methods (2019), https://doi.org/ 10.1016/j.mimet.2020.105842

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof A novel one-step method for targeted multiplication of DNA fragments from the Escherichia coli chromosome mediated by coordinated functioning of λ and φ80 bacteriophage recombination systems Igonina O., Samsonov V., Ublinskaya A., Hook Ch., Malykh E., Kozaeva E., Sycheva E., Stoynova N.* Corresponding author. e-mail: [email protected] Ajinomoto-Genetika Research Institute, 1st Dorozhny pr., Moscow, 117545, Russian Federation Highlights



of

ro



A method for one-step in vivo cloning and targeted long chromosomal insertion is proposed. Cloning and targeted chromosomal integration of the E. coli gene(s) with simultaneous replacement of a native regulatory region with a desired artificial one is possible. In vivo cloning and targeted integration into two chromosomal loci was performed simultaneously. PCR-amplification of long DNA fragment(s) is not required for cloning.

-p

 

Abstract

Jo ur

na

lP

re

A novel technique for targeted stable multiplication of a specific long E. coli chromosome fragment was developed. The method is based on the coordinated functioning of λ and φ80 bacteriophage site-specific recombination and integration systems. In vivo cloning and targeted insertion of a chosen chromosomal region is accomplished by a simple one-step experiment. The method does not require PCR amplification of an inserted fragment, which makes it especially convenient for manipulation of long-length DNA. For this purpose, we constructed a pKDAH vector that can perform both λRed recombineering and φ80-integrase-mediated integration. Using this technique, the chromosome region is cloned via λRed recombination and immediately inserted into another chromosome locus by φ80-integrase. The method was effectively used for targeted chromosomal integration of additional copies of an individual gene (alaE), a shortlength operon (kbl-tdh) and long-length DNA fragments harboring the E. coli atpIBEFHAGDC or nuoABCEFGHIJKLMN operons (7.5 and 15 kb, respectively), thus confirming the utility of the technique. Moreover, duplication of the target genes with simultaneous modification of the regulatory region was performed. Keywords: long length DNA cloning; integration; one-step multiplication; Escherichia coli; genome editing; recombineering. 1. Introduction E. coli is a well-characterized bacterium widely used as a workhorse in industrial biotechnology, synthetic biology, and metabolic engineering. Therefore, a wide variety of tools for E. coli chromosome editing have been developed. In particular, the needs of metabolic engineering along with the recently developed multiplex, random or bound-random approaches (Toussaint A., 2017; Wang et al., 2012, Ronda et al., 2018) often require tools that allow precise modifications of certain chromosomal regions or insertion of extended genetic constructs into loci chosen beforehand. The majority of such tools is based on λRed/RecET recombineering (Datsenko and Wanner, 2000; Murphy, 1998; Swingle et al., 2010; Yu et al., 2000; Zhang et al.,

Journal Pre-proof 1998) or targeted insertions mediated by phage integrases (Gu et al., 2015; Haldimann and Wanner, 2001). A variety of approaches have been developed by modifying these key techniques (Tischer et al., 2006; Minaeva et al., 2008; Kuhlman and Cox, 2010; 2012; St-Pierre et al., 2013; Snoeck et al., 2019); however, one must first clone target genes onto a plasmid using standard in vitro cloning procedures in all these methods. At the same time, construction of the “donor” plasmid may be a laborious and time-consuming task, especially in cases of cloning a longlength DNA fragment and/or a synthetic construct whose expression as part of a plasmid is strongly undesirable.

re

-p

ro

of

Recently, a useful tool for in vivo cloning and targeted long-length chromosomal insertion was developed in our laboratory (Hook et al., 2016). This tool is based on in vivo λRedmediated cloning of a DNA fragment from the E. coli chromosome into a specially constructed vector whose origin of replication can be later eliminated in vitro via hydrolysis by I-SceI endonuclease and self-circularization by DNA ligase. The resulting ori-less circular recombinant DNA can be used for targeted insertion into the chromosome in an artificially constructed φ80attB site via φ80-integrase-mediated recombination using the Dual-In/Out approach (Minaeva et al., 2008). Thus, it was possible to clone in vivo DNA fragments of different sizes. However, the integration procedure consists of several steps, and therefore, the efficiency of the procedure depends on a number of factors, especially on the efficiency of the restriction hydrolysis and subsequent self-ligation procedures. In addition, the multistep procedure is rather time consuming.

Jo ur

na

lP

In the current paper, we present an improved approach that allows simplification of the previously developed technique by assembling cloning and insertion procedures in one stage. Using the novel method, the chromosome region of interest is subcloned in vivo via λRed recombination into a short synthetic nonreplicable DNA fragment containing a marker (excisable chloramphenicol resistance (CmR) gene) and φ80 att-P site and a promoter region, if needed. The resulting nonreplicating circular DNA molecule is immediately inserted into an alternative chromosomal locus due to φ80-integrase activity. To this end, the specially designed helper plasmid pKDAH, which can provide both λRed recombineering and φ80-integrase-mediated insertion, was constructed. As a proof of concept, we constructed E. coli strains with additional copies of an individual gene (alaE), short-length operon (kbl-tdh), long-length 7.5 kb DNA fragment harboring the E. coli atpIBEFHAGDC operon or long-length 15 kb DNA fragment harboring the E. coli nuoABCEFGHIJKLMN operon. Moreover, the cloning and targeted chromosomal integration of the aldH gene into the chromosome was combined with simultaneous replacement of a native regulatory region with a desired artificial one. 2. Materials and methods 2.1. Strains, plasmids and growth conditions All bacterial strains and plasmids used in this study are listed in Table 1. The following media were used to culture bacteria: lysogeny broth (LB) (Bertani, 1951); Super Optimal Broth (SOB); and SOB with catabolite repression (SOC) (Sambrook and Russell, 2001). Ampicillin (Ap, 100 mg/L) and Cm (40 mg/L) were used for selection, as necessary.

Journal Pre-proof 2.2. DNA handling procedures Standard protocols were used in this study for the genetic manipulation of E. coli and the isolation and manipulation of nucleic acids (Sambrook and Russell, 2001). Restriction enzymes, T4 DNA ligase, Taq-polymerase and 1-kb DNA ladder were purchased from Thermo Scientific Inc. All reactions were performed according to the manufacturer's instructions. Primers were purchased from "Eurogen" (Russia). All primers used in this work are listed in Table 2. The plasmids were isolated using QIAGEN Plasmid Mini Kits (QIAGEN GmbH, Germany). QIAquick Gel Extraction kits (QIAGEN GmbH, Germany) were used to isolate DNA from agarose gels. 2.3. Construction of the pKDAH plasmid

-p

ro

of

The pKDAH plasmid was constructed as follows. A fragment containing the φ80-integrase and CI repressor genes was amplified by PCR from the plasmid pAH123 with primers 1 and 2 (Table 2), which contain NcoI restriction sites at their 5′ ends. Then, the PCR product and pKD46 plasmid were digested with NcoI and ligated. Cloning was performed in the XL1 Blue strain, and the ApR clones harboring the resulting pKDAH plasmid were selected. 2.4. Construction of the pGL2-promoter plasmids

re

2.4.1 Construction of the pGL2-Ptac and pGL2-Ptac-SD plasmids

Jo ur

na

lP

To construct the pGL2-Ptac and pGL2-Ptac-SD plasmids, the pGL2 plasmid, which carries the ori of pSC101, the φ80-attP site of φ80 phage, and an excisable CmR marker bracketed by attL/attR sites (Hook C.D. et al., 2016), was used as a starting material. A DNA fragment containing the whole pGL2-Ptac sequence was obtained by PCR from the pGL2 plasmid as a template with primers 3 and 4. Primer 4 contained the sequence of the Ptac promoter (Katashkina et al., 2005). The obtained DNA fragment was digested with the restriction enzyme NotI and subjected to self-ligation to construct the pGL2-Ptac plasmid. The obtained pGL2-Ptac plasmid was used as a starting material for construction of the pGL2Ptac-SD plasmid. The latter one additionally contains the Shine-Dalgarno-encoding region optimal for translation. A DNA fragment containing the whole pGL2-Ptac-SD sequence was obtained by a second round of PCR with the pGL2-Ptac plasmid as a template and with primers 3 and 5. Primer 5 contained the synthetic Shine-Dalgarno (SD) sequence aggagg. The obtained DNA fragment was digested with the restriction enzyme NotI and subjected to self-ligation to construct the pGL2-Ptac-SD plasmid. 2.4.2 Construction of the pGL2-Ptac3 plasmid To construct the pGL2-Ptac3 plasmid, the pGL2 plasmid (Hook C.D. et al., 2016) was again used as a starting material. A DNA fragment containing the whole pGL2-Ptac3 sequence was obtained by PCR with the pGL2 plasmid as a template and with primers 3 and 6. Primer 6 contained the sequence of the Ptac3 promoter (Katashkina et al., 2005). The obtained DNA fragment was digested with the restriction enzyme NotI and subjected to self-ligation to construct the pGL2Ptac3 plasmid. 2.4.3 Construction of the pGL2-Ptac7 plasmid

Journal Pre-proof To construct the pGL2-Ptac7 plasmid, the pGL2 plasmid (Hook C.D. et al., 2016) was again used as a starting material. A DNA fragment containing the whole pGL2-Ptac7 sequence was obtained by PCR with the pGL2 plasmid as a template and with primers 3 and 7. Primer 7 contained the sequence of the Ptac7 promoter (Katashkina et al., 2005). The obtained DNA fragment was digested with the restriction enzyme NotI and subjected to self-ligation to construct the pGL2Ptac7 plasmid. 2.4.4 Construction of the pGL2-Plac-lacI plasmid

-p

ro

of

To construct the pGL2-Plac-lacI plasmid, the Plac-lacI construct was cloned in vivo in the pGL2 plasmid (Hook et al., 2016) by means of pKD46-mediated λRed recombination. A DNA fragment containing the whole pGL2 sequence was obtained by PCR with the pGL2 plasmid as a template and with primers 8 and 9. Primers 8 and 9 contained 36 bp sequences that were homologous to the chromosome region of the Plac-lacI-containing strain chromosome (MG ∆tdh rhtA* miniMu::Plac-lacI-ilvA*-KmR). The obtained PCR fragment was electroporated into the E. coli MG ∆tdh rhtA* miniMu::Plac-lacI-ilvA*-KmR strain containing the pKD46 plasmid (Datsenko et al., 2000). The resulting plasmid pGL2-Plac-lacI was obtained from one of the clones independently grown on a plate, with chloramphenicol as the selectable marker. 2.5. E. coli chromosome region replacement procedure

lP

re

E. coli K-12 MG1655 was transformed with the helper plasmid pKDAH (ApR, repA101ts) for in vivo cloning and φ80-integrase-mediated targeted insertion.

Jo ur

na

The pGL2 vector (or pGL2-promoter vectors) was used as a template to amplify the “platform” DNA fragment containing the φ80-attP site, a -excisable cat gene as the selectable marker and a promoter region, if necessary. The “platform” DNA fragment was amplified by PCR using primers 10 and 11 for alaE multiplication, 12 and 13 for atp operon duplication, 22 and 23 for nuo operon duplication, 26 and 27 for aldH gene duplication, and 28 and 29 for kbltdh-operon duplication. The primers contained 36 nt sequences that were homologous to the duplicated region. Strain E. coli K-12 MG1655/pKDAH was grown in 10 ml SOB cultures at 30°C to an OD600 0.8 with ampicillin and 1 mM L-arabinose addition for λRed genes induction. Cells were made electrocompetent by concentrating 100-fold and washing three times with ice-cold deionized water. To perform E. coli chromosome region replacement, 400 ng of the gel-purified PCR product was used for electrotransformation using a MicroPulser Electroporator (Bio-Rad, USA) in 0.2-cm gap-width cuvettes according to the manufacturer’s instructions. Shocked cells were added to 1 ml SOC, incubation was performed for 2 h at 37°C for φ80-integrase expression. To achieve targeted integration of the resulting ori-less circular DNA, the recipient bacterial chromosome must contain the complementary attachment site (φ80-attB) that is either native or artificially preinserted into the desired locus. Due to the temperature shift, φ80-integrase gene expression is activated, and the circular molecule is integrated into the φ80 att-B site. The next day, the CmR recombinants selected at 37°C were analyzed by PCR. Three types of PCR analysis were used to show that all mutants have the correct structure. The first PCR was performed with the flanking locus-specific primers to verify loss of the parental (unmodified)

Journal Pre-proof fragment. Two other reactions were done by using locus-specific primers with the insertionspecific primers. 7- 80% of the recombinants contained the desired insertion. Elimination of the pKDAH helper plasmid was performed by maintaining the cells in nonselective (Ap-free) medium at a nonpermissive temperature (42°C). The resulting colonies were evaluated for ampicillin sensitivity. Table 1. Bacterial strains and plasmids used in this study. Strain or plasmid Strains MG1655 MG1655-Δ(φ80-attB)

Description E. coli K-12 MG1655 E. coli K-12 MG1655 with deleted native φ80-attB site Same as MG1655 Δφ80-attB but Δndh::φ80-attB; used as a recipient for φ80-Int-mediated integration Same as MG1655 Δφ80-attB but ΔgalT::φ80-attB; used as a recipient for φ80-Int-mediated integration endA1 gyrA96(nalR) thi-1 recA1 relA1 lac glnV44 F'[::Tn10 + q proAB lacI Δ(lacZ)M15] hsdR17(rKmK+) Same as MG1655 but Δφ80 attB native::λattL-cat-λattR-alaE; contains the L-alanine exporter gene Same as MG1655 but Δφ80 attB native::λattL-cat-λattR-alaE and Δndh:: alaE; contains two additional copies of the L-alanine exporter gene Same as MG1655 but Δφ80 attB native::λattL-cat-λattRatpIBEFHAGDC; contains the ATP synthase operon Same as MG1655 but Δφ80 attB native; ΔgalT::λattL-cat-λattRnuoABCEFGHIJKLMN; contains the NADH dehydrogenase I operon Same as MG1655 but Δφ80 attB native::λattL-cat-λattR-kbl-tdh; contains the 2-amino-3-ketobutyrate CoA ligase- threonine dehydrogenase operon Same as MG1655 but Δφ80 attB native::λattL-cat-λattR-Ptac-aldH; contains the γ-glutamyl-γaminobutyraldehyde dehydrogenase gene Same as MG1655, but ∆tdh rhtA* mini-Mu::Plac-lacI-ilvA*-KmR; contains the Plac-lacI construct

of

MG1655 Δndh::φ80-attB

Source

-p

ro

MG1655 Δ(φ80-attB) ΔgalT::φ80-attB

re

XL1 Blue

Jo ur

MG1655 Δφ80 attB native::atp

na

MG1655 Δφ80 attB native::alaE; Δndh:: alaE

lP

MG1655 Δφ80 attB native::alaE

MG1655 Δφ80 attB native ΔgalT::nuo MG1655 Δφ80 attB native::kbl-tdh

MG1655 Δφ80 attB native::Ptac-aldH

MG ∆tdh rhtA* miniMu::Plac-lacI-ilvA*KmR

(Minaeva et al., 2008) This study

This study

Stratagene, USA

This study

This study

This study

This study

This study

This study

Laboratory collection

Journal Pre-proof

pGL2-Ptac pGL2-Ptac-SD

pGL2-Ptac3 pGL2-Ptac7 pGL2-Plac-lacI

(Datsenko Wanner, 2000)

and

(Hook et al., 2016)

This study This study

This study This study This study (Haldimann and Wanner, 2001); GenBank accession number AY048726 (Minaeva et al., 2008) This study

Jo ur

na

pKDAH

lP

pMWattphi

re

-p

pAH123

of

pGL2

oriR101, repA101ts, araC, ParaB-[γ β exo of phage λ], ApR; used for pKDAH plasmid construction oriR101, repA, flanked by I-SceI sites, φ80-attP, λattR-cat-λattL used as a donor for generating φ80-attP, λattRcat-λattL-containing PCR fragment Same as pGL2 but with the Ptac promoter sequence Same as pGL2 but with the Ptac-SD promoter sequence; contains a ShineDalgarno-encoding region Same as pGL2 but with the Ptac3 promoter sequence Same as pGL2 but with the Ptac7 promoter sequence Same as pGL2 but with the Plac-lacI promoter sequence oriR101, repA101ts, λcIts857, R λPR→φ80-int, Ap ; used as a donor for generating λcIts857, λPR→φ80-intcontaining PCR fragment oriR101, repA, MCS, ApR, (φ80-attL) - KmR - (φ80-attR) oriR101, repA101ts, araC, ParaB-[γ β exo of phage λ], ApR, λcIts857, λPR→φ80-int; used as a helper plasmid for providing λRed-dependent recombination and thermoinducible expression of the φ80-int gene

ro

Plasmids pKD46

Table 2. Sequences of the PCR primers used in this study. No. 1 2 3

Sequence (5’→3’) atgccatggtcttgctcaattgttat tacccatggcaatcaaagagt tagcggccgcgccgatgtcacagtgcct

4

tagcggccgctccacacattatacgagccgatgattaattgtca aggtgaatcacgacaaagcgt

5

tagcggccgcctccttccgctcacaattccacacattatacgagc cg

6

tagcggccgctccacacattatacgagccgatgattaattgcaa agccgatgtcacagtgccttag

7

tagcggccgctccacacattatacgagccgatgattaatttgcc

Description Construction of pKDAH; the NcoI site is in bold Construction of the pGL2-promoter plasmids; the NotI site is in bold Construction of the pGL2-Ptac plasmid; the NotI site is in bold; the Ptac is in italics Construction of the pGL2-Ptac-SD plasmid; the NotI site is in bold; the SD is in italics Construction of the pGL2-Ptac3 plasmid; the NotI site is in bold; the Ptac3 is in italics Construction of the pGL2-Ptac7 plasmid;

Journal Pre-proof

8 9 10 11 12 13

the NotI site is in bold; the Ptac7 is in italics gcacgacaggtttcccgactggaaagcgggcagtgagccgatg Construction of the pGL2-Plac-lacI tcacagtgcct plasmid; the backbone of the primer for tcacattaattgcgttgcgctcactgcccgcagatcggtgaatcac PCR amplification is in italics gacaaagcgta tggaaatataataagtgatcgcttacactacgcgacgaaatgaag λattL-CmR-λattR-φ80-attP cctgcttttttatactaagttgg amplification with regions homologous to the alaE-flanking sequences; the ctggcttcgccaaataaaccattcaaataacgttcaagcgggtga backbone of the primer for PCR amplification is in italics atcacgacaaagcgta ccacctgacgcttaaattaaggtactgccttaattttctgtgaagcc λattL-CmR-λattR-φ80-attP tgcttttttatactaagttgg amplification with regions homologous to the atpIBEFHAGDC-flanking sequences; the backbone of the primer Aacagccaatgatggttcttagcgccgatttttagcagacggtga for PCR amplification is in italics atcacgacaaagcgtatcaa (Hook et al., 2016)

of

aggtgaatcacgacaaagcgt

18

19 20 21 22 23 24 25 26 27

-p

re

lP

17

na

16

Jo ur

15

Confirmation of alaE gene and atp operon insertion into the chromosome (into the native locus) ggcaatgagatccactgctt Confirmation of alaE gene insertion into the chromosome (into the native and the ndh locus) agcagaagcttccgagcaa Confirmation of atp operon insertion into the chromosome (into the native locus) gattgtgattgtcggcggcggtgctggtgggctggaaatggaaa Amplification of the fragment φ80ggtcatttttcctgaatatg attB::KmR with homologous regions for atgaggcgtttatgccacatccgccagtgtacgtcgattacgtttgt integration into the ndh locus; the backbone of the primer for PCR tgacagctggtccaatg amplification is in italics gatacaacgcggctgccgat Confirmation of alaE gene insertion into the chromosome (into the ndh locus) aaacagagattgtgttttttctttcagactcatttcgaaaggtcatttt Amplification of the fragment φ80tcctgaatatgctcacat ::KmR with homologous regions for cgccatccacagggatatcccgattaaggaacgacccgtttgttg integration into the galT locus; the backbone of the primer for PCR acagctggtccaatg amplification is in italics gtggcagtgcgtcatcaagccttcccgttgaaagacattttgaag λattL-CmR-λattR-φ80-attP cctgcttttttatactaagttgg amplification with regions homologous cagacattgggctgtattgccacggattatggtagctctcggtgaa to the nuo operon-flanking sequences; the backbone of the primer for PCR tcacgacaaagcgta amplification is in italics gcgtgcgcgaccgcctaaaa Confirmation of nuo operon insertion into the chromosome (into the galT gatatcccgattaaggaacg locus) gatgaaaattcattatgactcctgtttcacgtctatcagatccacac λattL-CmR-λattR-φ80-Ptac-attP attatacgagccga amplification with regions homologous gttactacgccgccagtgcgaataaatatgcaccattcgatgaag to the aldH gene-flanking sequences; the backbone of the primer for PCR cctgcttttttatactaagttgg amplification is in italics

ro

ctcaagacaaagctgatagcc 14

Journal Pre-proof 28 29

λattL-CmR-λattR-φ80-attP amplification with regions homologous to the kbl-tdh operon-flanking sequences; the backbone of the primer for PCR amplification is in italics Confirmation of aldH gene insertion into the chromosome (into the native locus) Confirmation of kdl-tdh operon insertion into the chromosome (into the native locus)

ctcttatatagctgctctcattatctctctaccctgaagtggtgaatc acgacaaagcgta attgtttggtaggtgaagatcttgaagccttgaagcctgcttttttat actaagttgg ggttgtagaaaatgcctgct

30 cgactggaccaaagtgatct 31

of

3. Results

na

lP

re

-p

ro

3.1 Targeted multiplication of E. coli chromosome fragments A method for cloning and targeted insertion/duplication of the E. coli chromosomal DNA fragments in the E. coli genome was developed. The novel technique was based on the pKDAH helper plasmid function that included in vivo λRed-governed cloning of a targeted E. coli chromosome region into a nonreplicable linear DNA “platform” (see, below, Figure 3) carrying, in particular, a φ80-attP site bracketed by flank homology for λRed recombination. This step was followed by φ80-integrase-dependent insertion of circular recombinant DNA product into the φ80-attB site previously introduced into the desired genome locus. Cloning and insertion were carried out by coordinated functioning of λRed recombination and φ80 integration systems. The pKDAH helper vector contains exo, beta, and gam genes for λRed recombination under the control of arabinose repressor (Haldimann and Wanner, 2001) and the φ80-integrase gene under the control of the λCI thermosensitive repressor (Figure 1).

Jo ur

AmR

araC PCPc ParaBAD ParaBAD gam

pKDAH

pKDAH for picture

beta

8573 bp

exo integrase

CI857 PR P R

PRM P RM

Figure 1 - Genetic map of the pKDAH helper plasmid. The pKDAH plasmid contains Larabinose-inducible exo, beta, and gam genes for λRed recombination and the temperatureinducible φ80-integrase gene for a targeted integration. The scheme of the experiment is presented in Figure 2. The plasmid pKDAH harboring E. coli cell is transformed with the “platform”, a linear fragment containing the φ80-attP site and

Journal Pre-proof a -excisable cat gene as the selectable marker (Figure 3). The fragment is bracketed with 36 bp regions homologous to the flanks of the cloned chromosome region for the λRed recombination process (your favorite region, YFR). E. coli cell φ80attB

A. + Arabinose Induction of the λRed genes expression

cat pKDAH

λRed recombination

φ80attP

Exo Bet Gam YFR

chromosome

(“in vivo” cloning)

B. cat

of

φ80attB

ro

φ80attP

YFR YFR

Non-replicated circle molecule for further targeted integration is formed

pKDAH

Int

na

50

D.

Jo ur

Selection for the CmR clones

φ80attB

Integration of nonreplicated YFRcontaining circular molecule into a native or artificial φ80-attB site

cat

lP

30ºC 37ºC Induction of the φ80-Integrase gene expression

re

C.

-p

chromosome

φ80attP

YFR YFR chromosome

φ80attL

cat

YFR

φ80attR

YFR

Result: the chromosome with two copies of YFR

chromosome

Figure 2 – Schematic representation of the one-step “in vivo” cloning and targeted multiplication of your favorite region (YFR) in the E. coli chromosome. The starting strain contains the pKDAH plasmid (expressing the λRed genes and the φ80-integrase gene) and the chromosome region you want to duplicate (YFR, green box). After the induction of λRed gene expression, the “platform” PCR fragment (see Figure 3) is transformed. A. Cloning of YFR via λRed recombination with the “platform” fragment. B. The nonreplicating circular molecule is formed. C. Φ80-integrase gene expression is activated by a temperature shift (30ºC→37ºC). This induction leads to the integration of the circular YFR-containing DNA molecule into the φ80attB site. D. An E. coli cell with two copies of YFR.

Journal Pre-proof

λattR

λattL

φ80-attP

cat

A.

λattL

λattR

φ80-attP

cat

of

B.

P

re

-p

ro

Figure 3. A. The “platform” for in vivo cloning - a linear PCR fragment containing the φ80-attP site (purple shape) and an “excisable” cat gene (orange arrow) flanked with λ attL/R sites (blue arrows). The DNA fragment is flanked with 36 nt arms homologous to YFR (green rectangles). B. Scheme of the cat-φ80-attP-promoter-bearing “platform” PCR fragment for simultaneous optimization of the expression of genes of interest and their duplication. (P, red arrow – regulatory region (Ptac, Ptac3, Ptac7 or Plac-lacI).

Jo ur

na

lP

After the transformation of the linear DNA into the recipient E. coli cell, the YFR from the chromosome was cloned with arabinose-dependent induction of λRed recombination with the “platform” (Figure 2A). As a result of this process, a circular nonreplicating molecule was formed in the bacterial cell (Figure 2B). This molecule possessing the YFR, -excisable cat gene and φ80-attP site could survive only due to possible integration into the bacterial chromosome. Therefore, in the next step, the φ80-integrase gene in pKADH was activated by increasing the temperature, and the circular product of λRed recombination was directly inserted into a chromosomal φ80-attB site in vivo (Figure 2C). As a result, cells with duplication of YFR were obtained by a one-step experiment (Figure 2D). 3.2 Multiplication of the desired chromosomal fragments with the simultaneous alteration of the regulatory region and construction of pGL2-promoter plasmids In some cases, e.g., to improve and accelerate the strain breeding process, changing the regulatory region of desired genes/operons is necessary. With this aim, the “platform” can be supplemented with a set of regulatory regions that allows simultaneous optimization of the expression of genes of interest with their multiplication. To this end, we constructed a line of pGL2-based plasmids with different promoters, pGL2-Ptac, pGL2-Ptac-SD, pGL2-Ptac3, pGL2Ptac7 (Katashkina et al., 2005), and pGL2-Plac-lacI, named pGL2-promoter plasmids. The pGL2promoter plasmids can be used as templates to obtain a cat-φ80-attP-promoter-bearing “platform” PCR fragment for λRed recombination with YFR. The recombination with such a fragment leads to cloning of YFR with simultaneous modification of the promoter region of YFR. 3.3 Proof-of-principle experiments

Journal Pre-proof To confirm the technique utility, the individual gene (alaE), short-length operon (kbl-tdh) and the long-length DNA fragments harboring the E. coli atp operon (7.5 kb) and E. coli nuo operon (15 kb) were successfully duplicated. The second copy of the alaE gene and atp operon were integrated into the native φ80-attB site. Integration into artificially generated φ80-attB sites in the E. coli genome was performed as well. Here, the galT and ndh genes were chosen as integration loci, and the sites for φ80-Intmediated chromosomal insertion were designed at these loci. Thus, the strains MG1655 Δ(φ80attB) ΔgalT::φ80-attB and MG1655 Δ(φ80-attB) Δndh::φ80-attB, containing the φ80 attachment B site for φ80-Int-mediated chromosomal insertion were constructed in a similar way as described by Minaeva et al (Minaeva et al, 2008). The strains were used for nuo operon and alaE gene integration, respectively.

ro

of

Moreover, we successfully duplicated the γ-glutamyl-γ-aminobutyraldehyde dehydrogenase gene aldH with simultaneous regulatory region replacement. The second copy of the aldH gene with the Ptac promoter was integrated into the native φ80-attB site.

Jo ur

na

lP

re

-p

Additionally, we tried to perform the integration into two φ80-attB sites simultaneously (Figure 4). For this purpose, a strain containing two φ80-attB sites was constructed, where the first one was the native attB site and the second one was an artificially designed Δndh::φ80-attB site. In this case, 3% of selected clones (from a total N=30) contained three copies of the alaE gene in the desired loci.

Figure 4. Integration of YFR into two φ80-attB sites. 4. Discussion In this study, we present an improved method for in vivo cloning and targeted φ80-Intmediated insertion of E. coli DNA fragments. In contrast to the previously developed approach (Hook et al., 2016), the improved technique allows cloning of E. coli DNA fragments of interest from the chromosome followed by their integration into a targeted locus of the bacterial genome in a one-step experiment. The earlier developed two-step method for E. coli chromosome editing includes in vivo cloning of a chromosome region (YFR) in a low-copy pGL2 vector (step I) and integration of pGL2-YFR into the chromosome of the strain of interest (step II). Steps I and II are divided into ori excision and self-ligation procedures. Therefore, the technique is multistage and time

Journal Pre-proof consuming. We modified this method by combining the λRed recombination and φ80-integrasemediated integration processes into one step, thus simplifying the experimental procedure. The novel simple method we present here is an optimal genome-editing approach convenient for routine PCR-free cloning of chromosomal fragments, which are not limited by size.

ro

of

To coordinate the functions of the λ and φ80 bacteriophage recombination systems, we constructed the pKDAH plasmid. Basically, the pKDAH plasmid is the pKD46 vector with the addition of the φ80-integrase gene under the control of the λPR promoter regulated by the CI thermosensitive repressor. Different types of control, L-arabinose-mediated induction for λRed genes and temperature shift for the φ80-integrase gene, allow consecutive performance of both processes, recombineering and insertion of a target construct, inside a cell, one by one. In vivo cloning is performed via recombination with the “platform”, an ori-less linear DNA fragment, which consists of the λXis/Int-excisable cat gene as a marker and φ80-attP site for integration. The correct orientation of the 5’ part of the primers, which are used for the PCR amplification of the “platform” DNA fragment, is essential for the in vivo cloning process (Figure 5).

A B 5'

C D 3'

-p

YFR

3'

C’ D’

re

A’ B’

5'

E F E’ F’

λattL

Jo ur

5' 3'

na

B’ A’ E F

lP

E. coli chromosome

φ80-attP λattR

cat

“platform” DNA fragment

G H G’ H’

3' 5'

G’ H’ D C

Figure 5. 5’ part of the primers for “platform” DNA fragment amplification. B’A’EF – forward primer, DCH’G’ – reverse primer (red arrows). B’A’ and DC indicate 36 nt regions, homologous to YFR of the E. coli chromosome (YFR, Your Favorite Region, green box). EF and G’H’ indicate the backbone of the primers for PCR amplification of the “platform” DNA fragment. As an additional modification of the method, we realized an opportunity to insert different promoters into the initial “platform”. With this aim, we constructed a set of pGL2based plasmids possessing Ptac, Ptac3, Ptac7 and Plac-lacI promoter regions; these plasmids were used as templates to obtain promoter-carrying “platforms”. A range of regulatory regions could be further ensured to broaden the opportunities for simultaneous optimization of the expression of target genes with their multiplication.

Journal Pre-proof

na

lP

re

-p

ro

of

Thus, in this study, we developed a novel approach for the in vivo “cloning” of genes/operons of interest with their subsequent insertion as an additional copy(ies) into the E. coli chromosome, accompanied, if necessary, with regulatory region modification, by a one-step experiment (Figure 6).

Jo ur

Figure 6. How to perform the one-step YFR cloning and insertion. A. Preparation of cells for λRed recombination: with arabinose addition - λRed-recombineering proteins are produced, and at 30°C, φ80-integrase gene transcription is blocked. B. Electrotransformation of cells with a “platform” PCR fragment. C. Temperature shift to 37°C. Φ80-integrase starts functioning and inserts a circular molecule into the chromosomal φ80-attB site. D. Incubation on selective plates. The method can be applied for multiplication of DNA fragments of various sizes. Thus, we duplicated an individual gene (alaE), a short-length operon (kbl-tdh) and long-length operons (7.5 kb atp and 15 kb nuo) as proof of concept. Theoretically, there is no limitation of the size of the inserted fragment. In our method, the ”platform“ DNA but not YFR is generated in vitro by PCR that avoids unintended PCR-derived errors in YFR. The ability to simultaneously insert a desirable promoter into YFR with its multiplication significantly simplifies the strain breeding process due to the possibility of easily optimizing the expression level of target genes. The efficiency of the method is high enough – approximately 80% of the obtained clones contained the second copy of the alaE gene, kbl-tdh operon or atp operon. However, in some experiments, the efficiency was only 3% (for example, in the case of the nuo operon). In this case, we detected only the cat marker integrated into the chromosome; no insertion of an additional nuo operon was detected. We supposed that such clones occur when the process of

Journal Pre-proof

re

-p

ro

of

φ80-integrase-mediated insertion is more effective than λRed recombineering. Perhaps, the efficacy of the λRed-recombineering process depends upon the location of YFR in the chromosome. We hypothesize that specific DNA structures in some chromosomal loci might affect λRed proteins function. Another reason why clones with integrated cat gene occur is that the φ80-integrase gene under control of the PR promoter is not fully repressed by the CI thermosensitive repressor. We suppose that in vivo self-ligation of the “platform” DNA and integration into φ80-attB is possible. As a further improvement of the method, fine tuning of the φ80-integrase gene expression may be necessary. Furthermore, we plan to broaden the collection of the regulatory regions in the “platform” fragment to make an easy and fast tool for optimizing target gene expression levels. The efficacy of the multiplication process itself could be additionally increased due to selective pressure enhancement by using a selectable marker functioning in a dose-dependent manner, e.g., in our case, by increasing the chloramphenicol concentration in the selective medium. The genetic stability of the strains obtained by the method described here was confirmed using the atpIBEFHAGDC operon as an example. It was found that a strain containing three copies of this operon at the aroG, ppdD and native loci retained all integrated copies after cultivation for 60 generations. Further improvement of the method requires a broadening of the collection of strains possessing φ80-attB in chromosomal loci, with individual or multiple instances, depending on the task; currently, our collection has approximately 30 variants. This collection could be expanded by means of well-known approaches for random (Toussaint A., 2017) or directed (Datsenko and Wanner, 2000) integration.

na

lP

Acknowledgments: We thank Dr. N. Minaeva for providing the MG1655-Δ(φ80-attB) strain and plasmid and Dr. I. Biryukova and I. Butov for help in construction of artificial φ80-attB site. We also would like to thank Prof. B.L. Wanner (Dept. of Biological Sciences, Purdue Univ., West Lafayette, Indiana 47907, USA) who kindly provided plasmids. We are grateful to Prof. S. Mashko for critical reading of manuscript.

2. 3.

4.

5.

6.

Jo ur

1.

5. References Bertani, G., 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62, 293–300. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97, 6640–5. Gu, P., Yang, F., Su, T., Wang, Q., Liang, Q., Qi, Q., 2015. A rapid and reliable strategy for chromosomal integration of gene(s) with multiple copies. Sci. Rep. 5, 9684. doi:10.1038/srep09684. Haldimann, A., Wanner, B.L., 2001. Conditional-Replication, Integration, Excision, and Retrieval Plasmid-Host Systems for Gene Structure-Function Studies of Bacteria. J. Bacteriol. 183, 6384–6393. Hook, C.D., Samsonov, V.V., Ublinskaya, A.A., Kuvaeva, T.M., Andreeva, E.V., Gorbacheva, L.Y., Stoynova, N.V., 2016. A novel approach for Escherichia coli genome editing combining in vivo cloning and targeted long-length chromosomal insertion. J. Microbiol. Methods 130, 83–91. doi:10.1016/J.MIMET.2016.08.024 Katashkina J.I., Skorokhodova A.Y., Zimenkov D.V., Gulevich A.Y., Minaeva N.I., Doroshenko V.G., Biryukova, I.V., Mashko, S.V., 2005. Tuning the expression level of a gene located on a bacterial chromosome. Molecular Biology 39(5), 719–26.

Journal Pre-proof

Jo ur

na

lP

re

-p

ro

of

7. Kuhlman, T.E., Cox, E.C., 2010. Site-specific chromosomal integration of large synthetic constructs. Nucleic Acids Res. 38, e92. doi:10.1093/nar/gkp1193. 8. Minaeva, N.I., Gak, E.R., Zimenkov, D.V., Skorokhodova, A.Y., Biryukova, I.V., Mashko, S.V., 2008. Dual-In/out strategy for genes integration into bacterial chromosome: a novel approach to step-by-step construction of plasmid-less marker-less recombinant E. coli strains with predesigned genome structure. BMC Biotechnol. 8, 63. doi:10.1186/1472-6750-8-63. 9. Murphy, K.C., 1998. Use of bacteriophage lambda recombination functions to promote gene replacement in Escherichia coli. J. Bacteriol. 180, 2063–2071. 10. Ronda, C., Pedersen, L.E., Sommer, M.O.A., Nielsen, A.T., 2016. CRMAGE: CRISPR Optimized MAGE Recombineering. Sci. Rep. 6, 19452. doi:10.1038/srep19452 11. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 12. Snoeck, N., De Mol, M.L., Van Herpe, D., Goormans, A., Maryns, I., Coussement, P., Peters, G., Beauprez, J., De Maeseneire, S.L., Soetaert, W., 2019. Serine integrase recombinational engineering (SIRE): A versatile toolbox for genome editing. Biotechnol. Bioeng. 116, 364–374. doi:10.1002/bit.26854 13. St-Pierre, F., Cui, L., Priest, D.G., Endy, D., Dodd, I.B., Shearwin, K.E., 2013. One-Step Cloning and Chromosomal Integration of DNA. ACS Synth. Biol. 2, 537–541. 14. Swingle, B., Markel, E., Costantino, N., Bubunenko, M.G., Cartinhour, S., Court, D.L., 2010. Oligonucleotide recombination in Gram-negative bacteria. Mol. Microbiol. 75, 138–148. doi:10.1111/j.1365-2958.2009.06976.x. 15. Tischer, B.K., Von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step Red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40, 191–197. 16. Toussaint, A., 2017. Transposable Bacteriophages as Genetic Tools. Bacteriophages, 263-278. Humana Press, New York, NY. doi:10.1007/978-1-4939-7343-9_19 17. Wang, H.H., Kim, H., Cong, L., Jeong, J., Bang, D., Church, G.M., 2012. Genome-scale promoter engineering by coselection MAGE. Nat. Methods 9, 591–3. doi:10.1038/nmeth.1971 18. Yu, D., Ellis, H.M., Lee, E., Jenkins, N.A., Copeland, N.G., Court, D.L., 2000. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.S. 97, 5978–5983. doi:10.1073/pnas.100127597. 19. Zhang, Y., Buchholz, F., Muyrers, J.P., Stewart, A.F., 1998. A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20, 123–128. doi:10.1038/2417. Igonina O.: Validation, Investigation, Writing- Original draft preparation. Samsonov V.: Conceptualization, Methodology. Ublinskaya A.: Investigation. Hook Ch.: Investigation. Malykh E.: Resources. Kozaeva E.: Resources. Sycheva E.: Resources. Stoynova N.: Conceptualization, Writing - Review & Editing, Supervision. Dear Editors, All the authors state that there is no conflict of interests. With my best regards,

Journal Pre-proof Dr. Nataliya Stoynova, Assistant professor Ajinomoto Genetika Research Institute 1st Dorozny pr., 1-1 Moscow 117545 Russia Tel.: +7(495)780-3378 ext (*) 515 Fax: +7(495)315-0640 e-mail: [email protected]

ro

-p

re

lP



na



A method for one-step in vivo cloning and targeted long chromosomal insertion is proposed. Cloning and targeted chromosomal integration of the E. coli gene(s) with simultaneous replacement of a native regulatory region with a desired artificial one is possible. In vivo cloning and targeted integration into two chromosomal loci was performed simultaneously. PCR-amplification of long DNA fragment(s) is not required for cloning.

Jo ur

 

of

Highlights