A novel p53 paralogue mediates antioxidant defense of mosquito cells to survive dengue virus replication

Virology 519 (2018) 156–169

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/virology

A novel p53 paralogue mediates antioxidant defense of mosquito cells to survive dengue virus replication

T

Tien-Huang Chena, Yi-Jun Wub, Jiun-Nan Houb, Yi-Hsuan Chianga, Chih-Chieh Chengb, ⁎ ⁎ Eny Sifiyatunb,c, Cheng-Hsun Chiud,e, Lian-Chen Wanga,b,d, , Wei-June Chena,b,d, a

Departments of Public Health and Parasitology, Chang Gung University, Kwei-San, Tao-Yuan 33332, Taiwan Graduate Institute of Biomedical Sciences, Chang Gung University, Kwei-San, Tao-Yuan 33332, Taiwan c Program in Tropical Medical Science, Gadjah Mada University, Yogyakartan, Indonesia d Molecular Infectious Disease Research Center, Chang Gung Memorial Hospital, Kwei-San, Tao-Yuan, Taiwan e Division of Pediatric Infectious Diseases, Department of Pediatrics, Chang Gung Children's Hospital, Chang Gung University College of Medicine, Kwei-San, Tao-Yuan, Taiwan b

A R T I C LE I N FO

A B S T R A C T

Keywords: Dengue 2 virus Mosquito cells P53-2 P53 paralogue Antioxidant defense Cell survival Gene regulation

Mosquito cells allow dengue viruses (DENVs) to undergo replication without causing serious deleterious effects on the cells, leading to advantages for dissemination to other cells. Despite this, increased accumulation of reactive oxygen species (ROS) is usually detected in C6/36 cells with DENV2 infection as shown in mammalian cells. Uniquely, oxidative stress caused by the ROS is alleviated by eliciting antioxidant defense which leads to protection of mosquito cells from the infection. In the present study, a novel p53 paralogue (p53-2) was identified and proved to be regulated in C6/36 cells with DENV2 infection. With a gene-knockdown technique, p53-2 was demonstrated to transcribe catalase which plays a critical role in reducing ROS accumulation and the death rate of infected cells. Ecologically, a higher survival rate of mosquito cells is a prerequisite for prosperous production of viral progeny, allowing infected mosquitoes to remain healthy and active for virus transmission.

1. Introduction Dengue viruses (DENVs) account for 50–100 million dengue infections and around 200,000 deaths each year worldwide (Fredericks and Fernandez-Sesma, 2014), and continue to be a health threat in tropical and subtropical regions (Bhatt et al., 2013). The DENV taxonomically belongs to the family Flaviviridae, the genome of which contains a single-stranded positive-sense RNA of ~ 11 kilobases (kb) in length. Viral RNA is composed of a structure possessing an m7GpppAmp cap at the 5′-end but lacks a poly(A) tail at the 3′-end (Gebhard et al., 2011). When the DENV enters a host cell, viral RNA is directly translated into a single polyprotein that is subsequently cleaved into three structural proteins (C, M, and E) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) by the combined actions of host proteases and the trypsin-like viral NS2B/NS3 serine protease (Mukhopadhyay et al., 2005). DENVs can be antigenically divided into four distinct serotypes, although there may be the fifth one (Holmes, 1998; Mustafa et al., 2015). Each serotype of DENVs causes similar clinical symptoms, including frontal headaches, retro-orbital pain, myalgia, joint pain, prostration, a macular rash, and hemorrhagic

⁎

manifestations in some cases (Gubler, 1998). More-severe forms such as dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are also observed in a proportion of DENV infections (Guzman et al., 2010). They are hypothesized to occur due to infection by a virulent strain or on the basis of antibody-dependent immune enhancement (Gubler, 2002). In addition, neurological complications of dengue infections were reported in certain cases (Chen et al., 1991; Puccioni-Sohler et al., 2013). DENVs are naturally transmitted between humans by mosquito vectors, primarily Aedes aegypti (Yang et al., 2014), meaning that the virus is able to replicate in both human/mammalian and mosquito cells. Within the human host, the virus injected by the mosquito vector frequently infects and replicates in skin Langerhans cells, monocytederived dendritic cells, and monocytes/macrophages (Palucka, 2000; Wu et al., 2000), and perhaps also in megakaryocytes (Noisakran et al., 2010). Panels of host genes being upregulated and downregulated in host cells with DENV infection suggests that selected host factors may be involved in host responses, such as innate immunity (Sessions et al., 2013). Apoptosis is usually the ultimate outcome of cells infected with DENVs (Morchang et al., 2011; Nasirudeen et al., 2008), based on determinants from both the virus and infected cells (Marianneau et al.,

Corresponding authors at: Departments of Public Health and Parasitology, Chang Gung University, Kwei-San, Tao-Yuan 33332, Taiwan E-mail addresses: [email protected] (L.-C. Wang), [email protected] (W.-J. Chen).

https://doi.org/10.1016/j.virol.2018.04.011 Received 3 March 2018; Received in revised form 31 March 2018; Accepted 16 April 2018 0042-6822/ © 2018 Elsevier Inc. All rights reserved.

Virology 519 (2018) 156–169

T.-H. Chen et al.

1998). According to a study in a p53-deficient cell line, apoptosis became undetectable in response to DENV infection (Nasirudeen et al., 2008). This indicates that DENV-induced cell death is dependent on p53, which is usually upregulated during the infection (Hollstein et al., 1991). p53 was reported to act as an important transcription factor in mammalian cells, functioning to restrict cellular proliferation via inducing distinct subsets of p53 target genes (Budde and Grummt, 1999; Vousden and Prives, 2009). p53 may be activated by various factors such as stress within cells. p53 is normally activated by low-intensity intracellular stress, facilitating triggering of an antioxidant response. However, a high level of p53 that tends to activate pro-oxidant targets may be induced under high-intensity oxidative stress (Borras et al., 2011). It seems that p53 is a double-edged sword, which can be converted from a killer into a healer based on the intensity of stress-induced ROS levels (Gudkov, 2002). As accumulation of high levels of ROS can cause dysfunction of cells (Mates et al., 1999), p53 may drive cells to a normal physiological or pathological status based on the intensity of the cellular stress (Brady and Attardi, 2010). This indicates that p53 or its downstream genes may be responsible for ROS-regulating activity and subsequent antioxidant defense (Budanov, 2014), by converting itself from a killer into a healer which facilitates DNA repair (Gudkov, 2002). In addition to mammalian cells, p53 was also identified in insects and other invertebrates, such as Drosophila melanogaster and Caenorhabditis elegans (Rutkowski et al., 2010), being a structural and functional homologue of that from mammals (Ollmann et al., 2000). The function of Drosophila p53 was demonstrated to be similar to that of mammals of triggering apoptosis under stress; this was also observed in Bombyx mori-derived cells exposed to H2O2 (Chen et al., 2015; Liu et al., 2008). Nevertheless, increasing evidence has revealed that invertebrate-derived p53 may function in DNA repair, cell-cycle checkpoint responses, and cell differentiation (Fan et al., 2010), implying that it may be beneficial for cell survival under specific conditions of a cell. Moreover, p53 of D. melanogaster was found to consist of two isoforms, A and B, and only isoform A is involved in mediating the apoptotic response to DNA damage (Zhang et al., 2015). Rather recently, two p53 paralogues, p53-1 and p53-2, were identified from mosquitoes and C6/36 cells (Chen et al., 2017). We previously demonstrated that oxidative stress occurs in DENV2infected C6/36 cells which usually survive the infection via induction of antioxidant defense and antiapoptotic effects (Chen et al., 2012, 2011). In this study, we continued to further investigate how antioxidant defense is triggered. Herein, we found that the p53-2 paralogue was specifically activated in response to DENV2 infection in C6/36 cells. Its roles of determining the fate of mosquito cells and facilitating viral replication were also studied and are discussed in this report.

Fig. 1. Identification of p53 paralogues from C6/36 cells and measurement of its expression in response to dengue 2 virus (DENV2) infection. Gene expressions of two p53 homologues (p53-1 and p53-2) were evaluated by a real-time RT-PCR in C6/36 cells in response to dengue 2 virus (DENV2) infection. It was shown that the mRNA level of p53-1 did not significantly change even though cells were infected for 48 h (< 1.32-fold increase) (Student t-test; p > 0.05). Nevertheless, although p53-2 remained at the baseline (1.13-fold increase) at 12 h post-infection (hpi), it had significantly increased by 2.27-, 2.37-, and 2.98-fold by 24, 36, and 48 hpi, respectively (one-way ANOVA, p < 0.05). This indicates that only p53-2 was responsive to DENV2 with infection time in C6/ 36 cells.

2.2. The absence of cross effect in knockdown of specific p53 paralogues by using specific dsRNA To examine mutual effects between the two paralogues of p53, synthesized dsRNAs were used to specifically knock down p53-1 or p532, and then their expressions were measured by a real-time RT-PCR. Results revealed that p53-1 was reduced to 21% and 25% of the expression in cells with knockdown of p53-1 at 24 and 48 h, respectively (Student's t-test, p < 0.05) (Fig. 2a). In contrast, p53-2 showed no significant change in this group with observations at the same time points (Student's t-test, p > 0.05) (Fig. 2b). On the other hand, only 5% and 1% of p53-2 was left in cells with p53-2-knockdown at 24 and 48 h, respectively, revealing statistically significant decreases (Student's ttest, p < 0.05) (Fig. 2c). However, a change in p53-1 was not observed in the same group (Student's t-test, p > 0.05) (Fig. 2d). Results revealed that a significant reduction in expression appeared only in C6/ 36 cells transfected with the corresponding dsRNA, reflecting that a mutual effect might be absent between the two paralogues of p53. 2.3. Association of the cell's fate with p53-2 in C6/36 cells with DENV2 infection

2. Results 2.1. Identification of p53 paralogues from C6/36 cells

We further evaluated the role of p53-2 in the death of C6/36 cells with DENV2 infection, by measuring the subG1 phase of cell-cycle progression. According to results, the cell death rate remained at ≤ 1% in all groups of cells with knockdown of p53-2, both when infected by the virus and not (Fig. 3a). Low cell death rates (< 1%) were also observed in mock- and DENV2-infected cells without knockdown of p53-2 at 48 hpi, while an obvious increase of cell death rate was seen in cells with p53-2 knockdown at 48 hpi (Fig. 3b). Statistically, an evident increase in the cell death rate was not seen in C6/36 cells at 24 hpi, even though p53-2 had been knocked down. On the other hand, a significant elevation in the cell death rate of up to 11.91% was detected at 48 hpi compared to the control groups (0.58% for cells without transfection and 0.73% for cells transfected with luciferase dsRNA) (Student's t-test, p < 0.01) (Fig. 3c). This implied that p53-2 indeed plays a role in regulating the fate in C6/36 cells during DENV2

Two p53 homologues (p53-1 and p53-2) were previously demonstrated in C6/36 cells which were derived from the Ae. albopictus mosquito. Using designed primer pairs from each sequence of the corresponding paralogue, the mRNA level of p53-1 was shown to have not significantly changed throughout the period of observation, i.e., 48 h of infection (< 1.32-fold increase) compared to that in mock-infected cells (Student's t-test; p > 0.05). In contrast, p53-2 remained near the baseline (a 1.13-fold increase) at 12 h post-inoculation (hpi); however, it had significantly increased to 2.27-fold at 24 and 2.37-fold at 36 hpi, and eventually reached 2.98-fold at 48 hpi (Fig. 1). This revealed that p53-2, but not p53-1, was responsive to DENV2 infection in C6/36 cells.

157

Virology 519 (2018) 156–169

T.-H. Chen et al.

Fig. 2. Evaluation on the mutual effect of p53-1 and p53-2 in C6/36 cells by knockdown of specific paralogues followed by measurement with a real-time RTPCR. (A) Compared to untreated control cells, 21% and 25% of p53-1 were left in cells transfected with p53-1 dsRNA for 24 and 48 h, respectively (Student's ttest, p < 0.05). Expression of p53-1 was not affected in cells transfected with dsRNA of luciferase which was used as an alternative control. (B) In the same treatment as (A), p53-2 did not change in the cells with p53-1 knockdown for 24 or 48 h (Student's t-test, p > 0.05) compared to that in the control groups. (C) In the groups with p53-2 knockdown, significant reductions with only 5% and 1% left were observed at 24 and 48 hpi, respectively (Student's t-test, p < 0.05). No significant change was shown in cells transfected with dsRNA of luciferase compared to cell sin the untreated control group. (D) No change in p53-1 was detected in the same group, i.e., knockdown of p53-2 (Student's t-test, p > 0.05). This indicates that there was no cross effect between p53-1 and p53-2 in C6/36 cells.

infection, especially at a later stage of infection.

2.6. The effect of p53-2 in regulating enzymatic activities of selected antioxidant genes in DENV2-infected C6/36 cells

2.4. ROS changes induced by p53-2 in C6/36 cells with DENV2 infection

The change in CAT's enzymatic activity was measured to determine its association with each of the p53 paralogues. No statistical difference in enzymatic activity was shown at 12–48 hpi for mock-infected C6/36 cells. Nevertheless, it had obviously increased in C6/36 cells with DENV2 infection, especially at 24, 36, and 48 hpi (one-way ANOVA, p < 0.05) (Fig. 6a). Looking at C6/36 cells with DENV2 infection, CAT activity had significantly decreased in cells with knockdown of p53-2, but not p53-1, particularly at 24, 36, and 48 hpi (Student's t-test, p < 0.01) (Fig. 6b). When CAT activity was measured in Ae. aegyptiderived CCL-125 with DENV2 infection, it was also shown to increase evidently (Supplemental Fig. S1a). Nevertheless, the enzymatic activity was significantly reduced in cells with knockdown of p53-2, especially at 36, and 48 hpi (Student's t-test, p < 0.01 and 0.05) (Supplemental Fig. S1b). The results clearly demonstrated the essentiality of p53-2 in regulating CAT activity in C6/36 cells and also CCL-125 cells in response to DENV2 infection. In addition, the enzymatic activities of other antioxidant genes, including SOD, GPx, and GST, were also measured in DENV2-infected C6/36 cells at the same time intervals. All of them were also shown to have increased at 24 hpi, and these increases persisted to 48 hpi (one-way ANOVA, p < 0.05) (Fig. 6c, e, g), indicating that DENV2 infection may activate antioxidant genes, while the virus continues to replicate. In an evaluation of the effect of specific p53 paralogues, none of their enzymatic activities showed significant changes in cells with knockdown of either p53-1 or p53-2 at any observed time points of infection (Fig. 6d, f, h). This revealed that CAT was relatively important and might be the only one regulated by p53-2 among the antioxidant genes in response to DENV2 infection.

In order to determine ROS changes in DENV2-infected C6/36 cells with p53-2-knockdown, accumulations of both superoxide anions and hydrogen peroxide (H2O2) were measured. Results showed that little change in superoxide anions was found at 24 hpi, while they had obviously increased at 48 hpi, compared to the control groups (Fig. 4a). Similarly, the amount of H2O2 had trivially changed at 24 hpi; however, it had evidently increased at 48 hpi (Fig. 4b). Statistically, neither superoxide anions (Fig. 4c) nor hydrogen peroxide (Fig. 4d) significantly increased until 48 hpi in C6/36 cells with p53-2-knockdown (Student's t-test, p < 0.01). Results revealed that ROS induced by DENV2 infection at 48 hpi in C6/36 cells might be regulated by upregulation of p532.

2.5. Identification of antioxidant genes regulated by p53 paralogues and expressed in C6/36 cells with DENV2 infection Six antioxidant genes, including SOD, GST, GPx, CAT, Grx, and Trx, were selected to evaluate their association with each of p53 paralogues using a real-time RT-PCR in C6/36 cells with DENV2 infection. No significant changes in gene expressions were seen in C6/36 cells with p53-1-knockdown and DENV2 infection at 24 and 48 hpi (Fig. 5a). On the other hand, the expression of CAT showed a significantly obvious decrease at 48 hpi (Student's t-test, p < 0.01), although the other five detected genes remained at similar expression levels in cells with p53-2knockdown (Fig. 5b). This suggested that p53-2 is specifically important in regulating CAT during antioxidant defense of C6/36 cells with DENV2 infection. To further confirm the effect of p53 paralogues on CAT expression during infection of C6/36 cells with DENV2, knockdown of each p53 paralogue followed by a real-time RT-PCR was performed. Results showed that p53-1 undoubtedly played no role in inducing CAT expression over the 48-h period of infection (Fig. 5c). In contrast, p53-2 was critically important in regulating CAT expression, principally at 36 and 48 hpi (Student's t-test, p < 0.01) (Fig. 5d).

2.7. Construction of a vector for p53-2 overexpression in C6/36 cells To construct an overexpressing vector, the p53-2 open reading frame consisting of 1299 nt with 433 encoded amino acids obtained from C6/36 cells was used to form pAC5.1-p53-2-HA (tagged with haemagglutinin (HA)). After transfection of the vector and detection by anti-HA antibodies, overexpression of p53-2-HA appeared throughout transfected C6/36 cells without DENV2 infection. However, the overexpressed recombinant protein had obviously aggregated in nuclei when transfected cells had been infected with DENV2 for 24 h, even 158

Virology 519 (2018) 156–169

T.-H. Chen et al.

Fig. 3. Cell fate associated with p53-2 in C6/36 cells with dengue 2 virus (DENV2) infection. The cell death rate was evaluated by observing the subG1 phase of cellcycle progression measured using flow cytometry. (A) Results showed that the cell death rate was as low as ≤ 1% in all groups of p53-2-knockdown cells with DENV2 for 24 h or mock infection. (B) The cell death rate remained at a low level at 48 h post-infection (hpi) in mock- and DENV2-infected cells without knockdown of p532; however, it had obviously increased in cells with p53-2 knockdown and DENV2 infection at 48 hpi. (C) Quantitatively, the cell death rate in the group with p53-2 knockdown had not significantly increased at 24 hpi, but showed a significant elevation of up to 11.91% at 48 hpi compared to the control groups (0.58% for cells without transfection and 0.73% for cells transfected with dsRNA of luciferase) (Student's t-test, p < 0.01). It seemed that p53-2 is important in regulating cell survival in response to DENV2 infection, but is not effective in an earlier stage of infection.

2.9. Alleviation of DENV2-induced oxidative stress by p53-2 overexpression in C6/36 cells with p53-2-knockdown

though viral antigens were mostly detected as being localize in the cytoplasm (Supplemental Fig. S2a). Further observations by Western blotting showed that p53-2-HA was easily detected in the control groups of C6/36 cells. It was also detected in cells in which p53-2 had been knocked down in advance, reflecting that the p53-2-overexpressing vector had been successfully constructed and may function to recover p53-2 in cells with previous p53-2 knockdown (Supplemental Fig. S2b).

To evaluate the effect of p53-2 overexpression on DENV2-induced endoplasmic reticular (ER) stress, the change in superoxide anion accumulation in response to DENV2 infection was first measured in C6/36 cells in which p53-2 had been knocked down in advance. Results revealed that little change appeared at 24 hpi in cells with p53-2 overexpression compared to that of cells transfected with an empty vector. However, an obvious reduction in superoxide anions was shown in cells with p53-2 overexpression (Fig. 8a). Statistically, there was a significant difference between cells in those two groups specifically at 48 hpi (Student's t-test, p < 0.05) (Fig. 8b). A similar changing trend in H2O2 levels was seen as with superoxide anions, i.e., little change at 24 hpi but and an obvious change at 48 hpi (Fig. 8c). Similarly, accumulation of H2O2 in cells overexpressing p53-2 was significantly reduced during DENV2 infection (Student's t-test, p < 0.05) (Fig. 8d). Both results demonstrated that ER stress induced by DENV2 infection was obviously alleviated by overexpression of p53-2 in C6/36 cells in which p53-2 had been knocked down in advance.

2.8. Effect of p53-2 recovery on CAT in C6/36 cells C6/36 cells in which p53-2 had been knocked down were subsequently transfected with the vector overexpressing p53-2 to recover its expression. CAT gene expression was effectively inhibited in cells with p53-2-knockdown compared to cells without treatment or cells with transfection of a vector containing the HA tag at 48 hpi. Results further showed that CAT gene expression significantly recovered after transfection with the p53-2-overexpressing vector compared to the control groups mentioned above (Student's t-test, p < 0.05) (Fig. 7a). Meanwhile, CAT enzymatic activity measured in the same groups of cells was revealed to be at a regular level compared to the control group, i.e., without overexpression of the p53-2, from 24 hpi (Student's t-test, p < 0.05) (Fig. 7b). 159

Virology 519 (2018) 156–169

T.-H. Chen et al.

Fig. 4. Changes in reactive oxygen species (ROS) induced in p53-2-knockdown C6/36 cells with dengue 2 virus (DENV2) infection. (A) When measuring ROS accumulated in DENV2-infected C6/36 cells with knockdown of p53-2 by flow cytometry, little change in superoxide anions was seen at 24 h post-infection (hpi), while an obvious increase was shown at 48 hpi compared to the control groups. (B) In cell with same treatment as (A), accumulation of hydrogen peroxide (H2O2) also changed trivially at 24 hpi, but it had obviously increased by 48 hpi. (C) Superoxide anions had statistically accumulated in C6/36 cells with p53-2-knockdown at 48 hpi compared to that in the control groups. (D) Hydrogen peroxide had also significantly accumulated in C6/36 cells with p53-2-knockdown at 48 hpi. Red: DENV-2-infected cells; Green: uninfected cells; Grey: blank cells (without fluorescent staining).

p < 0.01) (Fig. 10c). The results indicated that p53-2-regulated CAT activity actually plays a role to modulate the fate of cell in response to DENV2 infection.

2.10. Decrease in cell death by p53-2 overexpression in C6/36 cells with DENV2 infection p53-2-regulated cell death was further evaluated in DENV2-infected C6/36 cells in which p53-2 had been knocked down, by observing cell death rates in the subG1 phase of cell-cycle progression. The cell death rate did not significantly differ in p53-2-knockdown cells transfected with either a p53-2 overexpressing vector or an empty vector containing only the HA tag (0.45% and 0.70%, respectively) at 24 hpi (Fig. 9a). However, the cell death rate had increased to 6.15% for cells with p53-2 overexpression and to 10.73% for control group cells at 48 hpi (Fig. 9b). Infected cells with p53-2 overexpression presented a significantly lower cell death rate compared to those without p53-2 recovery at 48 hpi (Student's t-test, p < 0.01) (Fig. 9c). These results suggested that p53-2 is critical in reducing cell death in DENV2-infected C6/36 cells.

2.12. Enhanced production of DENV2 with p53-2 overexpression in C6/36 cells An enhanced effect of p53-2 on the production of DENV2 in C6/36 cells was demonstrated by a loss-and-gain strategy. In C6/36 cells transfected with dsRNA of luciferase, the viral titer was detected as 2.67 × 104 plaque-forming units (PFU)/ml at 24 hpi and 5.67 × 105 PFU/ml at 48 hpi. In cells of another group of p53-2-knockdown cells, the viral titer was 2.33 × 104 PFU/ml at 24 hpi and 4.33 × 105 PFU/ml at 48 hpi. As for p53-2-knockdown cells with recovery of p53-2 by transfection of a p53-2-overexpressing vector, the viral titer was evaluated to be 2.67 × 104 PFU/ml at 24 hpi and 5.67 × 105 PFU/ml, respectively, at 48 hpi. These results revealed that at 48 hpi, virus production was significantly depressed in cells in which p53-2 had been knocked down; however, it was evidently restored to a normal level after overexpression of the recombinant p53-2 (Student's t-test, p < 0.05) (Fig. 11).

2.11. Cell death rate evaluation after application with the catalase inhibitor to DENV2-infected C6/36 cells The CAT inhibitor (3-Amino-1,2,4-triazole) at a final concentration of 75 mM in the medium was used for culturing C6/36 cells with or without infection by DENV2. The cell death rates, either infected and/ or inhibitor-treated, did not show higher than 3.14% at 24 hpi, resulting in insignificant difference among all groups (Fig. 10a). The cell death rate increased up to 13.6% in DENV2-infected C6/36 cells treated with the inhibitor compared to that in uninfected cells (2.05%) as well as all cells infected by DENV2 but untreated with the inhibitor (1.23%) at 48 hpi (Fig. 10b), showing a significant difference (Student's t-test,

3. Discussion Dengue infections among humans are naturally transmitted through bites of mosquitoes which have acquired the DENV from a previous blood feeding on an infected human. The DENV in a blood meal ingested by the mosquito first infects the midgut and replicates in epithelial cells. Once produced, progeny of the virus surmount midgut 160

Virology 519 (2018) 156–169

T.-H. Chen et al.

Fig. 5. Catalase (CAT) is regulated by p53-2 among detected antioxidant genes in C6/36 cells during dengue 2 virus (DENV2) infection. (A) Antioxidant genes including superoxide dismutase (SOD), glutathione S-transferase (GST), glutathione peroxidase (GPx), CAT, glutaredoxin (Grx), and thioredoxin (Trx) were selected to evaluate their association with p53 paralogues using a real-time RT-PCR in DENV2-infected C6/36 cells. Significant difference of expression level was not seen in any detected genes in p53-1knockdown C6/36 cells with DENV2 infection at 24 or 48 h post-infection (hpi). (B) With the same genes detected in C6/36 cells with p53-2-knockdown, the expression of CAT appeared to be the only one that had significantly decreased at 48 hpi (Student's t-test, p < 0.01). (C) Regulation of CAT by p53 paralogues was further confirmed by performing specific knockdown of the paralogues. Results showed that p53-1 did not have an effect on CAT expression over the 48-h infection period. (D) In contrast, p53-2 played a significantly important regulatory role in CAT at 36 and 48 hpi (Student's t-test, p < 0.01).

Despite this, ROS which cause changes in the redox homeostasis were also detected in DENV2-infected mosquito cells, even though no obvious damage was exhibited by infected cells (Olagnier et al., 2014). Many observations have revealed that mosquito cells readily survive DENV2 infection through antioxidant defense and antiapoptotic effects (Chen et al., 2012, 2011). In the meantime, protein kinase RNA-like endoplasmic reticulum kinase (PERK) signaling pathway is also involved in promoting the survivability of dengue 2 virus-infected mosquito cells and also extending viral replication by the mode of modulating cellular protein (Hou et al., 2017). According to an investigation on expression profiles of midgut genes in Ae. aegypti susceptible to DENV, several key signaling genes were found to be expressed and to play roles in defending against infection (Chauhan et al., 2012). In fact, we recently identified two p53 paralogues, i.e., p53-1 and p53-2, in C6/ 36 cells. The nucleotide and amino acid sequences of both of them are highly similar to that found in D. melanogaster; in particular, they all possess a C-terminal sterile alpha motif (SAM) (Chen et al., 2017; Ollmann et al., 2000). In this study, we confirmed that the p53-2, but not the p53-1, paralogue is upregulated in response to DENV2 infection in C6/36 cells. This suggests that mosquito p53-2 plays an important role in cell/virus interactions during DENV2 infection in mosquito cells. As mentioned above, mosquito cells lack an apoptosis-inducing effect even when the DENV is prosperously replicating and generating ROS accumulation; however, cells inversely changed in this study after knockdown of p532. This indicates that p53-2 plays a role other than causing apoptosis, which usually occurs in mammalian cells with viral infection. As p53-2 was upregulated along with the time of infection, increasing ROS concentrations may be related to p53-2 expression. In fact, enhanced

infection/escape barriers (Franz et al., 2015), and disseminate into the hemocoel and ultimately reach their final destination, the salivary glands. It takes approximately 10–14 days of an extrinsic incubation period before transmission is possible (Salazar et al., 2007). Successful transmission of DENVs among humans is fully dependent on infected mosquito vectors which retain normal flight and biting behaviors. As a result, viral transmission may be influenced by a variety of biological and environmental factors (Carrington and Simmons, 2014). Virus infection in mammalian cells generally causes stress, which may activate p53 and its target genes, leading to DNA damage, cell growth arrest, senescence, and apoptosis (Riley et al., 2008). A study using human small airway lung epithelial cells with Rift Valley virus infection showed that p53 was induced and played a role in the apoptotic pathway of infected cells (Austin et al., 2012). A similar response of p53 was also observed in influenza virus-infected cells (Turpin et al., 2005). A model of virus infection in Drosophila melanogaster also showed that p53 was required to induce the reaper, a proapoptotic gene, in response to virus-induced stress, thus conveying viral resistance (Liu et al., 2013). Michelob_x (mx) is known to be the mosquito ortholog of the Drosophila reaper and is specifically induced in midgut cells following a baculovirus infection in Ae. aegypti larvae (Liu et al., 2011). These observations revealed that p53 is critical for regulating proapoptotic genes in mosquitoes with a pathogenic virus infection. The rapid induction of apoptosis was hypothesized to prevent expressions of viral genes and block the infection. It was presumed to be part of the host cell reaction to restrict viral infections. However, infection of mosquito cells by arboviruses such as DENV does not cause severe deleterious damage or apoptosis (Chen et al., 1994), and may result in persistent infection (Karpf and Brown, 1998).

161

Virology 519 (2018) 156–169

T.-H. Chen et al.

Fig. 6. The role of p53-2 in regulating in enzymatic activities of antioxidant genes by measuring optical density (OD) 570 nm. (A) Enzymatic activity of catalase (CAT) did not show an obvious increase until 24 h post-infection (hpi) through 48 hpi, in response to dengue 2 virus (DENV2) infection in C6/36 cells (one-way ANOVA, p < 0.05). (B) Statistically, no significant change in CAT enzymatic activity was seen in C6/36 cells with DENV2 infection at 24 hpi, while it was significantly reduced in cells when p53-2, but not p53-1 was knocked down especially at 24, 36, and 48 hpi (Student's t-test, p < 0.01). (C, E, G) Enzymatic activities of other antioxidant genes including superoxide dismutase (SOD), glutathione peroxidase (GPx), and glutathione S-transferase (GST) were also measured in DENV2infected C6/36 cells and showed no significant increase until 24 hpi (one-way ANOVA, p < 0.05). (D, F, G) Looking at the effects of the specific p53 paralogues on the antioxidant genes mentioned above, none of their enzymatic activities was affected in cells with knockdown of either p53-1 or p53-2 at each time point of infection. 162

Virology 519 (2018) 156–169

T.-H. Chen et al.

infection may open up an avenue for studies on interactions between arboviruses and host cells derived from humans or other mammals. As a transcription factor, p53 was reported to regulate a variety of stress-responsive genes and cell activities (Fridman and Lowe, 2003). For instance, p53 in mammalian cells may repress polymerase I transcription and thus result in cell growth restrictions (Zhai and Comai, 2000). In contrast, p53 was shown to protect cells against aberrant cell growth based on a study using a mouse model homozygous null for p53 (Donehower et al., 1992). In an investigation of p53-2 in mosquito cells with DENV2 infection, a panel of antioxidant genes was found to be upregulated in infected cells (Chen et al., 2011). Uniquely, only CAT was identified to be regulated since its gene expression and enzymatic activity were specifically reduced in DENV2-infected C6/36 cells with p53-2-knockdown. CAT is a hydrogen peroxide-inactivating enzyme that functions to break down hydrogen peroxide into water and oxygen and thus relieve cellular oxidative stress (Fita and Rossmann, 1985). Although intracellular free hydrogen peroxide can be reduced to water by GPx (Ng et al., 2007), we herein demonstrated that hydrogen peroxide accumulation was greatly reduced after p53-2 recovered from being knocked down in DENV-infected C6/36 cells. This suggests that p53-2 acts as a transcription factor that selectively transcribes CAT, which is known to convert hydrogen peroxide and alleviate ROS accumulation within cells (Liu et al., 2008). It is known that different antioxidant enzymes may be regulated by different transcription factors (Miao and St Clair, 2009). Nuclear factor (NF)-κB and activator protein (AP)-1 are two well-defined transcription factors with respect to the intracellular redox state (Sen and Packer, 1996). A variety of genes directly involved in the pathogenesis of many human diseases were reported to function by binding these transcription factors with their promoter regions (Sen and Packer, 1996). NF-E2 p45-related factor (Nrf2) is another primary transcription factor involved in regulating a group of oxidative genes, e.g., heme oxygenase (HO)-1 and MSP23 (Ishii et al., 2000). GST is an important antioxidant protein and was reported to be mediated by Nrf2 (Ho et al., 2005; Li et al., 2004). It was not directly regulated by p53-2 in DENV2-infected C6/36 cells according to results of the present study. This further suggests that stress-induced host genes involved in determining a cell's fate may be regulated by different transcription factors. So far, how p53-2 controls CAT expression and enzymatic activity remains to be worked out. Although it could be a direct control process, an indirect pathway via an interacting protein, such as p53R2, may also possibly function to rescue cells (Kang et al., 2013). p53R2 encoding ribonucleotide reductase is known to be directly involved in the p53 checkpoint for repairing damaged DNA (Tanaka et al., 2000). This study presents a regulatory redox mechanism associated with the newly identified p53-2 and its activating target CAT. Overall, p53-2 was upregulated by virus-induced ROS and functions to cope with ROS accumulation in DENV2-infected C6/36 cells. Eventually, the pro-survival CAT gene was transcribed by upregulated p53-2, leading to alleviation of stress caused by ROS and a reduction in the apoptosis rate. The survival of infected cells provides a circumstance suitable for producing a large number of DENV2 progeny which can subsequently be transmitted to other cells. This may account for arboviral dissemination from the initial site in the midgut epithelium to the destination in salivary glands (Carrington and Simmons, 2014). In turn, infected mosquitoes can maintain their normal flight and biting behaviors and are thus capable of serving as vectors for virus transmission.

Fig. 7. Recovery of catalase (CAT) after p53-2 was overexpressed in C6/36 cells with preceding p53-2 knockdown. (A) C6/36 cells with preceding knockdown of p53-2 were subsequently transfected with a p53-2-overexpressing vector. The expression of CAT was inhibited at 48 h post-infection (hpi), which was significantly recovered after the p53-2-overexpression (Student's t-test, p < 0.05). However, recovery of CAT was not observed in cells of control groups, including the one transfected with an empty vector. (B) The enzymatic activity of CAT was also measured as the method mentioned above, and results showed that it had recovered to a normal level compared to cells without p53-2 overexpression at 24 hpi, and that persisted to 48 hpi (Student's t-test, p < 0.05).

expression of p53 was also found in Bombyx mori-derived cells exposed to H2O2 (Chen et al., 2015), revealing the association of these two parameters. p53 in mammalian cells was reported to function in two ways, as a pro-oxidant and an antioxidant, under oxidative stress (Vurusaner et al., 2012). It may restrict abnormal cells by triggering apoptosis, but it also protects the genome from oxidation usually in a status without severe cellular stress (Sablina et al., 2005). The present results showed that accumulation of ROS (both superoxide anions and hydrogen peroxide) increased in DENV2-infected C6/ 36 cells with p53-2-knockdown. This reflects that relief of ROS accumulation induced by DENV2 infection in mosquito cells is mediated by p53-2. In other words, p53-2 may have a positive effect of facilitating cell growth by reducing virus-induced stress. To further confirm the role of p53-2 in DENV2 infection, a recombinant protein was overexpressed to recover its expression in p53-2-knockdown cells. Results showed that both ROS accumulation and the apoptosis rate were significantly reduced, resulting in a high survival rate of cells with DENV2 infection. As mentioned above, mammalian cells infected with the DENV usually end up undergoing apoptosis soon after infection (Yu et al., 2006). The dynamic responses of mosquito cells with DENV2

4. Materials and methods 4.1. Virus and cell culture DENV2 (New Guinea C strain) was propagated in Aedes albopictusderived C6/36 cells which were cultured in minimal essential medium (MEM; GIBCO™, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS), 2% non-essential amino acids, 2 g/ml 163

Virology 519 (2018) 156–169

T.-H. Chen et al.

Fig. 8. Alleviation of dengue 2 virus (DENV2)-induced oxidative stress by overexpression of p53-2 in C6/36 cells with p53-2 knockdown. (A) The effect of p53-2 overexpression was further evaluated on DENV2-induced endoplasmic reticular (ER) stress in C6/36 cells in which p53-2 had been knocked down. Results based on flow cytometry revealed that accumulation of superoxide anions had changed insignificantly at 24 h post-infection (hpi) in cells even though p53-2 in the cells had recovered, while it was evidently reduced to a relevantly low level at 48 hpi in cells transfected with the p53-2-overexpressing construct compared to that transfected with an empty vector. (B) Statistically, there was a significant difference between DENV2-infected cells in which overexpression of p53-2 had recovered by 48 hpi (Student's t-test, p < 0.05). (C) For H2O2 detection, a similar changing trend as that seen for superoxide anions was shown. Little change was shown at 24 hpi, but an evident change was detected at 48 hpi. (D) Statistically, cells with p53-2 recovery accumulated much less H2O2 than in the control groups (Student's t-test, p < 0.05). The results imply that the oxidative stress induced by DENV2 infection was alleviated after recovery of p53-2 in C6/36 cells in which p53-2 had been knocked down. Red: cells transfected with dsp53-2 +p53-2HA or dsp53-2+empty vector; Green: cells transfected with dsp53-2 only; Grey: blank cells (without fluorescent staining).

shaking every 10–20 min for adsorption. After discarding the viral suspension in each well, monolayers were overlaid with 4 ml of 1.1% methyl cellulose in MEM containing 5% FBS. After incubation for 4–5 days at 37 °C, cells were fixed with 10% formaldehyde for 1 h, then stained with 1% crystal violet for at least 15 min. Calculation of viral titers was based on the number of plaques formed in each well, which was expressed as plaque-forming units (PFU)/ml.

Hepes, 2.2 g/ml sodium bicarbonate (NaHCO3), and 0.4% antibioticantimycotic at 28 °C in a closed system. The virus was titrated as described previously in baby hamster kidney (BHK)-21 cells (Lin et al., 2007), which were maintained in MEM containing 10% FBS, 2% nonessential amino acids, 2.2 g/ml NaHCO3, and 0.4% antibiotic-antimycotic at 37 °C with a 5% CO2 atmosphere.

4.2. Virus titration 4.3. Cell infection and RNA extraction ENV2 were titrated by a plaque assay following the description in a previous report (Lin et al., 2007). Briefly, 4 × 104 BHK-21 cells were seeded in each well of 6-well plates at 37 °C for 1–2 days. Viral samples were serially 10-fold-diluted with fresh MEM containing 5% FBS. Each aliquot of 70 μl of diluted viral suspensions was added to a monolayer in each well, and allowed to stand for 40 min at 37 °C with gentle

C6/36 cells (~ 107 cells/tube) were harvested and centrifuged at 3000 rpm and 4 °C for 10 min. After removing the medium, the DENV2 viral suspension or medium (mock infection as the control) was added to the tubes at a multiplicity of infection (MOI) of 1 for incubation at 28 °C for 1 h with gentle agitation every 15 min. Then, the viral 164

Virology 519 (2018) 156–169

T.-H. Chen et al.

4.4. Real-time RT-PCR To detect changes in gene expression, a real-time RT-PCR was performed with SYBR Green PCR Master Mix using primers designed for each target gene on an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The relative level of messenger (m)RNA expression was determined by dividing the threshold cycle (Ct) of each sample by that of the 18S ribosomal (r)RNA gene, which was the calibrator or internal control, according to the formula: ΔCt = Ct (sample) - Ct (calibrator) (Walter-Yohrling et al., 2003). Primers used to amplify selected genes included a specifically designed forward primer and a reverse primer; while those for amplifying the 18S rRNA gene were designed from a previously reported sequence (Baldridge and Fallon, 1991). Comparative expression levels of detected mRNAs between cells infected by DENV2 and that with mock infection were then calculate by the formula 2-ΔΔCt where ΔΔCt = ΔCt (virusinfected sample) - ΔCt (mock-infected sample). 4.5. Quantitative detection of p53 gene expression The expression level of the p53 gene in C6/36 cells infected by DENV2 (at an MOI of 1, 24 h post-infection (hpi)) was quantitated by a real-time RT-PCR as described above. Practically, infected and uninfected cells were subjected to RNA extraction and reverse-transcribed to complementary (c)DNAs. Reagents used for the experiment included forward and reverse primers (2.5 μM), 10 μl of a KAPA SYBR FAST qPCR Kit (KAPABIOSYSTEM, Boston, MA, USA), 4 μl of a cDNA template, and 5.2 μl double-distilled (dd)H2O to a final volume of 20 μl. The protocol for thermal cycling was set to 10 min of AmpliTaq activation at 95 °C and 40 amplification cycles consisting of 15 s of denaturing at 95 °C and 60 s of annealing/extension at 60 °C for each cycle. Ct numbers were established to calculate the multiples of change. Levels of 18 S rRNA designed from the genome of Ae. albopictus were included in parallel with specific genes as the internal control for normalization. The primer pair used in this study included a forward (p53_QSF: AAG AACGAACAGGTCAACTACAC) and reverse primer (p53_QSR: CCGTAG CCCGCCGATTAATGT). 4.6. Preparation of double-stranded (ds)RNA for knockdown of p53 dsRNA synthesis MEGAscript® RNAi Kit (Ambion, Austin, TX, USA) was used in this experiment. First, we designed a pair of T7 promotertarget gene primers and performed the PCR experiment to amplify the T7-p53 sequence. After completing the PCR, reagents including 2 μl 10x T7 reaction buffer, 2 μl of ATP, CTP, UTP, GTP, and the T7 enzyme mix, and 2 μg of the PCR product were added to a new microtube to a final volume of 20 μl, and incubated at 37 °C overnight. After in vitro transcription, 21 μl DEPC-treated H2O, 5 μl 10x digestion buffer, and 2 μl RNase were added to dsRNA newly synthesized in the previous step, 523 and 576 bp for p53-1 and p53-2, respectively, and then incubated at 37 °C for 1 h. After purification of the digested dsRNA, 50 μl dsRNA, 50 μl 10x binding buffer, 150 μl DEPC-H2O, and 250 μl 100% alcohol were added and gently mixed. Subsequently, 500 μl of the mixture was added to the filter cartridge and centrifuged at 14,000 rpm for 2 min. A wash solution was used to wash the filter cartridge twice, and it was then centrifuged at the maximum speed for 30 s. Finally, 100 μl of elution buffer pre-warmed to 95 °C was added to the filter cartridge, incubated at 65 °C for 5 min, and then centrifuged again at 14,000 rpm for 2 min. Then, 100 μl of elution solution was added, the previous step was repeated, 200 μl of elution buffer was mixed, and the concentration was detected and verified the size by electrophoresis on 2% agarose gel. Primers used for dsRNA synthesis in this experiment included the pair for p53-2 (T7-p53-2F: TAATACGACTCACTATAGGGAGAGCCTCACAG GATTACGAACTG and T7-p53-2R: TAATACGACTCACTATAGGGAGAG AGGAGTTCTGGCAAACGAA) and that for p53-1 (C6_p53-1-T7F: 5TAATACGACTCACTATAGGGAGAGCGGTTGAACAAAGTCTTCG and

Fig. 9. The role of p53-2 in reducing cell death of C6/36 cells with dengue 2 virus (DENV2) infection. The cell death rate was evaluated by observing the subG1 phase of cell-cycle progression measured using flow cytometry. (A) The p53-2-regulated cell fate of DENV2-infected C6/36 cells was evaluated by observing cell death at the subG1 phase of cell-cycle progression. The cell death rate of p53-2-knockdown cells remained at a low level (both at < 1%) in cells both with and without p53-2 recovery at 24 hpi. However, it had increased to > 10.73% in cells with p53-2 in the control at 48 hpi, while it was 6.15% for those cells with p53-2 recovery. (B) Very clearly, infected cells with p53-2 overexpression presented a significantly lower cell death rate than those with mock-transfection at 48 hpi, although it was higher than uninfected cells (Student's t-test, p < 0.01). It seemed that p53-2 is important for reducing cell death during DENV2 infection.

suspension was removed by centrifugation; pelleted cells were seeded and incubated at 28 °C for 24 h. The RNA extraction procedure and reverse-transcription polymerase chain reaction (RT-PCR) were performed as described previously (Lin et al., 2007). In brief, total RNA was isolated from both mock- and DENV2-infected C6/36 cells using the Trizol reagent (Invitrogen) following the protocol in the manual provided by the manufacturer.

165

Virology 519 (2018) 156–169

T.-H. Chen et al.

Fig. 10. Evaluation on cell death rate modulated by catalase (CAT) by applying the catalase inhibitor to C6/36 cells with DENV2 infection. The CAT inhibitor (3Amino-1,2,4-triazole) at a final concentration of 75 mM in the culture medium was used to treat C6/36 cells either infected by DENV2 or not. (A) The cell death rates of C6/36 cells, either infected or treated by the inhibitor or not, did not show higher than 3.14% at 24 hpi, resulting in insignificant difference among all groups. (B) In contrast, the cell death rate increased up to 13.6% in DENV2-infected C6/36 cells treated with the inhibitor at 48 hpi while 2.28%.was shown in uninfected cells and 2.22% in as cells infected by DENV2 but untreated with the inhibitor, (C) The results revealed a significant difference (Student's t-test, p < 0.01), indicating that p53-2-regulated CAT activity actually modulates the cell fate in consequence.

(filled up to 1 ml of final volume with transfection medium) which was subsequently added to cells prewashed with transfection medium in each well of six-well plates. After incubation for 5 h at 28 °C, the transfection mix reagent was removed, and cells in each well were washed. Subsequently, 3 ml of 10% FBS MEM was added to the wells and incubated for 24 h at 28 °C. After cells were cultured for another 24 or 48 h, they were subjected to a real-time RT-PCR using the primer pair consisting of p53_QSF (AAGAACGAACAGGTCAACTACAC) and p53_QSR (CCGTAGCCCGCCGATTAATGT).

C6_p53-1- T7R: 5-TAATACGACTCACTATAGGGAGATATCGCTCTTACG CTTGGTC). 4.7. Confirmation for the efficiency of p53 knockdown by a real-time RTPCR To knock down p53 using synthesized p53 dsRNAs, 2 μg of the dsRNAs and 8 μl of FuGENEH HD (Roche, Berlin, Germany) were first added to each microtube containing 100 μl of transfection medium in the absence of FBS and antibiotics. The microtubes were then incubated at room temperature for 15 min to become the transfection mix reagent 166

Virology 519 (2018) 156–169

T.-H. Chen et al.

3.0 (Verity Software House, Topsham, ME, USA) with a FACScan flow cytometer (BD Biosciences, San Jose, CA, USA). To observe the effect of CAT on the cell fate, cell death rate was evaluated by the same method except for application of 3-Amino-1,2,4-triazole (catalase inhibitor; Sigma) by adding it into the culture medium at a final concentration of 75 mM. 4.10. Detection of antioxidant genes from DENV2-infected cells with knockdown of p53 homologues A real-time RT-PCR was used to detect selected antioxidant genes (SOD, GST, GPx, CAT, GRX, and TRX) in DENV2-infected C6/36 cells with knockdown of p53-1 or p53-2. In brief, p53-1 or p53-2 dsRNA was separately transfected into C6/36 cells, followed by DENV2 infection for 24 or 48 h. Cells were then harvested to measure expression of each gene with a real-time RT-PCR with corresponding primer pairs as listed below: SOD_RTF: 5′-GTCAAGGGCACCATCTTCTTC and RTR: 5′-CGAA CTCGTGGATGTGGAATC; GST_RTF: 5′-ACCGAGGATTATGCCAAGATG and RTR: 5′-TCGCACAAATACTGGAGGATG; GPX_RTF: 5′-TGGTTTGT CATTTGCGAGAC and RTR: 5′-TGCTTGTGCTTCAGATACTTG; CAT_RTF: 5′-GTTCCAGGTATCGAGGCATCC and RTR:5′-GCGGTACGG GCAGTTGAC; GRX_RTF: 5′-CCTGAACAACCCCTTCCGTAA and RTR: 5′-AGCAGCGTCGGCAGTTGAC; and TRX_RTF: 5′-GTGGTGGACTTTTT CGCCA and RTR: 5′-TCCACGTCGACCTTGATGAA.

Fig. 11. Enhanced dengue 2 virus (DENV2) production by p53-2 in C6/36 cells. To evaluate the effect of p53-2 on DENV2 production in C6/36 cells, virus titers were measured by a plaque assay based on a gene loss-and-gain strategy. Results showed that the control group of C6/36 cells which were transfected with double-stranded (ds)RNA of luciferase had produced a virus titer of 2.67 × 104 plaque-forming units (PFU)/ml at 24 h post-infection (hpi) and 5.67 × 105 PFU/ml at 48 hpi. The other group of p53-2-knockdown cells had produced virus titers of 2.33 × 104 and 4.33 × 105 PFU/ml at 24 and 48 hpi, respectively. After recovery of p53-2 by transfection with an overexpressing vector, the virus titer in those cells was 2.67 × 104 PFU/ml at 24 hpi, while it was 5.67 × 105 PFU/ml at 48 hpi. Results showed that at 48 hpi, the produced virus titer was significantly depressed in cells with p53-2-knockdown but it can be been restored to a normal level by overexpression of recombinant p53-2 (Student's t-test, p < 0.05).

4.11. Construction of a p53-2-overexpressing vector An overexpressing vector pAC5.1-A-p53-eGFP was created by replacing the enhanced green fluorescent protein (eGFP) with a haemagglutinin (HA) tag from a previously constructed vector (Yang et al., 2015). Briefly, the pAC5.1-A-p53-eGFP vector was treated with restriction enzymes, Xhol and Apal, to remove the eGFP fragment. The purified pAC5.1-A-p53 vector was mixed with 20 μl of the primers (100 μM) Xhol-HA-STOP-Apal-F (5′-TCGAGATGTACCCATACGATGTTC CCAGATTACGCTTAAGGGCC-3′) and Xhol-HA-STOP-Apal-R (5′-CTTA AGAGTAATCTGGAACATCGTATGGGTACAT-3′) and then incubated for 10 min at 95 °C to insert the HA fragment and form the pAC5.1-A-p53HA vector. The efficiency of p53-2 overexpression was detected by an immunofluorescent antibody assay (IFA) at 24 h after transfection with the pAC5.1-A-p53-HA vector. The construct was then used in cells for overexpression or recovery of p53-2.

4.8. Detection of superoxide anions and hydrogen peroxide in virus-infected cells Methods for these experiments followed a previously described protocol (Chen et al., 2012). A monolayer of C6/36 cells (with or without transfection of p53 dsRNA) infected with DENV2 at an MOI of 1 in a Petri dish (10 cm in diameter) was washed with phosphate-buffered saline (PBS; pH 7.3), and then treated with trypsin-EDTA for 5 min. To detect superoxide anions, 1 ml of PBS containing 10% FBS was added to the dish, and cells were incubated with 10 μM dihydroethidium (Sigma-Aldrich, St. Louis, MO, USA) at 28 °C in the dark for 30 min. To detect hydrogen peroxide, cells were incubated with 10 µM 2′,7′-dichlorofluorescein (CM-H2DCFDA) (Sigma-Aldrich) at 28 °C in the dark for 30 min. Cells were then harvested and subjected to analysis by a fluorescence-activated cell sorter (FACScalibur, Becton Dickinson, Immunofluorometry Systems, Mountain View, CA, USA) with excitation at 535 nm and emission at 610 nm (for superoxide anion) or excitation at 492–495 nm and emission at 517–527 nm (for H2O2).

4.12. Immunofluorescent antibody assay (IFA) About 2 × 106 transfected C6/36 cells were plated in 6-well culture plates for 24 h. A DENV2 suspension was added to each well and allowed to be adsorbed for 1 h, and then the mixture was incubated for another 24 h. Cells were fixed with 4% paraformaldehyde and subsequently treated with 0.1% Triton X-100 for 2 min to increase the permeability. Primary antibodies including a rabbit anti-HA antibody and mouse anti-DENV2 monoclonal antibody (4G2), followed by secondary antibodies of anti-rabbit Dylight 594(1:100) and anti-mouse Alexa 488 (1:100), were used to respectively detect HA (in red) and the DENV2 (in green). 4′-6-Diamidino-2-phenylindole (DAPI) which presents as blue was also used as an indicator of cell nuclei. Prepared specimens were then observed under a laser scanning confocal microscope (Zeiss LSM 510, Vertrieb, Germany).

4.9. Cell death measured with propidium iodide (PI) nucleic acid staining C6/36 cells (~ 2 × 106 cells/ tube) with or without transfection of p53 dsRNA were collected and subsequently infected with the DENV2 at an MOI of 1. At 24 and 48 hpi, cells (infected or uninfected) were harvested and centrifuged at 1000 rpm and 4 °C for 5 min. After the supernatant was removed, the cell pellet was fixed with ice-cold 70% ethanol in a − 20 °C freezer for at least 1 h. Cells were centrifuged again at 1500 rpm and 4 °C for 5 min, and washed with PBS after the fixation solution had been discarded. These cells were treated with 0.5% Triton X-100% and 0.05% RNase A (Sigma) in PBS for 1 h at 37 °C. After a final centrifugation, pelleted cells were stained with 50 μg/ml of PI (Sigma) in PBS at 37 °C for 20 min and then stored at 4 °C in the dark. The cellular DNA content was measured using ModFit LT software version

4.13. Assay for enzymatic activity of GST The monolayer of C6/36 (with or without transfection of p53-1 or p53-2 dsRNA) was infected by the DENV2 at an MOI of 1. After being washed twice with PBS, cells were harvested by scraping at 12-h intervals until 48 hpi and then centrifuged at 3000 rpm for 10 min. Collected cells were disrupted by a tissue grinder containing the sample buffer which was attached to the GST Colorimetric Activity Assay Kit 167

Virology 519 (2018) 156–169

T.-H. Chen et al.

(BioVision, Milpitas, CA, USA), followed by centrifugation at 104 g for 15 min at 4 °C. The supernatant was then harvested to evaluate GST activity using the protocol provided by the manufacturer of the kit. GST activity measured by this method was expressed as U/ml.

emphasis on its paralogues in mosquitoes. J. Microbiol. Immunol. Infect. 50, 747–754. Chen, W.J., Chen, S.L., Fang, A.H., 1994. Phenotypic characteristics of dengue 2 virus persistently infected in a C6/36 clone of Aedes albopictus cells. Intervirology 37, 25–30. Chen, W.J., Hwang, K.P., Fang, A.H., 1991. Detection of IgM antibodies from cerebrospinal fluid and sera of dengue fever patients. Southeast Asian J. Trop. Med. Public Health 22, 659–663. Donehower, L.A., Harvey, M., Slagle, B.L., McArthur, M.J., Montgomery Jr., C.A., Butel, J.S., Bradley, A., 1992. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215–221. Fan, Y., Lee, T.V., Xu, D., Chen, Z., Lamblin, A.F., Steller, H., Bergmann, A., 2010. Dual roles of Drosophila p53 in cell death and cell differentiation. Cell Death Differ. 17, 912–921. Fita, I., Rossmann, M.G., 1985. The active center of catalase. J. Mol. Biol. 185, 21–37. Franz, A.W., Kantor, A.M., Passarelli, A.L., Clem, R.J., 2015. Tissue barriers to arbovirus infection in mosquitoes. Viruses 7, 3741–3767. Fredericks, A.C., Fernandez-Sesma, A., 2014. The burden of dengue and chikungunya worldwide: implications for the southern United States and California. Ann. Glob. Health 80, 466–475. Fridman, J.S., Lowe, S.W., 2003. Control of apoptosis by p53. Oncogene 22, 9030–9040. Gebhard, L.G., Filomatori, C.V., Gamarnik, A.V., 2011. Functional RNA elements in the dengue virus genome. Viruses 3, 1739–1756. Gubler, D.J., 1998. Dengue and dengue hemorrhagic fever. Clin. Microbiol. Rev. 11, 480–496. Gubler, D.J., 2002. Epidemic dengue/dengue hemorrhagic fever as a public health, social and economic problem in the 21st century. Trends Microbiol. 10, 100–103. Gudkov, A.V., 2002. Converting p53 from a killer into a healer. Nat. Med. 8, 1196–1198. Guzman, M.G., Halstead, S.B., Artsob, H., Buchy, P., Farrar, J., Gubler, D.J., Hunsperger, E., Kroeger, A., Margolis, H.S., Martinez, E., Nathan, M.B., Pelegrino, J.L., Simmons, C., Yoksan, S., Peeling, R.W., 2010. Dengue: a continuing global threat. Nat. Rev. Microbiol. 8, S7–S16. Ho, H.K., White, C.C., Fernandez, C., Fausto, N., Kavanagh, T.J., Nelson, S.D., Bruschi, S.A., 2005. Nrf2 activation involves an oxidative-stress independent pathway in tetrafluoroethylcysteine-induced cytotoxicity. Toxicol. Sci. 86, 354–364. Hollstein, M., Sidransky, D., Vogelstein, B., Harris, C.C., 1991. p53 mutations in human cancers. Science 253, 49–53. Holmes, E.C., 1998. Molecular epidemiology and evolution of emerging infectious diseases. Br. Med. Bull. 54, 533–543. Hou, J.N., Chen, T.H., Chiang, Y.H., Peng, J.Y., Yang, T.H., Cheng, C.C., Sofiyatun, E., Chiu, C.H., Chiang-Ni, C., Chen, W.J., 2017. PERK signal-modulated protein translation promotes the survivability of dengue 2 virus-infected mosquito cells and extends viral replication. Viruses 9, 262. Ishii, T., Itoh, K., Takahashi, S., Sato, H., Yanagawa, T., Katoh, Y., Bannai, S., Yamamoto, M., 2000. Transcription factor Nrf2 coordinately regulates a group of oxidative stressinducible genes in macrophages. J. Biol. Chem. 275, 16023–16029. Kang, M.Y., Kim, H.B., Piao, C., Lee, K.H., Hyun, J.W., Chang, I.Y., You, H.J., 2013. The critical role of catalase in prooxidant and antioxidant function of p53. Cell Death Differ. 20, 117–129. Karpf, A.R., Brown, D.T., 1998. Comparison of Sindbis virus-induced pathology in mosquito and vertebrate cell cultures. Virology 240, 193–201. Li, N., Alam, J., Venkatesan, M.I., Eiguren-Fernandez, A., Schmitz, D., Di Stefano, E., Slaughter, N., Killeen, E., Wang, X., Huang, A., Wang, M., Miguel, A.H., Cho, A., Sioutas, C., Nel, A.E., 2004. Nrf2 is a key transcription factor that regulates antioxidant defense in macrophages and epithelial cells: protecting against the proinflammatory and oxidizing effects of diesel exhaust chemicals. J. Immunol. 173, 3467–3481. Lin, C.C., Yang, C.F., Tu, C.H., Huang, C.G., Shih, Y.T., Chuang, C.K., Chen, W.J., 2007. A novel tetraspanin C189 upregulated in C6/36 mosquito cells following dengue 2 virus infection. Virus Res. 124, 176–183. Liu, B., Becnel, J.J., Zhang, Y., Zhou, L., 2011. Induction of reaper ortholog mx in mosquito midgut cells following baculovirus infection. Cell Death Differ. 18, 1337–1345. Liu, B., Behura, S.K., Clem, R.J., Schneemann, A., Becnel, J., Severson, D.W., Zhou, L., 2013. P53-mediated rapid induction of apoptosis conveys resistance to viral infection in Drosophila melanogaster. PLoS Pathog. 9, e1003137. Liu, B., Chen, Y., St Clair, D.K., 2008. ROS and p53: a versatile partnership. Free Radic. Biol. Med. 44, 1529–1535. Marianneau, P., Flamand, M., Deubel, V., Despres, P., 1998. Induction of programmed cell death (apoptosis) by dengue virus in vitro and in vivo. Acta Cient. Venez. 49 (Suppl. 1), S13–S17. Mates, J.M., Perez-Gomez, C., Nunez de Castro, I., 1999. Antioxidant enzymes and human diseases. Clin. Biochem. 32, 595–603. Miao, L., St Clair, D.K., 2009. Regulation of superoxide dismutase genes: implications in disease. Free Radic. Biol. Med. 47, 344–356. Morchang, A., Yasamut, U., Netsawang, J., Noisakran, S., Wongwiwat, W., Songprakhon, P., Srisawat, C., Puttikhunt, C., Kasinrerk, W., Malasit, P., Yenchitsomanus, P.T., Limjindaporn, T., 2011. Cell death gene expression profile: role of RIPK2 in dengue virus-mediated apoptosis. Virus Res. 156, 25–34. Mukhopadhyay, S., Kuhn, R.J., Rossmann, M.G., 2005. A structural perspective of the flavivirus life cycle. Nat. Rev. Microbiol. 3, 13–22. Mustafa, M.S., Rasotgi, V., Jain, S., Gupta, V., 2015. Discovery of fifth serotype of dengue virus (DENV-5): a new public health dilemma in dengue control. Med. J. Armed Forces India 71, 67–70. Nasirudeen, A.M., Wang, L., Liu, D.X., 2008. Induction of p53-dependent and mitochondria-mediated cell death pathway by dengue virus infection of human and animal cells. Microbes Infect. 10, 1124–1132.

4.14. Assays for enzymatic activities of SOD, CAT, and GPx Cell preparations followed that the method described above for detecting the enzymatic activity of GST. To detect that of SOD, collected cells were disrupted with a tissue grinder in ice-cold 0.1 M Tris/ HCL (pH 7.4) containing 0.5% Triton X-100, 5 mM β-ME, and 0.1 mg/ ml PMSF, followed by centrifugation at 14,000 g for 5 min at 4 °C. The supernatant was then harvested, and the activities of SOD, CAT, and GPx were determined by measuring optical density (OD) at 570 nm in a plate reader following the protocol of corresponding assay kits provided by the manufacturer (BioVision). 5. Statistical analysis Statistical analyses for parametric data were performed using Student’s t-test (for two groups) or one-way ANOVA (more than two groups) with a significant difference at *p < 0.05, **p < 0.01, and ***p < 0.001. Acknowledgments The authors thank Mr. Tsong-Han Yang and Ms. Der-Jen Tang fort their assistance with the analytical techniques. This study was financially supported by a grant from the Ministry of Science and Technology, Taiwan (MOST103-2320-B-182-029-MY3) and grants from Chang Gung Memorial Hospital (CMRPD1E0201–2 and CMRPD1F0321–3). Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.virol.2018.04.011. References Austin, D., Baer, A., Lundberg, L., Shafagati, N., Schoonmaker, A., Narayanan, A., Popova, T., Panthier, J.J., Kashanchi, F., Bailey, C., Kehn-Hall, K., 2012. p53 Activation following Rift Valley fever virus infection contributes to cell death and viral production. PLoS One 7, e36327. Baldridge, G.D., Fallon, A.M., 1991. Nucleotide sequence of a mosquito 18S ribosomal RNA gene. Biochim. Biophys. Acta 1089, 396–400. Bhatt, S., Gething, P.W., Brady, O.J., Messina, J.P., Farlow, A.W., Moyes, C.L., Drake, J.M., Brownstein, J.S., Hoen, A.G., Sankoh, O., Myers, M.F., George, D.B., Jaenisch, T., Wint, G.R., Simmons, C.P., Scott, T.W., Farrar, J.J., Hay, S.I., 2013. The global distribution and burden of dengue. Nature 496, 504–507. Borras, C., Gomez-Cabrera, M.C., Vina, J., 2011. The dual role of p53: DNA protection and antioxidant. Free Radic. Res. 45, 643–652. Brady, C.A., Attardi, L.D., 2010. p53 at a glance. J. Cell Sci. 123, 2527–2532. Budanov, A.V., 2014. The role of tumor suppressor p53 in the antioxidant defense and metabolism. Subcell. Biochem. 85, 337–358. Budde, A., Grummt, I., 1999. p53 represses ribosomal gene transcription. Oncogene 18, 1119–1124. Carrington, L.B., Simmons, C.P., 2014. Human to mosquito transmission of dengue viruses. Front. Immunol. 5, 290. Chauhan, C., Behura, S.K., Debruyn, B., Lovin, D.D., Harker, B.W., Gomez-Machorro, C., Mori, A., Romero-Severson, J., Severson, D.W., 2012. Comparative expression profiles of midgut genes in dengue virus refractory and susceptible Aedes aegypti across critical period for virus infection. PLoS One 7, e47350. Chen, P., Hu, Y.F., Wang, L., Xiao, W.F., Bao, X.Y., Pan, C., Yi, H.S., Chen, X.Y., Pan, M.H., Lu, C., 2015. Mitochondrial apoptotic pathway is activated by H2O2-mediated oxidative stress in BmN-SWU1 cells from Bombyx mori ovary. PLoS One 10, e0134694. Chen, T.H., Lo, Y.P., Yang, C.F., Chen, W.J., 2012. Additive protection by antioxidant and apoptosis-inhibiting effects on mosquito cells with dengue 2 virus infection. PLoS Negl. Trop. Dis. 6, e1613. Chen, T.H., Tang, P., Yang, C.F., Kao, L.H., Lo, Y.P., Chuang, C.K., Shih, Y.T., Chen, W.J., 2011. Antioxidant defense is one of the mechanisms by which mosquito cells survive dengue 2 viral infection. Virology 410, 410–417. Chen, T.H., Wu, Y.J., Hou, J.N., Chiu, C.H., Chen, W.J., 2017. The p53 gene with

168

Virology 519 (2018) 156–169

T.-H. Chen et al.

Tanaka, H., Arakawa, H., Yamaguchi, T., Shiraishi, K., Fukuda, S., Matsui, K., Takei, Y., Nakamura, Y., 2000. A ribonucleotide reductase gene involved in a p53-dependent cell-cycle checkpoint for DNA damage. Nature 404, 42–49. Turpin, E., Luke, K., Jones, J., Tumpey, T., Konan, K., Schultz-Cherry, S., 2005. Influenza virus infection increases p53 activity: role of p53 in cell death and viral replication. J. Virol. 79, 8802–8811. Vousden, K.H., Prives, C., 2009. Blinded by the light: the growing complexity of p53. Cell 137, 413–431. Vurusaner, B., Poli, G., Basaga, H., 2012. Tumor suppressor genes and ROS: complex networks of interactions. Free Radic. Biol. Med. 52, 7–18. Walter-Yohrling, J., Cao, X., Callahan, M., Weber, W., Morgenbesser, S., Madden, S.L., Wang, C., Teicher, B.A., 2003. Identification of genes expressed in malignant cells that promote invasion. Cancer Res. 63, 8939–8947. Wu, S.J., Grouard-Vogel, G., Sun, W., Mascola, J.R., Brachtel, E., Putvatana, R., Louder, M.K., Filgueira, L., Marovich, M.A., Wong, H.K., Blauvelt, A., Murphy, G.S., Robb, M.L., Innes, B.L., Birx, D.L., Hayes, C.G., Frankel, S.S., 2000. Human skin Langerhans cells are targets of dengue virus infection. Nat. Med. 6, 816–820. Yang, C.F., Hou, J.N., Chen, T.H., Chen, W.J., 2014. Discriminable roles of Aedes aegypti and Aedes albopictus in establishment of dengue outbreaks in Taiwan. Acta Trop. 130, 17–23. Yang, C.F., Tu, C.H., Lo, Y.P., Cheng, C.C., Chen, W.J., 2015. Involvement of tetraspanin C189 in cell-to-cell spreading of the dengue virus in C6/36 cells. PLoS Negl. Trop. Dis. 9, e0003885. Yu, C.Y., Hsu, Y.W., Liao, C.L., Lin, Y.L., 2006. Flavivirus infection activates the XBP1 pathway of the unfolded protein response to cope with endoplasmic reticulum stress. J. Virol. 80, 11868–11880. Zhai, W., Comai, L., 2000. Repression of RNA polymerase I transcription by the tumor suppressor p53. Mol. Cell. Biol. 20, 5930–5938. Zhang, B., Rotelli, M., Dixon, M., Calvi, B.R., 2015. The function of Drosophila p53 isoforms in apoptosis. Cell Death Differ. 22, 2058–2067.

Ng, C.F., Schafer, F.Q., Buettner, G.R., Rodgers, V.G., 2007. The rate of cellular hydrogen peroxide removal shows dependency on GSH: mathematical insight into in vivo H2O2 and GPx concentrations. Free Radic. Res. 41, 1201–1211. Noisakran, S., Onlamoon, N., Songprakhon, P., Hsiao, H.M., Chokephaibulkit, K., Perng, G.C., 2010. Cells in dengue virus infection in vivo. Adv. Virol. 2010, 164878. Olagnier, D., Peri, S., Steel, C., van Montfoort, N., Chiang, C., Beljanski, V., Slifker, M., He, Z., Nichols, C.N., Lin, R., Balachandran, S., Hiscott, J., 2014. Cellular oxidative stress response controls the antiviral and apoptotic programs in dengue virus-infected dendritic cells. PLoS Pathog. 10, e1004566. Ollmann, M., Young, L.M., Di Como, C.J., Karim, F., Belvin, M., Robertson, S., Whittaker, K., Demsky, M., Fisher, W.W., Buchman, A., Duyk, G., Friedman, L., Prives, C., Kopczynski, C., 2000. Drosophila p53 is a structural and functional homolog of the tumor suppressor p53. Cell 101, 91–101. Palucka, A.K., 2000. Dengue virus and dendritic cells. Nat. Med. 6, 748–749. Puccioni-Sohler, M., Rosadas, C., Cabral-Castro, M.J., 2013. Neurological complications in dengue infection: a review for clinical practice. Arq. Neuropsiquiatr. 71, 667–671. Riley, T., Sontag, E., Chen, P., Levine, A., 2008. Transcriptional control of human p53regulated genes. Nat. Rev. Mol. Cell Biol. 9, 402–412. Rutkowski, R., Hofmann, K., Gartner, A., 2010. Phylogeny and function of the invertebrate p53 superfamily. Cold Spring Harb. Perspect. Biol. 2, a001131. Sablina, A.A., Budanov, A.V., Ilyinskaya, G.V., Agapova, L.S., Kravchenko, J.E., Chumakov, P.M., 2005. The antioxidant function of the p53 tumor suppressor. Nat. Med. 11, 1306–1313. Salazar, M.I., Richardson, J.H., Sanchez-Vargas, I., Olson, K.E., Beaty, B.J., 2007. Dengue virus type 2: replication and tropisms in orally infected Aedes aegypti mosquitoes. BMC Microbiol. 7, 9. Sen, C.K., Packer, L., 1996. Antioxidant and redox regulation of gene transcription. FASEB J. 10, 709–720. Sessions, O.M., Tan, Y., Goh, K.C., Liu, Y., Tan, P., Rozen, S., Ooi, E.E., 2013. Host cell transcriptome profile during wild-type and attenuated dengue virus infection. PLoS Negl. Trop. Dis. 7, e2107.

169