- Email: [email protected]
A novel peptide isolated from phage display peptides library recognized by an antibody against connective tissue growth factor (CTGF)
International Immunopharmacology 9 (2009) 291–297
Contents lists available at ScienceDirect
International Immunopharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p
A novel peptide isolated from phage display peptides library recognized by an antibody against connective tissue growth factor (CTGF) Naifeng Liu a,⁎,1, Guoqiu Wu b,1,2, Hui Li c, Linxian Li c, Honglei Xing a,3, Cheng Zhang b,2, Huixia Lu b,2 a b c
Institute of Cardiovascular disease of Zhongda Hospital, Southeast University, Nanjing 210009, China Center of clinical laboratory medicine of Zhongda Hospital, Southeast University, China School of Pharmacy, China Pharmaceutical University, China
a r t i c l e
i n f o
Article history: Received 12 October 2008 Received in revised form 25 November 2008 Accepted 25 November 2008 Keywords: CTGF Phage display Antibody
a b s t r a c t The aim of this study was to isolate a peptide binding to an antibody against CTGF C-terminal domain from the peptide library and to evaluate its immunological and biological activities. A phage display 12-mer peptide library was screened using anti-CTGF/C antibody as the target. Ten of the positive clones were sequenced after three rounds bio-panning. The DNA encoding peptide ZD521 was cloned and expressed as the fusion protein(TrxA-ZD521). The specificity of ZD521 to anti-CTGF/C antibody was determined by competitive inhibition assay. Mice were immunized with purified fusion protein(TrxA-ZD521) and the antipeptide or anti-CTGF response of antiserum was also tested by enzyme-linked immunoabsorbent assay (ELISA) and Western blot. The inhibition effect of anti-serum on proliferation of kidney mesangial cells was evaluated by MTT. A peptide ZD521(GEPQTKLFSFPL) that could specifically recognize anti-CTGF/C antibody was isolated. No sequence homology was found between ZD521 and CTGF/C. The purified TrxA-ZD521 could specifically bind to anti-CTGF/C antibody and block the binding of anti-CTGF/C antibody to CTGF/C and native CTGF(mesangial cell lysate). Moreover, the antiserum from mice immunized with TrxA-ZD521 could also bind to CTGF/C recombinant protein and native CTGF, as well as significantly inhibit the proliferation of kidney mesangial cells induced by CTGF/C. Therefore, ZD521 might be a conformational epitope of CTGF which is potentially useful to be developed as a vaccine for prevention and treatment of fibrosis disorders. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Connective tissue growth factor (CTGF) has recently received much attention as a downstream mediator of many signaling pathways in different cell types during fibrosis [1]. Treatment with agents of downregulated CTGF or antibodies of neutralizing activity of CTGF generated by auto- or passive immunity might be effective approaches to minimize fibrosis. CTGF is a multifunctional, cysteine-rich protein originally identified as a growth factor secreted by vascular endothelial cells in culture [2]. It belongs to the CCN family(cysteine-rich 61, Cyr61/connective tissue growth factor, CTGF/nephroblastoma-overexpressed, NOV) of immediate early growth-responsive genes residing on chromosome 6q23.1, proximal to c-myb, and comprises five exons and four introns from human [2,3]. CTGF stimulates broad cellular responses including proliferation, chemotaxis, adhesion, migration, and extracellular
⁎ Corresponding author. Institute of Cardiovascular disease of Zhongda Hospital, Southeast University, 87 Dingjiaqiao, Nanjing 210009, China. Tel.: +86 25 83272001. E-mail addresses: [email protected] (N. Liu), [email protected] (G. Wu). 1 These authors contributed equally to this work. 2 Tel.: +86 25 83272355. 3 Tel.: +86 25 83272001. 1567-5769/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2008.11.015
matrix (ECM) production [4]. It has also been implicated in regulating diverse processes in vivo including angiogenesis, placentation, embryogenesis, differentiation, wound healing, and fibrosis, and its target cells include fibroblasts, endothelial cells, smooth muscle cells, epithelia cells, and neuronal cells [4]. Pathologically, CTGF is known to play important roles during tumorigenesis, arthrosclerosis and fibrotic disorders of the skin, kidney, lung, liver, and pancreas [5,6]. Since fibrosis usually shows excessive connective tissue and ECM deposition, these reports suggests that CTGF is involved in the development of fibrotic pathology. CTGF has four domains: an insulin-like growth factor-binding domain, a von Willebrand factor type C repeat domain, a thrombospondin type 1 repeat domain, and the C-terminal domain and it possesses a secretory signal peptide at the N terminus that leads to secretion from the cell. There are various molecular weight forms that were isolated by specific heparin binding [3,7–13]. These forms were highly truncated and showed that the N-terminal two thirds of the primary translational product was not required for mitogenic activity or heparin binding [14]. Although the cell surface receptor for CTGF has not been identified to date, some reports have shown that CTGF can bind to integrins in some cell types [15]. CTGF binds to alpha(v)beta(3) integrin on endothelial cells [16], alpha(IIb)beta(3) integrin on blood platelets
292
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
[17], and both alpha(6)beta(1) integrin and heparin sulfate proteoglycans on fibroblast cells [18]. Additionally, low-density lipoprotein receptor-related protein/alpha2-macroglobulin receptor (LRP) was recently identified as a binding site for CTGF in fibroblasts [19]. Because integrins can transduce extracellar binding events into intracellar signaling cascades, the ability of CTGF to interact with different integrins showed diverse biological functions of CTGF. CTGF actually works as a secreted ECM protein and transmits its signal either by initiating signaling through interaction with integrins or by modulating the function of other growth factors through direct protein–protein interaction [1]. It has also been reported that hepatic stellate cells (HSC) can produce integrins that act as cell adhesion receptors capable of binding CTGF and this adhesion activity was blocked by anti-alpha(v)beta(3) integrin antibody [15]. The CTGF Cterminal domain appears to play a fundamental and central role in intercellular HSC adhesion by CTGF [15]. Phage display is a bioscreening technique by which foreign peptides or proteins are expressed as a fusion with coat proteins of a bacteriophage resulting in display of the fused protein on the surface of the phages, while the nucleotide sequence encoding the fusion resides within the phages. Phage display has been used to create a physical link between a library of random peptide sequences and the DNA encoding each sequence, allowing rapid identification of peptide ligands against specific target molecules by a selection technique called panning [20]. Phage display libraries of random short peptides have been successfully used for identification of antigenic epitopes, and for screening of mimotopes by panning against antibodies and other receptor molecules [21]. A mimotope is a structure that acts as a mimic of the epitope recognized by an antibody. Because a compound with a similar tertiary structure to the epitope can work as a mimotope, peptidyl mimotopes can be prepared even to an epitope composed of nonpeptidyl molecules. In this study, we aimed to mimic the CTGF C-terminal domain(CTGF/C) which plays a important biological role. Amino acids residue(242–349) of CTGF were cloned and expressed as a fusion protein which is a peptide sequence fused with the thloredoxin (Trx) A protein(109 aa), and monoclonal antibody against CTGF C-terminal domain was prepared. In the meantime, a phage display 12-mer peptide library was used to isolate a peptide that bound to the monoclonal antibody against CTGF. The immunological and biological activities of isolated peptides were also determined. The peptide could become a candidate as a vaccine for the treatment or prevention of fibrosis disorders.
was emulsified in complete Freund's adjuvant (CFA) the first time. Mice were boosted four times with the antigen emulsified in incomplete Freund's adjuvant (IFA) every 3 weeks. Sera were taken on day 0 and 7 days after the third and fifth immunization. Antibody level in the sera from the immunized mice were determined by ELISA. Splenocytes from the immunized mice were fused with myeloma cells (SP2/0) at the ratio of 5:1. The cell mixture was cultured in RPMI 1640 supplemented with 10% fetal calf serum, and the hybridoma cells were selected by using a hypoxanthine-aminopterin-thymidine(HAT) medium(Sigma). All monoclonal antibodies were prepared from ascite fluids of the mice treated with pristane and were purified by chromatography on a protein-A column (Pharmacia). To test the anti-recombinant CTGF and native protein response, 96well flat-bottom microtiter plates were coated with 100 μl/well of a solution containing 2 μg/ml of purified recombinant CTGF and native protein (kidney mesangial cell lysate, which was prepared by lysing the cells in buffer containing 1% Triton X-100, l mM EDTA, 10 mM DTT, 1 mM PMSF, and 1 mg/ml aprotinin) or control material(trxA protein) in 0.1 M PBS (pH 7.4) by overnight incubation at 4 °C. After washing and blocking for 1 h at 37 °C with a solution of 10% fetal bovine sera in PBS, 100 μl of purified antibody at various concentrations was added in the wells and incubated for 2 h at 37 °C before 100 μl of horseradish peroxidase-conjugated goat anti-mouse Ig (1:2000 dilution, R&D Systems Inc.). The wells were then washed 5 times and the specific binding was revealed by addition of 100 μl of substrate tetramethylbenzidine(TMB). Color development was stopped by addition of 2 M sulphuric acid, and the results were recorded by reading the OD value at 450 by an automated ELISA reader(CliniBio 128C, Austria). 2.3. Western blot To further identify the reactivity of MoAb with recombinant and native protein, Western blot analysis was performed. 2 μg of TrxA, TrxA-CTGF/C, and kidney mesangial cell lysate were subjected to 12% Sodium dodecyl sulfate-polyacrylamide gelelectrophoresis(SDSPAGE) and transferred to nitrocellulose. The proteins were probed with the produced antibody (1:2000 dilution with PBS). After being washed, the filters were incubated with HRP-conjugated secondary antibody(1:1000 dilution with PBS, R&D Systems Inc.) and then developed with an electrochemilumineseence (ECL) system (Amersham Biosciences). 2.4. Bio-panning and selection of phage
2. Materials and methods 2.1. Preparation of recombinant CTGF C-terminal domain (CTGF/C) The recombinant CTGF/C had been obtained as described previously [22]. Briefly, total RNA was extracted from human endothelial cells and reverse transcribed into cDNA. The gene encoded CTGF Cterminal domain 242–349 residues was obtained by a standard PCR procedure with designed primers: 5'-CCCAAGCTTTGCCATGTCTCCGTACATCTTCC-3' and 5'-GCTGGATCCGAAGAGAACATTAAGAAGGGC-3'. The PCR product was subcloned into pET-32a(+) vector (Invitrogen) by endonuclease restriction sites of BamH I and Hind III. Positive plasmid colonies were was selected and grown in Luria Broth (LB) medium containing ampicillin and induction was typically achieved by addition of 1 mM final concentration of IPTG(MBI, Ins). Cells were harvested and sonicated to release the required protein. The recombinant CTGF/C(TrxA-CTGF/C) was purified by HisTrap™ HP Kit (Amersham Biosciences). 2.2. Production of monoclonal antibody(MoAb) against CTGF/C 6 to 8-week old BALB/c mice (purchased from Shanghai Animal Center ) were immunized s.c. with 50 μg of recombinant protein that
Mouse normal lgG and anti-CTGF antibody (7G2, 100 μg/ml) in 0.05 M NaHCO3 (pH9.6) were separately coated on 96-wells plate (Nunc)(100 μl/well) by incubating overnight at 4 °C. After blocking with 0.5% BSA in TBS at 37 °C for 1 h, the wells were washed 6 times with TBST(TBS + 0.1% Tween-20). The phage display peptide library (Ph.D.12, New England Biolabs), diluted in TBS containing 0.1% Tween20 to a concentration of 4.0 × l011 pfu were preabsorbed on plate containing immobilized mouse normal IgG and BSA to remove any phages that were not specifically reactive with anti-CTGF antibody at 37 °C for 1 h, and then were transferred into the wells immobilized with 7G2, and incubated at 37 °C for 1 h. The wells were washed 5 times with 0.1% Tween-20/TBS. Then, the phages that bound with 7G2 were eluted with 0.2 M Glycine-HCl(pH2.2) containing 0.5% BSA, and immediately neutralized with 1 M Tris–HCl(pH9.1). 1 μl of the elution was tittered as described briefly: Inoculate 5–10 ml LB with a single colony of ER2738(New England Biolabs) and continue with shaking until mid-log phase (OD600 ~ 0.5). While cells are growing, melt Agarose Top in microwave and dispense 3 ml into sterile culture tubes, one per expected phage dilution (10-fold serial dilutions from 10− 2 to 10− 18 with PBS). Tubes were equilibrated at 45 °C until ready for use. An aliquot of 200 μl cell culture was added into microfuge tubes for each phage dilution. Add 10 μl of each dilution to each tube, vortex
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
quickly, and incubation at room temperature for 1–5 min. The infected cells were transferred to a culture tube containing 45 °C Agarose Top, vortexed quickly, and immediately poured onto a pre-warmed LB/ IPTG/X-gal(MBI, Ins.) plate. The plates were cooled for 5 min and then were inverted and incubated overnight at 37 °C. Plaques on plates were counted. Plaque forming units(pfu/ml) = plaque number × 100/ dilution factor. The rest were amplified by inoculation into 20 ml LB medium in a 250 ml Erlenmeyer flask containing 200 μl of E. coli ER2738 by overnight culture and shaken for 4.5 h at 37 °C. The amplified phages were purified by precipitation with 1/6 volume of polyethylene glycol 8000 (PEG8000)/2.5 M NaCl and used in the next cycle. Three rounds of selection were performed., In the second round, the wells were coated with 7G2 at a concentration of 50 μg/ml and washed 10 times with 0.5% Tween-20/TBS, and in the third round, the wells were coated with 7G2 at a concentration of 25 μg/ml and washed 20 times with 1.0% Tween-20/TBS. After that, individual plaques were picked up randomly and subjected to analysis by phage enzymelinked immunosorbent assay (ELISA). 2.5. Phage ELISA In total, 32 phage clones picked up randomly were tested for reactivity with 7G2 by ELISA. Briefly, a single clone was grown for 4.5 h in 1 ml LB and shaken at 37 °C. Bacterial cells were spun down, and the supernatant containing phage was added to the wells of a microtiter plate that was coated with 2 μg/ml of 7G2 or mouse normal IgG in 0.05 M NaHCO3 (pH 9.6) and then blocked with 1% BSA in PBS. The plate was incubated at room temperature for 2 h and washed 5 times with 1.0% Tween/TBS. Bound phages were detected by incubation with 100 μl HRP-conjugated anti-M13 antibody (Pharmacia, diluted 5000 times with PBS) for 1 h, followed by washing 5 times and the addition of a substrate solution (100 μl/well) containing 3,3',5,5'-tetramethylbenzidine(TMB) at 100 μg/ml. After incubating for 10 min, the reaction was stopped by the addition of 1 M H2SO4(50 μl/well). Peroxidase activity was evaluated by the difference between the absorbance at 450 nm and 620 nm by using a microplate reader (CliniBio 128C, Austra). 2.6. DNA sequencing The phage plaques were amplified by the procedure described above. A 500 μl of the phage-containing supernatant was transferred to a fresh microfuge tube and added 200 μl of PEG/NaCl, and centrifuged 10 min after standing at room temperature for 10 min. The pellet was suspended with 100 μl of Iodide buffer(10 mM Tris–HCl pH8.0, 1 mM EDTA, 4 M NaI) and 250 μl ethanol. Single-stranded phage DNA was precipitated by centrifugation for 10 min at 10,000 rpm after incubation for 10 min at room temperature and sequenced by BioAsia Biology Inc. (Shanghai, China). 2.7. Peptide synthesis 2 single-strand DNAs were synthesized: PH1: 5'GATCCGGGGAGCCGCAGACGAAGCTTTTTAGTTTTCCGCTGTGAC3', PH2: 5'TCGAGTCACAGCGGAAAACTAAAAAGCTTCGTCTGCGGCTCCCCG3', encoding amino acid sequence GEPQTKLFSFPL(ZD521)(BioAsia Biology Inc). The double-strand DNAs were formed by mixing 10 μl (500 pmol) of PH1 and 10 μl (500 pmol) of PH2 and incubating for 10 min at 70 °C, followed by a gradual decrease to room temperature. Ligation of the double-strand DNAs with pET-32(a)+ digested with BamH I and Hind III was done in 10 μl of reaction mixture containing 5.0 μg of doublestrands DNAs, 1.0 μg of vector DNA, 350 U of T4 DNA ligase for 16 h at 16 °C. The ligation products were used to transform competent cells of E. coli JM109, and positive colonies were identified by sequencing. Subsequently, the recombinant plasmid was transformed into E. coli
293
BL21 (DE3) and the fused peptide (Trx A-ZD521) was obtained by induction with IPTG and purified with the HisTrap™ HP Kit described as above. In the meantime, a peptide (GEPQTKLFSFPL) was synthesized by the standard 9-fluorenylmethoxycarbonyl solid-phase synthesis, and analyzed and purified by reverse-phase HPLC (Sangon BioEngineering Corporation, Shanghai, China). 2.8. Specificity of peptide binding to 7G2 Microtiter wells were coated with 100 μl of a solution containing 2 μg/ml of ZD521 peptide, TrxA-ZD521, or TrxA in 0.1 M PBS (pH7.4) by overnight incubation at 4 °C. After washing and blocking for 2 h at 37 °C with a solution of 10% fetal bovine sera in PBS, an aliquot of 100 μl of 7G2 of various concentrations with 0.1 M PBS (pH 7.4) were added in the wells and incubated for 2 h at 37 °C before 100 μl of horseradish peroxidase-conjugated goat anti-mouse Ig (1:2000 dilution, R&D Systems Inc.). The wells were then washed 5 times and 100 μl of substrate tetramethylbenzidine (TMB) was added. Color development was stopped by addition of 2 M sulphuric acid, and the results were recorded by reading the OD value at 450 nm by an automated ELISA reader. 2.9. Competitive inhibition assay To test the inhibition of 7G2 binding to CTGF, a 96-well microtiter plate was coated with 5 μg/ml of TrxA-CTGF/C, or TrxA-ZD521 in 0.1 M PBS(pH7.4) at 4 °C overnight and blocked for 2 h at 37 °C with a solution of 10% fetal bovine sera in PBS. Next, 0.5 μg/ml 7G2 was mixed with TrxA, TrxA-ZD521, ZD521 peptide, TrxA-CTGF/C, and mensangial cell lysates of various concentration, and preincubated for 1 h at room temperature, then transferred to the plates. Bound antibodies were detected by standard ELISA as described above. The peptides or proteins were tested at 0, 0.5, 5, 10, 40 μg/ml. Each dilution was tested in duplicate. The inhibition was calculated by using the following formula: (OD7G2 − OD7G2 with peptide or protein)/OD7G2 × l00%.The experiment was repeated three times. 2.10. Immunization 10 BALB/c mice were immunized s.c. with 100 μg of TrxA-ZD521 or TrxA that was emulsified in complete Freund's adjuvant (CFA) the first time and boosted four times with the antigen emulsified in incomplete Freund's adjuvant (IFA) every 3 weeks. Sera were taken on the third day after the fifth immunization. Antibody levels in the sera of immunized mice were determined by ELISA. To test the antipeptide and anti-CTGF response, 96-well microtiter plates were coated with 5 μg/ml of TrxA, TrxA-ZD521, TrxA-CTGF/C or mesangial cell lysate in 0.1 M PBS(pH 7.4) and then blocked with PBS(pH7.4) containing 10% fetal bovine sera. The plates were incubated for 2 h at 37 °C after addition of 100 μl of mice sera at the dilution of 1:100. Bound antibody was detected by using HRP-conjugated anti-mouse IgG with TMB as the peroxidase substrate as described above. To further demonstrate the reactivity with ZD521 or CTGF, Western blot analysis was performed. 2 μg of TrxA, TrxA-ZD521, TrxA-CTGF/C, and kidney mesangial cell lysate were subjected to 12% SDS-PAGE and transferred to nitrocellulose. The proteins were probed with anti-sera at the dilution of 1:100. After being washed, the filters were incubated with HRP-conjugated anti-mouse IgG antibody and then developed as described above. 2.11. Cell proliferation assay with MTT Human kidney mesangial cells (kindly provided by Dr. Liu Bicheng, Institute of Renal disease of Zhongda Hospital, Southeast University, China) were cultured on plastic culture dishes in DMEM supplemented with 10% fetal bovine sera. The cells were plated in a 96-well plate at a
294
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297 Table 1 Recovery of phages by biopanning Round
Phage added(pfu)
Phage eluted(pfu)
Yield
1 2 3
1.5 × 1011 2.1 × 1012 3.8 × 1012
3.4 × 103 4.7 × 105 1.5 × 106
2.3 × 10− 8 2.2 × 10− 7 0.4 × 10− 6
Titer after each round of panning procedure shown as plaque forming units(pfu). Yield = Phage eluted/Phage added.
Fig. 1. The specificity of 7G2 Binding to CTGF. A 96-well flat-bottom microtiter plate was coated with 2 μg/ml of TrxA, TrxA-CTGF/C or kidney mesangial cell lysate in 0.1 M PBS (pH 7.4) and blocked with PBS containing 10% fetal bovine sera. 7G2 of various concentrations was added to the wells. Bound 7G2 was detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The values are recorded at OD450 nm. SDs are indicated by error bars.
3.3. Specificity of peptide binding to 7G2 and its sequence
density of 104 cells/well. When cells grew to 50% confluence, the medium were replaced by DMEM medium containing 0.5 μg/ml TrxACTGF/C and anti-serum of serial dilutions from the mice immunized with TrxA-ZD521 or TrxA The plates were incubated at 37 °C for 48 h. Numbers of live cells were measured using a thiazolyl blue(MTT, Sigma) cell proliferation assay by reading OD492. Each dilution was tested in triplicate. Proliferation inhibition were calculated by using the following formulas: ODprotein − ODprotein with anti-serum/ODprotein × 100%.
All 10 positive phage clones were sequenced, and the sequences of all clones were consentaneous which encoded the identical amino acid sequence (GEPQTKLFSFPL) named ZD521(Fig. 3). The amino acid sequence had no obvious similarities in motif with that of full length of CTGF/C. The binding activity of TrxA-ZD521 to 7G2 was also demonstrated by ELISA and Western blot. For this experiment, oligonucleotide encoding the peptide ZD521 were expressed as a Cterminal extension of the TrxA protein. The results of ELISA assay showed that 7G2 could specifically bind to ZD521 peptide and TrxAZD521 but not to TrxA (Fig. 4). The results of Western blot also suggested that 7G2 could specifically react with the TrxA-ZD521, whereas no reaction was obtained with TrxA (see lane 1, 2 of left panels in Fig. 2).
3. Results
3.4. TrxA-ZD521 and peptide ZD521 inhibition of 7G2 binding to CTGF/C
3.1. Generation of anti-CTGF antibodies
To demonstrate that ZD521 resembled the epitope of CTGF, we had to show that ZD521 blocked binding between 7G2 and CTGF. To perform these experiments, we used an ELISA in which 7G2 and inhibitors (TrxA, TrxA-ZD521, peptide ZD521 and mesangial cell lysate) were preincubated and plated onto the microtiter plates coated with TrxA-CTGF/C. This analysis revealed that TrxA-ZD521, ZD521 peptide and mesangial cell lysate could inhibit the binding of 7G2 to TrxA-CTGF/C in a dose-dependent manner, but TrxA protein did not produce noteworthy inhibition of their interaction (Fig. 5).
Five hybridoma cell lines that reacted with TrxA-CTGF/C, but not with TrxA were established (data no shown). 7G2 was chosen to use in this research. The results of ELISA assays showed that 7G2 could specifically bind to TrxA-CTGF/C and kidney mesangial cell lysates, but not to TrxA (Fig. 1). The results of Westen-blot analysis also suggested that 7G2 reacted with TrxA-CTGF/C and a 38 kd protein of kidney mesangial cell lysates, but not with TrxA (Fig. 2, left panels). 3.2. Phage selection To select the positive clones that bind to monoclonal antibody against CTGF, a random 12-mer phage display peptide library composed of 4.0 × 1011 independent phage clones was reabsorbed by mouse serum IgG and BSA , and then specifically absorbed with 7G2. For each biopanning, phages were titrated for pfu in the inputs and outputs to determine the degree of selection. The total number of phages bound to 7G2 was increased from 3.4 × l03 pfu in the first round to 4.7 × 105 pfu in the second round, and 1.5 × 106 pfu in the third round (Table 1). After 3 rounds of selection, roughly 31.3% (10/32) of the phage clones analyzed exhibited 7G2 binding activity by ELISA (data no shown).
3.5. TrxA-CTGF/C inhibiting 7G2 binding to TrxA-ZD521 and peptide ZD521 To demonstrate that the 7G2 that bound to TrxA-ZD521 or peptide ZD521 was specific for CTGF, we used CTGF/C to inhibit 7G2 binding to TrxA-ZD521 or peptide ZD521. 7G2 was premixed with various dilutions of inhibitors. The results showed that TrxA-CTGF/C, ZD521 peptide or mesangial cell lysate significantly inhibited 7G2 binding to TrxA-ZD521(Fig. 6). In Fig. 6, TrxA alone also demonstrated a concentration-dependent inhibition on 7G2 binding to TrxA-ZD521, but TrxA-ZD521 fusion protein doubled or tripled the inhibition effect, as compared with TrxA. 3.6. Mice immunized with TrxA-ZD521 made antibodies Sera of mice were collected after the fifth immunization with TrxAZD521. The reactivity of anti-serum (anti-TrxA-ZD521 antibody) with TrxA-ZD521, TrxA-CTGF/C and CTGF native protein was evaluated by ELISA. All mice immunized with TrxA-ZD521 produced antibodies not
Fig. 2. Westen blot analysis of antibodies binding to proteins. Different proteins were prepared as described under “Materials and methods”. Equal amounts(2 μg) of proteins were subjected to SDS-PAGE and transferred to nitrocellulose membranes. The proteins were probed with 7G2 (left panels), anti-TrxA-ZD521 antibody(middle panels) and antiTrxA antibody (right panels) to detect the specificity of antibodies. Lane 1, TrxA; Lane 2, TrxA-ZD521; Lane 3, mesangial cells lysates; Lane 4, TrxA-CTGF/C.
Fig. 3. Amino acid sequence of ZD521. All positive phage clones encoded a consentaneous sequence when sequenced with the M13(-96) gIII primer (5'-CCCTCATAGTTAGCGTAACG-3').
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
295
Fig. 4. Binding of 7G2 to TrxA-ZD521. Microtiter wells were coated with 2 μg/ml of ZD521 peptide, TrxA-ZD521, or TrxA and blocked with PBS containing 10% fetal bovine sera. 7G2 of various concentrations was added to the wells. Bound 7G2 was detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The values are recorded at OD450 nm. SDs are indicated by error bars.
only against TrxA-ZD521 but also against recombinant and native CTGF (Fig. 7). The response to native CTGF was lower than to TrxAZD521 or TrxA-CTGF/C. Western blot analysis also showed that the anti-TrxA-ZD521 antibody specifically reacted with TrxA-ZD521, TrxACTGF/C and mesangial cell lysate(see middle panels in Fig. 2). No antipeptide or anti-CTGF response was observed in mice immunized with TrxA(see right panels in Fig. 2). 3.7. Anti-serum blocked cell proliferation induced by CTGF/C Anti-serum from mice immunized with TrxA-ZD521 was used to evaluate inhibition of cell proliferation induced by CTGF/C. The results showed that the anti-serum from mice immunized with TrxA-ZD521 inhibited cell proliferation induced by CTGF/C in a dose-dependent manner, but anti-serum from mice immunized with TrxA did not (Fig. 8). 4. Discussion Connective tissue growth factor (CTGF) is a novel profibrotic factor that is upregulated in different human diseases [23]. Angiotensin II (AngII) could stimulate overexpression of CTGF and regulates renal fibrosis via type 1 angiotensin(AT1) receptor by the Smad signaling pathway [24,25]. CTGF was positive in the majority of human biopsy specimens from various chronic liver diseases and in experimental models of liver fibrosis in rats. Moreover, there was a significant association between CTGF immunostaining intensity and the stage of fibrosis [26]. It has also been reported that CTGF were up-regulated specifically in the scar tissue of the ventricle after experimental induction of myocardial infarction (MI), and levels of CTGF mRNA in fibroblasts of scar tissue were clearly related to the development of heart fibrosis in mice 1 and 4 weeks post-M I [27]. CTGF expression is rapidly upregulated in many cell lines by various factors such as high glucose, stresses, and many growth factors including angiotensin(II), TGF-beta, vascular endothelial growth factor (VGEF) and increased ECM production [1]. Reports revealed that CTGF
could enhance mRNA level for alpha1-type collagen, fibronectin, and integrin in normal rat kidney(NRK) [28], increase expressive levels of collagen type II in rabbit growth cartilages [29], collagen type I and fibronectin in primary human and rabbit mensangial cells [8,30]. The sustained overexpression of CTGF was strongly correlated with the upregulation of ECM genes such as fibronection, collagen type I, and collagen type III in a rat MI model [31]. The C-terminal domain of CTGF that contains a cysteine knot similar to that found in other growth factors such as TGF-beta, platelet-derived growth factor (PDGF) and nerve growth factor is involved in diverse biological effects including cell surface binding, mitogenic activity for fibroblasts, stimulating DNA synthesis, cell transdifferentiation, and fibrosis [15,16,32]. It has recently been reported that CTGF directly binds bone morphogenic protein 4 (BMP4) and TGF-beta-1 through its cysteine-rich domain [33]. CTGF can inhibit BMP4 and activate TGF-beta-1 signals by direct binding to their extracellular domain. Therefore, it is possible that the C-terminal domain of CTGF can be a superior pharmacological target of profibrotic disease such as using neutralizing antibodies, antisense oligonucleotide and inhibitors. Phage display technology is broadly applied in identifying new receptors, natural ligands, and drug discovery as well as for vaccine design [34–40]. When an antibody is used for affinity selection, the peptides selected from random peptide library are antigenic mimics of the corresponding natural epitope. These peptides are able to elicit new antibodies that cross-react with the natural epitope, even though the animal has never been directly exposed to it. Generally, the epitope can be a linear fragment or conformational region. Linear epitopes correspond to the ordered sequence of amino acids in the protein. However, in conformational epitopes (mimotope), sequences from non-sequential protein regions in the primary structure or its associated carbohydrates contribute to a single tridimensional site. Screening phage display peptide libraries may be a simple and convenient way to find out not only linear epitopes but also conformational epitopes. To search for the peptides that could mimic the epitope of CTGF C-terminal domain and would have
Fig. 5. Peptide ZD521 or TrxA-ZD521 inhibited 7G2 binding to CTGF. Previously, 0.5 μg/ml of 7G2 was mixed with peptide ZD521, TrxA, TrxA-ZD521, TrxA-CTGF/C, mensangial cell lysate, preincubated for 1 h and transferred to the TrxA-CTGF/C coated plates. Bound antibodies were detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The inhibition rate was calculated according to the following formula: (ODantibody − ODantibody with protein)/ODantibody × l00%. SDs are indicated by error bars.
296
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
Fig. 6. CTGF inhibited 7G2 binding to TrxA-ZD521. First, 0.5 μg/ml of 7G2 was mixed with peptide ZD521, TrxA, TrxA-ZD521, TrxA-CTGF/C, mensangial cell lysate for 1 h. The mixture were added to TrxA-ZD521 coated wells. Bound 7G2 was detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The inhibition rate was calculated according to the following formula: (ODantibody − ODantibody with protein)/ODantibody × l00%. SDs are indicated by error bars.
potential as a vaccine in preventing or treating fibrosis disorder, the phage display peptide library used here is based on a combinatorial library of random peptide 12 mers fused to a minor coat protein(p3) of the M13 phage by a flexible peptide(GGGS) (Fig. 3B). The peptide library was screened for phages with binding activity to antibody against CTGF as the target protein by bio-panning and a peptide (GEPQTKLFSFPL) was obtained. Although no sequence homology was found between the mimotope(ZD521) and CTGF/C by sequence alignment, our results showed that ZD521 might be a conformational structure of CTGF. For screening the library, some improvements were introduced for increasing the specificity and the yield. Firstly, to remove the nonspecific phage clones, the original phage display library was first pro-absorbed with mouse normal IgG. Secondly, Selective pressure was increased step by step, that is, the coated concentration of antibody was decreased from 100 μg/ml in the first round to 25 μg/ml in the third round, and washing times and concentration of Tween-20 in washing solution(TBS) were increased from 5 times, 0.01% in the first round to 20 times, 1% separately. Ten positive phage clones were selected from 32 clones picked up at random, and were completely identified by DNA sequencing. To rule out the effects of phage protein in the binding, the TrxA fusion protein was made. The fusion protein TrxA-ZD521 and ZD521 peptide showed the binding activity to 7G2 but the TrxA did not. Further analysis demonstrated that the TrxAZD521 and ZD521 peptide specifically inhibited the binding of 7G2 to CTGF. Moreover, the immunization analysis showed that the TrxAZD521 could induce an active immune response to CTGF in vivo. The anti-serum from mice immunized with TrxA-ZD521 could inhibit the CTGF/C-induced proliferation of human kidney mesangial cells but the anti-serum from mice immunized with TrxA did not. These results strongly suggested that ZD521 is similar to the antigen epitope of CTGF that is recognized by monoclonal antibody against CTGF. Whether or not the peptide is a real mimotope can be clarified by
Fig. 7. Antibody response of sera from mice immunized with TrxA-ZD521. Microtiter plates were coated with 5 μg/ml of TrxA, TrxA-ZD521, TrxA-CTGF/C or kidney mesangial cell lysate and blocked with PBS (pH7.4) containing10% fetal bovine sera. The antiserum at the dilution of 1:100 was added to the wells. Bound antibody was detected with HRP-conjugated anti-mouse IgG antibody and with the substrate. The values are recorded at OD 450 nm. SDs are indicated by error bars. ⁎p b 0.05(compared with serum from TrxA immunized mice, using Student's t test).
determining the peptide conformation by means of NMR or X-ray diffraction analysis. Pharmacologic manipulation of CTGF expression has been examined. Prostaglandin(PG)E2, forskolin and cAMP can downregulate TGFbeta-induced CTGF by inhibition of transcription of the CTGF gene [31,41,42]. Iloprost inhibited the induction of CTGF in human skin fibroblasts through upregulation of cAMP [43]. 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitor reduced CTGF induction through a Rho-dependent signaling mechanism [44,45]. An angiogenic inhibitor has been shown to inhibit post-transcriptional induction of CTGF by VEGF in human endothelial cells [46]. In the meantime, a search for a drug to neutralize CTGF itself is constantly being explored. Neutralizing anti-CTGF antibodies were capable of inhibiting glucoseinduced collagen secretion in renal fibroblasts [47], and a CTGF antisense oligonucleotide could prevent AngII induced fibronectin upregulation in vascular smooth muscle cell (VSMC) [48]. In this study, we found a novel peptide (ZD521) that binds to monoclonal antibody against CTGF C-terminal domain, and the peptide might be a conformational epitope of CTGF. Immunized with the peptide that was properly modified by heterogenetic proteins such as surface antigen of hepatitis virus B(HBsAg), antibodies against CTGF would be elicited by autoimmuine system. It was especially useful to prevent or neutralize the excess activity of over-expressed CTGF in fibrosis disorders, and avoid human anti-mouse reaction(HAMA) if treated with neutralizing anti-CTGF antibody derived from mouse. Indeed, CTGF is one of natural growth factors. It is difficult to prepare vaccines for humans (or other hosts) against self peptides or proteins such as CTGF, when that is needed and necessary, overcoming tolerance and avoiding autoimmune responses. The primary structure of ZD521 is not homological with that of CTGF, thus it can facilitate generation of antibody against CTGF in host. However, whether cross
Fig. 8. Proliferation inhibition assay by MTT. Human kidney mesangial cells were plated in 96-well microtiter plates at the density of 1 × 104 cells/well. After incubation at 37 °C overnight, the medium were replaced by DMEM medium containing 0.5 μg/ml TrxACTGF/C and anti-serum of serial dilutions from the mice immunized with TrxA-ZD521 or TrxA The plate were incubated at 37 °C for 48 h. Numbers of live cells were measured using a thiazolyl blue(MTT, Sigma) cell proliferation assay by reading OD492. Each dilution was tested in triplicate. Proliferation inhibition were calculated by using the following formulas: ODprotein − ODprotein with anti-serum/ODprotein × 100%.
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
reaction might take place between generated antibody and other cysteine knot proteins such as TGF-beta or VEGF, and real effects on fibrosis in vivo can be as expected by immunization with the peptide remained to be further researched. In general, the peptide which had been identified as a mimotope to CTGF might potentially be a useful candidate to be developed as a vaccine, providing a new approach for prevention and immunotherapy of fibrosis disorders. Acknowledgement The work was partly supported by the Fund of Science Research (No:XY2008341 and 9290002295) from Southeast University, PRC. References [1] Matsui Y, Sadoshima J. Rapid upregulation of CTGF in cardiac myocytes by hypertrophic stimuli: implication for cardiac fibrosis and hypertrophy. J Mol Cell Cardiol 2004;37:477–81. [2] Bradham DM, Igarashi A, Potter RL, Grotendorst GR. Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10. J Cell Biol 1991;114:1285–94. [3] Brigstock DR, Steffen CL, Kim GY, Vegunta RK, Diehl JR, Harding PA. Purification and characterization of novel heparin-binding growth factors in uterine secretary fluids. J Bio Chem 1997;272:20275–82. [4] Brigstock DR. The CCN family: a new stimuluspackage. J Endocrinol 2003;178: 169–75. [5] Moussad EE, Brigstock DR. Connective tissue growth factor: what's in a name? Mol Genet Metab 2000;71:276–92. [6] Shakunaga T, Ozaki T, Ohara N, Asaumi K, Doi T, Nishida K, et al. Expression of connective tissue growth factor in cartilaginous tumors. Cancer 2000;89:1466–73. [7] Croci S, Landuzzi L, Astolfi A, Nicoletti G, Rosolen A, Sartori F, et al. Inhibition of connective tissue growth factor (CTGF/CCN2) expression decrease the survival and myogenic differentiation of human rhabdomyosarcoma cells. Cancer Res 2004;64: 1730–6. [8] Hong HH, Uzel MI, Duan C, Sheff MC, Tracman PC. Regulation of lysyloxidase, collagen, and connective tissue growth factor by TGF-beta and detection in human gingival. Lab Invest 1999;79:1655–67. [9] Steffen CL, Ball-Mirth DK, Harding PA, Bhattacharyya N, Pillai S, Brigstock DR. Characterization of cell associated and soluble forms of connective tissue growth factor produced by fibroblast cells in vitro. Growth factors 1998;15:199–213. [10] Boes M, Dake BL, Booth BA, Erondu NE, Oh Y, Hwa V, et al. Connective tissue growth factor(IGFBP-rP2) expression and regulation in cultured bovine endothelial cells. Endocrinology 1999;140:1575–80. [11] Nishida T, Kubota S, Kojima S, Kuboki T, Nakao K, Kushibiki T, et al. Regeneration of defects in articular cartilage in rat knee joints by CCN2(connective tissue growth factor). J Bone Miner Res 2004;19:1308–19. [12] Rachfal AW, Luquette MH, Brigstock DR. Expression of connective tissue growth factor (CCN2) in desmoplastic small round cell tumour. J Clin Pathol 2004;57: 422–5. [13] Riser BL, Denichilo M, Cortes P, Baker C, Grondin JM, Yee J, et al. Regulation of connective tissue growth factor activity in cultured rat mesangial cells and its expression in experimental diabetic glomerulosclerosis. J Am Soc Nephrol 2000;11:25–38. [14] Ball DA, Surveyor GA, Diehl JR, Steffen CL, Uzumcu M, MAM, et al. Characterization of 16-20-kilodalton(kDa) connective tissue growth factors(CTGF) and demonstrate of proteolytic activity for 38 kDa CTGF in pig uterine luminal flushings. Biol Reprod 1998;59:828–35. [15] Gao R, Brigstock DR. Connective tissue growth factor (CCN2) induces adhesion of rat activated hepatic stellate cells by binding of its C-terminal domain to integrin alpha(v)beta(3) and heparan sulfateproteoglycan. J Biol Chem 2004;279:8848–55. [16] Babic AM, Chen CC, Lau LF. Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin alphavbeta3, promotes endothelial cell survival, and induces angiogenesis in vivo. Mol Cell Biol 1999;19: 2958–66. [17] Jedsadayanmata A, Chen CC, Kireeva ML, Lau LF, Lam SC. Activation-dependent adhesion of human platelets to Cyr61 andFisp12/mouse connective tissue growth factor is mediated through integrin alpha(IIb)beta(3). J Biol Chem 1999;274: 24321–7. [18] Chen CC, Chen N, Lau LF. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem 2001;276:10443–52. [19] Segarini PR, Nesbitt JE, Li D, Hays LG, Yates III JR, Carmichael DF. The low density lipoprotein receptor-related protein/alpha2-macroglobulin receptor is a receptor for connective tissue growth factor. J Biol Chem 2001;276:40659–67.
297
[20] Willats WGT. Phage display: practicalities and prospects. Plant Mol Biol 2002;50: 837–54. [21] Smith GP. Surface presentation of protein epitopes using bacteriophage expression system. Curr Opin Biotechnol 1991;2:668–73. [22] Liu NF, Wu GQ, Sun HW, Huang LX, Zhang FM, Qian JY, et al. Secretive expression and establishment of ELISA determination of connective tissue growth factor. Chin J Clin Lab Sci 2005;23:4–8. [23] Perbal B. CCN proteins: multifunctional signalling regulators. Lancet 2004;363:62–4. [24] Ruiz-Ortega M, Ruperez M, Esteban V, Egido J. Molecular mechanisms of angiotensin II-induced vascular injury. Curr Hypertens Rep 2003;5:73–9. [25] Ruiz-Ortega M, Ruperez M, Esteban V, Rodriguez-Vita J, Sanchez-Lopez E, Carvajal G, et al. Angiotensin II: a key factor in the inflammatory and fibrotic response in kidney diseases. Nephrol Dial Transplant 2006;21:16–20. [26] Paradis V, Dargere D, Vidaud M, De Gouville AC, Huet S, Martinez V, et al. Expression of connective tissue growth factor in experimental rat and human liver fibrosis. Hepatology 1999;30:968–76. [27] Chuva de Sousa Lopes SM, Feijen A, Korving J, Korchynskyi O, Larsson J, Karlsson S, et al. Connective tissue growth factor expression and Smad signaling during mouse heart development and myocardial infarction. Dev Dyn 2004;231:542–50. [28] Frazier K, Williams S, Kothapalli D, Klapper H, Grotendorst GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol 1996;107:404–11. [29] Nakanishi T, Nishida T, Shimo T, kobayashi K, Kubo T, Tamatani T, et al. Effects of CTGF/Hcs24, a product of a hypertrophy chondrocyte-specific gene, on the proliferation and differentiation of chondrocytes in culture. Endocrinology 2000;141:264–73. [30] Murphy M, Godson C, Cannon S, Kato S, Mackenzie HS, Martin F, et al. Suppression subtractive hybridization identifies high glucose levels as a stimulus for expression of connective tissue growth factor and other genes in human mesangial cells. J Biol Chem 1999;274:5830–4. [31] Chen MM, Lam A, Abraham JA, Schreiner GF, Joly AH. CTGF expression is induced by TGF-beta in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis. J Mol Cell Cardiol 2000;32:1805–19. [32] Lau LF, Lam SC. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res 1999;248:44–57. [33] Abreu JG, Ketpura NI, Reversade B, De Robertis EM. Connective tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta. Nat Cell Biol 2002;4: 599–604. [34] Yip YL, Ward RL. Epitope discovery using monoclonal antibodies and phage peptide libraries. Comb Chem High Throughput Screen 1999;2:125–38. [35] Scott JK, Smith CP. Searching for peptide ligands with an epitope brary. Science 1990;249:386–90. [36] Aina OH, Sroka TC. Therapeutic cancer targeting peptides. Biopolymers 2002;66: 184–99. [37] Samoylova TI, Morrison NE, Globa LP, Cox NR. Peptide phage display: opportunities for development of personalized anti-cancer strategies. Anticancer Agents Med Chem 2006;6:9–17. [38] Landon LA, Deutscher SL. Combinatorial discovery of tumor targeting peptides using phage display. J Cell Biochem 2003;90:509–17. [39] Landon LA, Zou J, Deutscher SL. Is phage display technology on target for developing peptide-based cancer drugs? Curr Drug Discov Technol 2004;1: 113–32. [40] Uchiyama F, Tanaka Y, Minari Y, Tokui N. Designing scaffolds of peptides for phage display libraries. J Biosci Bioeng 2005;99:448–56. [41] Ricupero DA, Rishikof DC, Kuang PP, Poliks CF, Goldstein RH. Regulation of connective tissue growth factor expression by prostaglandin E(2). Am J Physiol Lung Cell Mol Physiol 1999;277:L1165–1171. [42] Yu J, Prado GN, Schreiber B, Polgar P, Taylor L. Role of prostaglandin E(2) EP receptors and cAMP in the expression of connective tissue growth factor. Arch Biochem Biophys 2002;404:302–8. [43] Stratton R, Shiwen X, Martini G, Holmes A, Leask A, Haberberger T, et al. Iloprost suppresses connective tissue growth factor production in fibroblasts and in the skin of scleroderma patients. J Clin Invest 2001;108:241–50. [44] Eberlein M, Heusinger-Ribeiro J, Goppelt-Struebe M. Rho-dependent inhibition of the induction of connective tissue growth factor (CTGF) by HMG CoA reductase inhibitors (statins). Br J Pharmacol 2001;133:1172–80. [45] Watts KL, Spiteri MA. Connective tissue growth factor expression and induction by transforming growth factor-beta is abrogated by simvastatin via a Rho signaling mechanism. Am J Physiol Lung Cell Mol Physiol 2004;287:L1323–1332. [46] Kondo S, Tanaka N, Kubota S, Mukudai Y, Yosimichi G, Sugahara T, et al. Novel angiogenic inhibitor DN-9693 that inhibits posttranscriptional induction of connective tissue growth factor (CTGF/CCN2) by vascular endothelial growth factor in human endothelial cells. Mol Cancer Ther 2006;5:129–37. [47] Lam S, van der Geest RN, Verhagen NA, van Nieuwenhoven FA, Blom IE, Aten J, et al. Connective tissue growth factor and igf-I are produced by human renal fibroblasts and cooperate in the induction of collagen production by high glucose. Diabetes 2003;52:2975–83. [48] Ruperez M, Lorenzo O, Blanco-Colio LM, Esteban V, Egido J, Ruiz-Ortega M. Connective tissue growth factor is a mediator of angiotensin II-induced fibrosis. Circulation 2003;108:1499–505.
Contents lists available at ScienceDirect
International Immunopharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p
A novel peptide isolated from phage display peptides library recognized by an antibody against connective tissue growth factor (CTGF) Naifeng Liu a,⁎,1, Guoqiu Wu b,1,2, Hui Li c, Linxian Li c, Honglei Xing a,3, Cheng Zhang b,2, Huixia Lu b,2 a b c
Institute of Cardiovascular disease of Zhongda Hospital, Southeast University, Nanjing 210009, China Center of clinical laboratory medicine of Zhongda Hospital, Southeast University, China School of Pharmacy, China Pharmaceutical University, China
a r t i c l e
i n f o
Article history: Received 12 October 2008 Received in revised form 25 November 2008 Accepted 25 November 2008 Keywords: CTGF Phage display Antibody
a b s t r a c t The aim of this study was to isolate a peptide binding to an antibody against CTGF C-terminal domain from the peptide library and to evaluate its immunological and biological activities. A phage display 12-mer peptide library was screened using anti-CTGF/C antibody as the target. Ten of the positive clones were sequenced after three rounds bio-panning. The DNA encoding peptide ZD521 was cloned and expressed as the fusion protein(TrxA-ZD521). The specificity of ZD521 to anti-CTGF/C antibody was determined by competitive inhibition assay. Mice were immunized with purified fusion protein(TrxA-ZD521) and the antipeptide or anti-CTGF response of antiserum was also tested by enzyme-linked immunoabsorbent assay (ELISA) and Western blot. The inhibition effect of anti-serum on proliferation of kidney mesangial cells was evaluated by MTT. A peptide ZD521(GEPQTKLFSFPL) that could specifically recognize anti-CTGF/C antibody was isolated. No sequence homology was found between ZD521 and CTGF/C. The purified TrxA-ZD521 could specifically bind to anti-CTGF/C antibody and block the binding of anti-CTGF/C antibody to CTGF/C and native CTGF(mesangial cell lysate). Moreover, the antiserum from mice immunized with TrxA-ZD521 could also bind to CTGF/C recombinant protein and native CTGF, as well as significantly inhibit the proliferation of kidney mesangial cells induced by CTGF/C. Therefore, ZD521 might be a conformational epitope of CTGF which is potentially useful to be developed as a vaccine for prevention and treatment of fibrosis disorders. © 2008 Elsevier B.V. All rights reserved.
1. Introduction Connective tissue growth factor (CTGF) has recently received much attention as a downstream mediator of many signaling pathways in different cell types during fibrosis [1]. Treatment with agents of downregulated CTGF or antibodies of neutralizing activity of CTGF generated by auto- or passive immunity might be effective approaches to minimize fibrosis. CTGF is a multifunctional, cysteine-rich protein originally identified as a growth factor secreted by vascular endothelial cells in culture [2]. It belongs to the CCN family(cysteine-rich 61, Cyr61/connective tissue growth factor, CTGF/nephroblastoma-overexpressed, NOV) of immediate early growth-responsive genes residing on chromosome 6q23.1, proximal to c-myb, and comprises five exons and four introns from human [2,3]. CTGF stimulates broad cellular responses including proliferation, chemotaxis, adhesion, migration, and extracellular
⁎ Corresponding author. Institute of Cardiovascular disease of Zhongda Hospital, Southeast University, 87 Dingjiaqiao, Nanjing 210009, China. Tel.: +86 25 83272001. E-mail addresses: [email protected] (N. Liu), [email protected] (G. Wu). 1 These authors contributed equally to this work. 2 Tel.: +86 25 83272355. 3 Tel.: +86 25 83272001. 1567-5769/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2008.11.015
matrix (ECM) production [4]. It has also been implicated in regulating diverse processes in vivo including angiogenesis, placentation, embryogenesis, differentiation, wound healing, and fibrosis, and its target cells include fibroblasts, endothelial cells, smooth muscle cells, epithelia cells, and neuronal cells [4]. Pathologically, CTGF is known to play important roles during tumorigenesis, arthrosclerosis and fibrotic disorders of the skin, kidney, lung, liver, and pancreas [5,6]. Since fibrosis usually shows excessive connective tissue and ECM deposition, these reports suggests that CTGF is involved in the development of fibrotic pathology. CTGF has four domains: an insulin-like growth factor-binding domain, a von Willebrand factor type C repeat domain, a thrombospondin type 1 repeat domain, and the C-terminal domain and it possesses a secretory signal peptide at the N terminus that leads to secretion from the cell. There are various molecular weight forms that were isolated by specific heparin binding [3,7–13]. These forms were highly truncated and showed that the N-terminal two thirds of the primary translational product was not required for mitogenic activity or heparin binding [14]. Although the cell surface receptor for CTGF has not been identified to date, some reports have shown that CTGF can bind to integrins in some cell types [15]. CTGF binds to alpha(v)beta(3) integrin on endothelial cells [16], alpha(IIb)beta(3) integrin on blood platelets
292
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
[17], and both alpha(6)beta(1) integrin and heparin sulfate proteoglycans on fibroblast cells [18]. Additionally, low-density lipoprotein receptor-related protein/alpha2-macroglobulin receptor (LRP) was recently identified as a binding site for CTGF in fibroblasts [19]. Because integrins can transduce extracellar binding events into intracellar signaling cascades, the ability of CTGF to interact with different integrins showed diverse biological functions of CTGF. CTGF actually works as a secreted ECM protein and transmits its signal either by initiating signaling through interaction with integrins or by modulating the function of other growth factors through direct protein–protein interaction [1]. It has also been reported that hepatic stellate cells (HSC) can produce integrins that act as cell adhesion receptors capable of binding CTGF and this adhesion activity was blocked by anti-alpha(v)beta(3) integrin antibody [15]. The CTGF Cterminal domain appears to play a fundamental and central role in intercellular HSC adhesion by CTGF [15]. Phage display is a bioscreening technique by which foreign peptides or proteins are expressed as a fusion with coat proteins of a bacteriophage resulting in display of the fused protein on the surface of the phages, while the nucleotide sequence encoding the fusion resides within the phages. Phage display has been used to create a physical link between a library of random peptide sequences and the DNA encoding each sequence, allowing rapid identification of peptide ligands against specific target molecules by a selection technique called panning [20]. Phage display libraries of random short peptides have been successfully used for identification of antigenic epitopes, and for screening of mimotopes by panning against antibodies and other receptor molecules [21]. A mimotope is a structure that acts as a mimic of the epitope recognized by an antibody. Because a compound with a similar tertiary structure to the epitope can work as a mimotope, peptidyl mimotopes can be prepared even to an epitope composed of nonpeptidyl molecules. In this study, we aimed to mimic the CTGF C-terminal domain(CTGF/C) which plays a important biological role. Amino acids residue(242–349) of CTGF were cloned and expressed as a fusion protein which is a peptide sequence fused with the thloredoxin (Trx) A protein(109 aa), and monoclonal antibody against CTGF C-terminal domain was prepared. In the meantime, a phage display 12-mer peptide library was used to isolate a peptide that bound to the monoclonal antibody against CTGF. The immunological and biological activities of isolated peptides were also determined. The peptide could become a candidate as a vaccine for the treatment or prevention of fibrosis disorders.
was emulsified in complete Freund's adjuvant (CFA) the first time. Mice were boosted four times with the antigen emulsified in incomplete Freund's adjuvant (IFA) every 3 weeks. Sera were taken on day 0 and 7 days after the third and fifth immunization. Antibody level in the sera from the immunized mice were determined by ELISA. Splenocytes from the immunized mice were fused with myeloma cells (SP2/0) at the ratio of 5:1. The cell mixture was cultured in RPMI 1640 supplemented with 10% fetal calf serum, and the hybridoma cells were selected by using a hypoxanthine-aminopterin-thymidine(HAT) medium(Sigma). All monoclonal antibodies were prepared from ascite fluids of the mice treated with pristane and were purified by chromatography on a protein-A column (Pharmacia). To test the anti-recombinant CTGF and native protein response, 96well flat-bottom microtiter plates were coated with 100 μl/well of a solution containing 2 μg/ml of purified recombinant CTGF and native protein (kidney mesangial cell lysate, which was prepared by lysing the cells in buffer containing 1% Triton X-100, l mM EDTA, 10 mM DTT, 1 mM PMSF, and 1 mg/ml aprotinin) or control material(trxA protein) in 0.1 M PBS (pH 7.4) by overnight incubation at 4 °C. After washing and blocking for 1 h at 37 °C with a solution of 10% fetal bovine sera in PBS, 100 μl of purified antibody at various concentrations was added in the wells and incubated for 2 h at 37 °C before 100 μl of horseradish peroxidase-conjugated goat anti-mouse Ig (1:2000 dilution, R&D Systems Inc.). The wells were then washed 5 times and the specific binding was revealed by addition of 100 μl of substrate tetramethylbenzidine(TMB). Color development was stopped by addition of 2 M sulphuric acid, and the results were recorded by reading the OD value at 450 by an automated ELISA reader(CliniBio 128C, Austria). 2.3. Western blot To further identify the reactivity of MoAb with recombinant and native protein, Western blot analysis was performed. 2 μg of TrxA, TrxA-CTGF/C, and kidney mesangial cell lysate were subjected to 12% Sodium dodecyl sulfate-polyacrylamide gelelectrophoresis(SDSPAGE) and transferred to nitrocellulose. The proteins were probed with the produced antibody (1:2000 dilution with PBS). After being washed, the filters were incubated with HRP-conjugated secondary antibody(1:1000 dilution with PBS, R&D Systems Inc.) and then developed with an electrochemilumineseence (ECL) system (Amersham Biosciences). 2.4. Bio-panning and selection of phage
2. Materials and methods 2.1. Preparation of recombinant CTGF C-terminal domain (CTGF/C) The recombinant CTGF/C had been obtained as described previously [22]. Briefly, total RNA was extracted from human endothelial cells and reverse transcribed into cDNA. The gene encoded CTGF Cterminal domain 242–349 residues was obtained by a standard PCR procedure with designed primers: 5'-CCCAAGCTTTGCCATGTCTCCGTACATCTTCC-3' and 5'-GCTGGATCCGAAGAGAACATTAAGAAGGGC-3'. The PCR product was subcloned into pET-32a(+) vector (Invitrogen) by endonuclease restriction sites of BamH I and Hind III. Positive plasmid colonies were was selected and grown in Luria Broth (LB) medium containing ampicillin and induction was typically achieved by addition of 1 mM final concentration of IPTG(MBI, Ins). Cells were harvested and sonicated to release the required protein. The recombinant CTGF/C(TrxA-CTGF/C) was purified by HisTrap™ HP Kit (Amersham Biosciences). 2.2. Production of monoclonal antibody(MoAb) against CTGF/C 6 to 8-week old BALB/c mice (purchased from Shanghai Animal Center ) were immunized s.c. with 50 μg of recombinant protein that
Mouse normal lgG and anti-CTGF antibody (7G2, 100 μg/ml) in 0.05 M NaHCO3 (pH9.6) were separately coated on 96-wells plate (Nunc)(100 μl/well) by incubating overnight at 4 °C. After blocking with 0.5% BSA in TBS at 37 °C for 1 h, the wells were washed 6 times with TBST(TBS + 0.1% Tween-20). The phage display peptide library (Ph.D.12, New England Biolabs), diluted in TBS containing 0.1% Tween20 to a concentration of 4.0 × l011 pfu were preabsorbed on plate containing immobilized mouse normal IgG and BSA to remove any phages that were not specifically reactive with anti-CTGF antibody at 37 °C for 1 h, and then were transferred into the wells immobilized with 7G2, and incubated at 37 °C for 1 h. The wells were washed 5 times with 0.1% Tween-20/TBS. Then, the phages that bound with 7G2 were eluted with 0.2 M Glycine-HCl(pH2.2) containing 0.5% BSA, and immediately neutralized with 1 M Tris–HCl(pH9.1). 1 μl of the elution was tittered as described briefly: Inoculate 5–10 ml LB with a single colony of ER2738(New England Biolabs) and continue with shaking until mid-log phase (OD600 ~ 0.5). While cells are growing, melt Agarose Top in microwave and dispense 3 ml into sterile culture tubes, one per expected phage dilution (10-fold serial dilutions from 10− 2 to 10− 18 with PBS). Tubes were equilibrated at 45 °C until ready for use. An aliquot of 200 μl cell culture was added into microfuge tubes for each phage dilution. Add 10 μl of each dilution to each tube, vortex
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
quickly, and incubation at room temperature for 1–5 min. The infected cells were transferred to a culture tube containing 45 °C Agarose Top, vortexed quickly, and immediately poured onto a pre-warmed LB/ IPTG/X-gal(MBI, Ins.) plate. The plates were cooled for 5 min and then were inverted and incubated overnight at 37 °C. Plaques on plates were counted. Plaque forming units(pfu/ml) = plaque number × 100/ dilution factor. The rest were amplified by inoculation into 20 ml LB medium in a 250 ml Erlenmeyer flask containing 200 μl of E. coli ER2738 by overnight culture and shaken for 4.5 h at 37 °C. The amplified phages were purified by precipitation with 1/6 volume of polyethylene glycol 8000 (PEG8000)/2.5 M NaCl and used in the next cycle. Three rounds of selection were performed., In the second round, the wells were coated with 7G2 at a concentration of 50 μg/ml and washed 10 times with 0.5% Tween-20/TBS, and in the third round, the wells were coated with 7G2 at a concentration of 25 μg/ml and washed 20 times with 1.0% Tween-20/TBS. After that, individual plaques were picked up randomly and subjected to analysis by phage enzymelinked immunosorbent assay (ELISA). 2.5. Phage ELISA In total, 32 phage clones picked up randomly were tested for reactivity with 7G2 by ELISA. Briefly, a single clone was grown for 4.5 h in 1 ml LB and shaken at 37 °C. Bacterial cells were spun down, and the supernatant containing phage was added to the wells of a microtiter plate that was coated with 2 μg/ml of 7G2 or mouse normal IgG in 0.05 M NaHCO3 (pH 9.6) and then blocked with 1% BSA in PBS. The plate was incubated at room temperature for 2 h and washed 5 times with 1.0% Tween/TBS. Bound phages were detected by incubation with 100 μl HRP-conjugated anti-M13 antibody (Pharmacia, diluted 5000 times with PBS) for 1 h, followed by washing 5 times and the addition of a substrate solution (100 μl/well) containing 3,3',5,5'-tetramethylbenzidine(TMB) at 100 μg/ml. After incubating for 10 min, the reaction was stopped by the addition of 1 M H2SO4(50 μl/well). Peroxidase activity was evaluated by the difference between the absorbance at 450 nm and 620 nm by using a microplate reader (CliniBio 128C, Austra). 2.6. DNA sequencing The phage plaques were amplified by the procedure described above. A 500 μl of the phage-containing supernatant was transferred to a fresh microfuge tube and added 200 μl of PEG/NaCl, and centrifuged 10 min after standing at room temperature for 10 min. The pellet was suspended with 100 μl of Iodide buffer(10 mM Tris–HCl pH8.0, 1 mM EDTA, 4 M NaI) and 250 μl ethanol. Single-stranded phage DNA was precipitated by centrifugation for 10 min at 10,000 rpm after incubation for 10 min at room temperature and sequenced by BioAsia Biology Inc. (Shanghai, China). 2.7. Peptide synthesis 2 single-strand DNAs were synthesized: PH1: 5'GATCCGGGGAGCCGCAGACGAAGCTTTTTAGTTTTCCGCTGTGAC3', PH2: 5'TCGAGTCACAGCGGAAAACTAAAAAGCTTCGTCTGCGGCTCCCCG3', encoding amino acid sequence GEPQTKLFSFPL(ZD521)(BioAsia Biology Inc). The double-strand DNAs were formed by mixing 10 μl (500 pmol) of PH1 and 10 μl (500 pmol) of PH2 and incubating for 10 min at 70 °C, followed by a gradual decrease to room temperature. Ligation of the double-strand DNAs with pET-32(a)+ digested with BamH I and Hind III was done in 10 μl of reaction mixture containing 5.0 μg of doublestrands DNAs, 1.0 μg of vector DNA, 350 U of T4 DNA ligase for 16 h at 16 °C. The ligation products were used to transform competent cells of E. coli JM109, and positive colonies were identified by sequencing. Subsequently, the recombinant plasmid was transformed into E. coli
293
BL21 (DE3) and the fused peptide (Trx A-ZD521) was obtained by induction with IPTG and purified with the HisTrap™ HP Kit described as above. In the meantime, a peptide (GEPQTKLFSFPL) was synthesized by the standard 9-fluorenylmethoxycarbonyl solid-phase synthesis, and analyzed and purified by reverse-phase HPLC (Sangon BioEngineering Corporation, Shanghai, China). 2.8. Specificity of peptide binding to 7G2 Microtiter wells were coated with 100 μl of a solution containing 2 μg/ml of ZD521 peptide, TrxA-ZD521, or TrxA in 0.1 M PBS (pH7.4) by overnight incubation at 4 °C. After washing and blocking for 2 h at 37 °C with a solution of 10% fetal bovine sera in PBS, an aliquot of 100 μl of 7G2 of various concentrations with 0.1 M PBS (pH 7.4) were added in the wells and incubated for 2 h at 37 °C before 100 μl of horseradish peroxidase-conjugated goat anti-mouse Ig (1:2000 dilution, R&D Systems Inc.). The wells were then washed 5 times and 100 μl of substrate tetramethylbenzidine (TMB) was added. Color development was stopped by addition of 2 M sulphuric acid, and the results were recorded by reading the OD value at 450 nm by an automated ELISA reader. 2.9. Competitive inhibition assay To test the inhibition of 7G2 binding to CTGF, a 96-well microtiter plate was coated with 5 μg/ml of TrxA-CTGF/C, or TrxA-ZD521 in 0.1 M PBS(pH7.4) at 4 °C overnight and blocked for 2 h at 37 °C with a solution of 10% fetal bovine sera in PBS. Next, 0.5 μg/ml 7G2 was mixed with TrxA, TrxA-ZD521, ZD521 peptide, TrxA-CTGF/C, and mensangial cell lysates of various concentration, and preincubated for 1 h at room temperature, then transferred to the plates. Bound antibodies were detected by standard ELISA as described above. The peptides or proteins were tested at 0, 0.5, 5, 10, 40 μg/ml. Each dilution was tested in duplicate. The inhibition was calculated by using the following formula: (OD7G2 − OD7G2 with peptide or protein)/OD7G2 × l00%.The experiment was repeated three times. 2.10. Immunization 10 BALB/c mice were immunized s.c. with 100 μg of TrxA-ZD521 or TrxA that was emulsified in complete Freund's adjuvant (CFA) the first time and boosted four times with the antigen emulsified in incomplete Freund's adjuvant (IFA) every 3 weeks. Sera were taken on the third day after the fifth immunization. Antibody levels in the sera of immunized mice were determined by ELISA. To test the antipeptide and anti-CTGF response, 96-well microtiter plates were coated with 5 μg/ml of TrxA, TrxA-ZD521, TrxA-CTGF/C or mesangial cell lysate in 0.1 M PBS(pH 7.4) and then blocked with PBS(pH7.4) containing 10% fetal bovine sera. The plates were incubated for 2 h at 37 °C after addition of 100 μl of mice sera at the dilution of 1:100. Bound antibody was detected by using HRP-conjugated anti-mouse IgG with TMB as the peroxidase substrate as described above. To further demonstrate the reactivity with ZD521 or CTGF, Western blot analysis was performed. 2 μg of TrxA, TrxA-ZD521, TrxA-CTGF/C, and kidney mesangial cell lysate were subjected to 12% SDS-PAGE and transferred to nitrocellulose. The proteins were probed with anti-sera at the dilution of 1:100. After being washed, the filters were incubated with HRP-conjugated anti-mouse IgG antibody and then developed as described above. 2.11. Cell proliferation assay with MTT Human kidney mesangial cells (kindly provided by Dr. Liu Bicheng, Institute of Renal disease of Zhongda Hospital, Southeast University, China) were cultured on plastic culture dishes in DMEM supplemented with 10% fetal bovine sera. The cells were plated in a 96-well plate at a
294
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297 Table 1 Recovery of phages by biopanning Round
Phage added(pfu)
Phage eluted(pfu)
Yield
1 2 3
1.5 × 1011 2.1 × 1012 3.8 × 1012
3.4 × 103 4.7 × 105 1.5 × 106
2.3 × 10− 8 2.2 × 10− 7 0.4 × 10− 6
Titer after each round of panning procedure shown as plaque forming units(pfu). Yield = Phage eluted/Phage added.
Fig. 1. The specificity of 7G2 Binding to CTGF. A 96-well flat-bottom microtiter plate was coated with 2 μg/ml of TrxA, TrxA-CTGF/C or kidney mesangial cell lysate in 0.1 M PBS (pH 7.4) and blocked with PBS containing 10% fetal bovine sera. 7G2 of various concentrations was added to the wells. Bound 7G2 was detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The values are recorded at OD450 nm. SDs are indicated by error bars.
3.3. Specificity of peptide binding to 7G2 and its sequence
density of 104 cells/well. When cells grew to 50% confluence, the medium were replaced by DMEM medium containing 0.5 μg/ml TrxACTGF/C and anti-serum of serial dilutions from the mice immunized with TrxA-ZD521 or TrxA The plates were incubated at 37 °C for 48 h. Numbers of live cells were measured using a thiazolyl blue(MTT, Sigma) cell proliferation assay by reading OD492. Each dilution was tested in triplicate. Proliferation inhibition were calculated by using the following formulas: ODprotein − ODprotein with anti-serum/ODprotein × 100%.
All 10 positive phage clones were sequenced, and the sequences of all clones were consentaneous which encoded the identical amino acid sequence (GEPQTKLFSFPL) named ZD521(Fig. 3). The amino acid sequence had no obvious similarities in motif with that of full length of CTGF/C. The binding activity of TrxA-ZD521 to 7G2 was also demonstrated by ELISA and Western blot. For this experiment, oligonucleotide encoding the peptide ZD521 were expressed as a Cterminal extension of the TrxA protein. The results of ELISA assay showed that 7G2 could specifically bind to ZD521 peptide and TrxAZD521 but not to TrxA (Fig. 4). The results of Western blot also suggested that 7G2 could specifically react with the TrxA-ZD521, whereas no reaction was obtained with TrxA (see lane 1, 2 of left panels in Fig. 2).
3. Results
3.4. TrxA-ZD521 and peptide ZD521 inhibition of 7G2 binding to CTGF/C
3.1. Generation of anti-CTGF antibodies
To demonstrate that ZD521 resembled the epitope of CTGF, we had to show that ZD521 blocked binding between 7G2 and CTGF. To perform these experiments, we used an ELISA in which 7G2 and inhibitors (TrxA, TrxA-ZD521, peptide ZD521 and mesangial cell lysate) were preincubated and plated onto the microtiter plates coated with TrxA-CTGF/C. This analysis revealed that TrxA-ZD521, ZD521 peptide and mesangial cell lysate could inhibit the binding of 7G2 to TrxA-CTGF/C in a dose-dependent manner, but TrxA protein did not produce noteworthy inhibition of their interaction (Fig. 5).
Five hybridoma cell lines that reacted with TrxA-CTGF/C, but not with TrxA were established (data no shown). 7G2 was chosen to use in this research. The results of ELISA assays showed that 7G2 could specifically bind to TrxA-CTGF/C and kidney mesangial cell lysates, but not to TrxA (Fig. 1). The results of Westen-blot analysis also suggested that 7G2 reacted with TrxA-CTGF/C and a 38 kd protein of kidney mesangial cell lysates, but not with TrxA (Fig. 2, left panels). 3.2. Phage selection To select the positive clones that bind to monoclonal antibody against CTGF, a random 12-mer phage display peptide library composed of 4.0 × 1011 independent phage clones was reabsorbed by mouse serum IgG and BSA , and then specifically absorbed with 7G2. For each biopanning, phages were titrated for pfu in the inputs and outputs to determine the degree of selection. The total number of phages bound to 7G2 was increased from 3.4 × l03 pfu in the first round to 4.7 × 105 pfu in the second round, and 1.5 × 106 pfu in the third round (Table 1). After 3 rounds of selection, roughly 31.3% (10/32) of the phage clones analyzed exhibited 7G2 binding activity by ELISA (data no shown).
3.5. TrxA-CTGF/C inhibiting 7G2 binding to TrxA-ZD521 and peptide ZD521 To demonstrate that the 7G2 that bound to TrxA-ZD521 or peptide ZD521 was specific for CTGF, we used CTGF/C to inhibit 7G2 binding to TrxA-ZD521 or peptide ZD521. 7G2 was premixed with various dilutions of inhibitors. The results showed that TrxA-CTGF/C, ZD521 peptide or mesangial cell lysate significantly inhibited 7G2 binding to TrxA-ZD521(Fig. 6). In Fig. 6, TrxA alone also demonstrated a concentration-dependent inhibition on 7G2 binding to TrxA-ZD521, but TrxA-ZD521 fusion protein doubled or tripled the inhibition effect, as compared with TrxA. 3.6. Mice immunized with TrxA-ZD521 made antibodies Sera of mice were collected after the fifth immunization with TrxAZD521. The reactivity of anti-serum (anti-TrxA-ZD521 antibody) with TrxA-ZD521, TrxA-CTGF/C and CTGF native protein was evaluated by ELISA. All mice immunized with TrxA-ZD521 produced antibodies not
Fig. 2. Westen blot analysis of antibodies binding to proteins. Different proteins were prepared as described under “Materials and methods”. Equal amounts(2 μg) of proteins were subjected to SDS-PAGE and transferred to nitrocellulose membranes. The proteins were probed with 7G2 (left panels), anti-TrxA-ZD521 antibody(middle panels) and antiTrxA antibody (right panels) to detect the specificity of antibodies. Lane 1, TrxA; Lane 2, TrxA-ZD521; Lane 3, mesangial cells lysates; Lane 4, TrxA-CTGF/C.
Fig. 3. Amino acid sequence of ZD521. All positive phage clones encoded a consentaneous sequence when sequenced with the M13(-96) gIII primer (5'-CCCTCATAGTTAGCGTAACG-3').
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
295
Fig. 4. Binding of 7G2 to TrxA-ZD521. Microtiter wells were coated with 2 μg/ml of ZD521 peptide, TrxA-ZD521, or TrxA and blocked with PBS containing 10% fetal bovine sera. 7G2 of various concentrations was added to the wells. Bound 7G2 was detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The values are recorded at OD450 nm. SDs are indicated by error bars.
only against TrxA-ZD521 but also against recombinant and native CTGF (Fig. 7). The response to native CTGF was lower than to TrxAZD521 or TrxA-CTGF/C. Western blot analysis also showed that the anti-TrxA-ZD521 antibody specifically reacted with TrxA-ZD521, TrxACTGF/C and mesangial cell lysate(see middle panels in Fig. 2). No antipeptide or anti-CTGF response was observed in mice immunized with TrxA(see right panels in Fig. 2). 3.7. Anti-serum blocked cell proliferation induced by CTGF/C Anti-serum from mice immunized with TrxA-ZD521 was used to evaluate inhibition of cell proliferation induced by CTGF/C. The results showed that the anti-serum from mice immunized with TrxA-ZD521 inhibited cell proliferation induced by CTGF/C in a dose-dependent manner, but anti-serum from mice immunized with TrxA did not (Fig. 8). 4. Discussion Connective tissue growth factor (CTGF) is a novel profibrotic factor that is upregulated in different human diseases [23]. Angiotensin II (AngII) could stimulate overexpression of CTGF and regulates renal fibrosis via type 1 angiotensin(AT1) receptor by the Smad signaling pathway [24,25]. CTGF was positive in the majority of human biopsy specimens from various chronic liver diseases and in experimental models of liver fibrosis in rats. Moreover, there was a significant association between CTGF immunostaining intensity and the stage of fibrosis [26]. It has also been reported that CTGF were up-regulated specifically in the scar tissue of the ventricle after experimental induction of myocardial infarction (MI), and levels of CTGF mRNA in fibroblasts of scar tissue were clearly related to the development of heart fibrosis in mice 1 and 4 weeks post-M I [27]. CTGF expression is rapidly upregulated in many cell lines by various factors such as high glucose, stresses, and many growth factors including angiotensin(II), TGF-beta, vascular endothelial growth factor (VGEF) and increased ECM production [1]. Reports revealed that CTGF
could enhance mRNA level for alpha1-type collagen, fibronectin, and integrin in normal rat kidney(NRK) [28], increase expressive levels of collagen type II in rabbit growth cartilages [29], collagen type I and fibronectin in primary human and rabbit mensangial cells [8,30]. The sustained overexpression of CTGF was strongly correlated with the upregulation of ECM genes such as fibronection, collagen type I, and collagen type III in a rat MI model [31]. The C-terminal domain of CTGF that contains a cysteine knot similar to that found in other growth factors such as TGF-beta, platelet-derived growth factor (PDGF) and nerve growth factor is involved in diverse biological effects including cell surface binding, mitogenic activity for fibroblasts, stimulating DNA synthesis, cell transdifferentiation, and fibrosis [15,16,32]. It has recently been reported that CTGF directly binds bone morphogenic protein 4 (BMP4) and TGF-beta-1 through its cysteine-rich domain [33]. CTGF can inhibit BMP4 and activate TGF-beta-1 signals by direct binding to their extracellular domain. Therefore, it is possible that the C-terminal domain of CTGF can be a superior pharmacological target of profibrotic disease such as using neutralizing antibodies, antisense oligonucleotide and inhibitors. Phage display technology is broadly applied in identifying new receptors, natural ligands, and drug discovery as well as for vaccine design [34–40]. When an antibody is used for affinity selection, the peptides selected from random peptide library are antigenic mimics of the corresponding natural epitope. These peptides are able to elicit new antibodies that cross-react with the natural epitope, even though the animal has never been directly exposed to it. Generally, the epitope can be a linear fragment or conformational region. Linear epitopes correspond to the ordered sequence of amino acids in the protein. However, in conformational epitopes (mimotope), sequences from non-sequential protein regions in the primary structure or its associated carbohydrates contribute to a single tridimensional site. Screening phage display peptide libraries may be a simple and convenient way to find out not only linear epitopes but also conformational epitopes. To search for the peptides that could mimic the epitope of CTGF C-terminal domain and would have
Fig. 5. Peptide ZD521 or TrxA-ZD521 inhibited 7G2 binding to CTGF. Previously, 0.5 μg/ml of 7G2 was mixed with peptide ZD521, TrxA, TrxA-ZD521, TrxA-CTGF/C, mensangial cell lysate, preincubated for 1 h and transferred to the TrxA-CTGF/C coated plates. Bound antibodies were detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The inhibition rate was calculated according to the following formula: (ODantibody − ODantibody with protein)/ODantibody × l00%. SDs are indicated by error bars.
296
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
Fig. 6. CTGF inhibited 7G2 binding to TrxA-ZD521. First, 0.5 μg/ml of 7G2 was mixed with peptide ZD521, TrxA, TrxA-ZD521, TrxA-CTGF/C, mensangial cell lysate for 1 h. The mixture were added to TrxA-ZD521 coated wells. Bound 7G2 was detected with HRP-conjugated anti-mouse IgG antibody and then with the substrate. The inhibition rate was calculated according to the following formula: (ODantibody − ODantibody with protein)/ODantibody × l00%. SDs are indicated by error bars.
potential as a vaccine in preventing or treating fibrosis disorder, the phage display peptide library used here is based on a combinatorial library of random peptide 12 mers fused to a minor coat protein(p3) of the M13 phage by a flexible peptide(GGGS) (Fig. 3B). The peptide library was screened for phages with binding activity to antibody against CTGF as the target protein by bio-panning and a peptide (GEPQTKLFSFPL) was obtained. Although no sequence homology was found between the mimotope(ZD521) and CTGF/C by sequence alignment, our results showed that ZD521 might be a conformational structure of CTGF. For screening the library, some improvements were introduced for increasing the specificity and the yield. Firstly, to remove the nonspecific phage clones, the original phage display library was first pro-absorbed with mouse normal IgG. Secondly, Selective pressure was increased step by step, that is, the coated concentration of antibody was decreased from 100 μg/ml in the first round to 25 μg/ml in the third round, and washing times and concentration of Tween-20 in washing solution(TBS) were increased from 5 times, 0.01% in the first round to 20 times, 1% separately. Ten positive phage clones were selected from 32 clones picked up at random, and were completely identified by DNA sequencing. To rule out the effects of phage protein in the binding, the TrxA fusion protein was made. The fusion protein TrxA-ZD521 and ZD521 peptide showed the binding activity to 7G2 but the TrxA did not. Further analysis demonstrated that the TrxAZD521 and ZD521 peptide specifically inhibited the binding of 7G2 to CTGF. Moreover, the immunization analysis showed that the TrxAZD521 could induce an active immune response to CTGF in vivo. The anti-serum from mice immunized with TrxA-ZD521 could inhibit the CTGF/C-induced proliferation of human kidney mesangial cells but the anti-serum from mice immunized with TrxA did not. These results strongly suggested that ZD521 is similar to the antigen epitope of CTGF that is recognized by monoclonal antibody against CTGF. Whether or not the peptide is a real mimotope can be clarified by
Fig. 7. Antibody response of sera from mice immunized with TrxA-ZD521. Microtiter plates were coated with 5 μg/ml of TrxA, TrxA-ZD521, TrxA-CTGF/C or kidney mesangial cell lysate and blocked with PBS (pH7.4) containing10% fetal bovine sera. The antiserum at the dilution of 1:100 was added to the wells. Bound antibody was detected with HRP-conjugated anti-mouse IgG antibody and with the substrate. The values are recorded at OD 450 nm. SDs are indicated by error bars. ⁎p b 0.05(compared with serum from TrxA immunized mice, using Student's t test).
determining the peptide conformation by means of NMR or X-ray diffraction analysis. Pharmacologic manipulation of CTGF expression has been examined. Prostaglandin(PG)E2, forskolin and cAMP can downregulate TGFbeta-induced CTGF by inhibition of transcription of the CTGF gene [31,41,42]. Iloprost inhibited the induction of CTGF in human skin fibroblasts through upregulation of cAMP [43]. 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitor reduced CTGF induction through a Rho-dependent signaling mechanism [44,45]. An angiogenic inhibitor has been shown to inhibit post-transcriptional induction of CTGF by VEGF in human endothelial cells [46]. In the meantime, a search for a drug to neutralize CTGF itself is constantly being explored. Neutralizing anti-CTGF antibodies were capable of inhibiting glucoseinduced collagen secretion in renal fibroblasts [47], and a CTGF antisense oligonucleotide could prevent AngII induced fibronectin upregulation in vascular smooth muscle cell (VSMC) [48]. In this study, we found a novel peptide (ZD521) that binds to monoclonal antibody against CTGF C-terminal domain, and the peptide might be a conformational epitope of CTGF. Immunized with the peptide that was properly modified by heterogenetic proteins such as surface antigen of hepatitis virus B(HBsAg), antibodies against CTGF would be elicited by autoimmuine system. It was especially useful to prevent or neutralize the excess activity of over-expressed CTGF in fibrosis disorders, and avoid human anti-mouse reaction(HAMA) if treated with neutralizing anti-CTGF antibody derived from mouse. Indeed, CTGF is one of natural growth factors. It is difficult to prepare vaccines for humans (or other hosts) against self peptides or proteins such as CTGF, when that is needed and necessary, overcoming tolerance and avoiding autoimmune responses. The primary structure of ZD521 is not homological with that of CTGF, thus it can facilitate generation of antibody against CTGF in host. However, whether cross
Fig. 8. Proliferation inhibition assay by MTT. Human kidney mesangial cells were plated in 96-well microtiter plates at the density of 1 × 104 cells/well. After incubation at 37 °C overnight, the medium were replaced by DMEM medium containing 0.5 μg/ml TrxACTGF/C and anti-serum of serial dilutions from the mice immunized with TrxA-ZD521 or TrxA The plate were incubated at 37 °C for 48 h. Numbers of live cells were measured using a thiazolyl blue(MTT, Sigma) cell proliferation assay by reading OD492. Each dilution was tested in triplicate. Proliferation inhibition were calculated by using the following formulas: ODprotein − ODprotein with anti-serum/ODprotein × 100%.
N. Liu et al. / International Immunopharmacology 9 (2009) 291–297
reaction might take place between generated antibody and other cysteine knot proteins such as TGF-beta or VEGF, and real effects on fibrosis in vivo can be as expected by immunization with the peptide remained to be further researched. In general, the peptide which had been identified as a mimotope to CTGF might potentially be a useful candidate to be developed as a vaccine, providing a new approach for prevention and immunotherapy of fibrosis disorders. Acknowledgement The work was partly supported by the Fund of Science Research (No:XY2008341 and 9290002295) from Southeast University, PRC. References [1] Matsui Y, Sadoshima J. Rapid upregulation of CTGF in cardiac myocytes by hypertrophic stimuli: implication for cardiac fibrosis and hypertrophy. J Mol Cell Cardiol 2004;37:477–81. [2] Bradham DM, Igarashi A, Potter RL, Grotendorst GR. Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10. J Cell Biol 1991;114:1285–94. [3] Brigstock DR, Steffen CL, Kim GY, Vegunta RK, Diehl JR, Harding PA. Purification and characterization of novel heparin-binding growth factors in uterine secretary fluids. J Bio Chem 1997;272:20275–82. [4] Brigstock DR. The CCN family: a new stimuluspackage. J Endocrinol 2003;178: 169–75. [5] Moussad EE, Brigstock DR. Connective tissue growth factor: what's in a name? Mol Genet Metab 2000;71:276–92. [6] Shakunaga T, Ozaki T, Ohara N, Asaumi K, Doi T, Nishida K, et al. Expression of connective tissue growth factor in cartilaginous tumors. Cancer 2000;89:1466–73. [7] Croci S, Landuzzi L, Astolfi A, Nicoletti G, Rosolen A, Sartori F, et al. Inhibition of connective tissue growth factor (CTGF/CCN2) expression decrease the survival and myogenic differentiation of human rhabdomyosarcoma cells. Cancer Res 2004;64: 1730–6. [8] Hong HH, Uzel MI, Duan C, Sheff MC, Tracman PC. Regulation of lysyloxidase, collagen, and connective tissue growth factor by TGF-beta and detection in human gingival. Lab Invest 1999;79:1655–67. [9] Steffen CL, Ball-Mirth DK, Harding PA, Bhattacharyya N, Pillai S, Brigstock DR. Characterization of cell associated and soluble forms of connective tissue growth factor produced by fibroblast cells in vitro. Growth factors 1998;15:199–213. [10] Boes M, Dake BL, Booth BA, Erondu NE, Oh Y, Hwa V, et al. Connective tissue growth factor(IGFBP-rP2) expression and regulation in cultured bovine endothelial cells. Endocrinology 1999;140:1575–80. [11] Nishida T, Kubota S, Kojima S, Kuboki T, Nakao K, Kushibiki T, et al. Regeneration of defects in articular cartilage in rat knee joints by CCN2(connective tissue growth factor). J Bone Miner Res 2004;19:1308–19. [12] Rachfal AW, Luquette MH, Brigstock DR. Expression of connective tissue growth factor (CCN2) in desmoplastic small round cell tumour. J Clin Pathol 2004;57: 422–5. [13] Riser BL, Denichilo M, Cortes P, Baker C, Grondin JM, Yee J, et al. Regulation of connective tissue growth factor activity in cultured rat mesangial cells and its expression in experimental diabetic glomerulosclerosis. J Am Soc Nephrol 2000;11:25–38. [14] Ball DA, Surveyor GA, Diehl JR, Steffen CL, Uzumcu M, MAM, et al. Characterization of 16-20-kilodalton(kDa) connective tissue growth factors(CTGF) and demonstrate of proteolytic activity for 38 kDa CTGF in pig uterine luminal flushings. Biol Reprod 1998;59:828–35. [15] Gao R, Brigstock DR. Connective tissue growth factor (CCN2) induces adhesion of rat activated hepatic stellate cells by binding of its C-terminal domain to integrin alpha(v)beta(3) and heparan sulfateproteoglycan. J Biol Chem 2004;279:8848–55. [16] Babic AM, Chen CC, Lau LF. Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin alphavbeta3, promotes endothelial cell survival, and induces angiogenesis in vivo. Mol Cell Biol 1999;19: 2958–66. [17] Jedsadayanmata A, Chen CC, Kireeva ML, Lau LF, Lam SC. Activation-dependent adhesion of human platelets to Cyr61 andFisp12/mouse connective tissue growth factor is mediated through integrin alpha(IIb)beta(3). J Biol Chem 1999;274: 24321–7. [18] Chen CC, Chen N, Lau LF. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem 2001;276:10443–52. [19] Segarini PR, Nesbitt JE, Li D, Hays LG, Yates III JR, Carmichael DF. The low density lipoprotein receptor-related protein/alpha2-macroglobulin receptor is a receptor for connective tissue growth factor. J Biol Chem 2001;276:40659–67.
297
[20] Willats WGT. Phage display: practicalities and prospects. Plant Mol Biol 2002;50: 837–54. [21] Smith GP. Surface presentation of protein epitopes using bacteriophage expression system. Curr Opin Biotechnol 1991;2:668–73. [22] Liu NF, Wu GQ, Sun HW, Huang LX, Zhang FM, Qian JY, et al. Secretive expression and establishment of ELISA determination of connective tissue growth factor. Chin J Clin Lab Sci 2005;23:4–8. [23] Perbal B. CCN proteins: multifunctional signalling regulators. Lancet 2004;363:62–4. [24] Ruiz-Ortega M, Ruperez M, Esteban V, Egido J. Molecular mechanisms of angiotensin II-induced vascular injury. Curr Hypertens Rep 2003;5:73–9. [25] Ruiz-Ortega M, Ruperez M, Esteban V, Rodriguez-Vita J, Sanchez-Lopez E, Carvajal G, et al. Angiotensin II: a key factor in the inflammatory and fibrotic response in kidney diseases. Nephrol Dial Transplant 2006;21:16–20. [26] Paradis V, Dargere D, Vidaud M, De Gouville AC, Huet S, Martinez V, et al. Expression of connective tissue growth factor in experimental rat and human liver fibrosis. Hepatology 1999;30:968–76. [27] Chuva de Sousa Lopes SM, Feijen A, Korving J, Korchynskyi O, Larsson J, Karlsson S, et al. Connective tissue growth factor expression and Smad signaling during mouse heart development and myocardial infarction. Dev Dyn 2004;231:542–50. [28] Frazier K, Williams S, Kothapalli D, Klapper H, Grotendorst GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol 1996;107:404–11. [29] Nakanishi T, Nishida T, Shimo T, kobayashi K, Kubo T, Tamatani T, et al. Effects of CTGF/Hcs24, a product of a hypertrophy chondrocyte-specific gene, on the proliferation and differentiation of chondrocytes in culture. Endocrinology 2000;141:264–73. [30] Murphy M, Godson C, Cannon S, Kato S, Mackenzie HS, Martin F, et al. Suppression subtractive hybridization identifies high glucose levels as a stimulus for expression of connective tissue growth factor and other genes in human mesangial cells. J Biol Chem 1999;274:5830–4. [31] Chen MM, Lam A, Abraham JA, Schreiner GF, Joly AH. CTGF expression is induced by TGF-beta in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis. J Mol Cell Cardiol 2000;32:1805–19. [32] Lau LF, Lam SC. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res 1999;248:44–57. [33] Abreu JG, Ketpura NI, Reversade B, De Robertis EM. Connective tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta. Nat Cell Biol 2002;4: 599–604. [34] Yip YL, Ward RL. Epitope discovery using monoclonal antibodies and phage peptide libraries. Comb Chem High Throughput Screen 1999;2:125–38. [35] Scott JK, Smith CP. Searching for peptide ligands with an epitope brary. Science 1990;249:386–90. [36] Aina OH, Sroka TC. Therapeutic cancer targeting peptides. Biopolymers 2002;66: 184–99. [37] Samoylova TI, Morrison NE, Globa LP, Cox NR. Peptide phage display: opportunities for development of personalized anti-cancer strategies. Anticancer Agents Med Chem 2006;6:9–17. [38] Landon LA, Deutscher SL. Combinatorial discovery of tumor targeting peptides using phage display. J Cell Biochem 2003;90:509–17. [39] Landon LA, Zou J, Deutscher SL. Is phage display technology on target for developing peptide-based cancer drugs? Curr Drug Discov Technol 2004;1: 113–32. [40] Uchiyama F, Tanaka Y, Minari Y, Tokui N. Designing scaffolds of peptides for phage display libraries. J Biosci Bioeng 2005;99:448–56. [41] Ricupero DA, Rishikof DC, Kuang PP, Poliks CF, Goldstein RH. Regulation of connective tissue growth factor expression by prostaglandin E(2). Am J Physiol Lung Cell Mol Physiol 1999;277:L1165–1171. [42] Yu J, Prado GN, Schreiber B, Polgar P, Taylor L. Role of prostaglandin E(2) EP receptors and cAMP in the expression of connective tissue growth factor. Arch Biochem Biophys 2002;404:302–8. [43] Stratton R, Shiwen X, Martini G, Holmes A, Leask A, Haberberger T, et al. Iloprost suppresses connective tissue growth factor production in fibroblasts and in the skin of scleroderma patients. J Clin Invest 2001;108:241–50. [44] Eberlein M, Heusinger-Ribeiro J, Goppelt-Struebe M. Rho-dependent inhibition of the induction of connective tissue growth factor (CTGF) by HMG CoA reductase inhibitors (statins). Br J Pharmacol 2001;133:1172–80. [45] Watts KL, Spiteri MA. Connective tissue growth factor expression and induction by transforming growth factor-beta is abrogated by simvastatin via a Rho signaling mechanism. Am J Physiol Lung Cell Mol Physiol 2004;287:L1323–1332. [46] Kondo S, Tanaka N, Kubota S, Mukudai Y, Yosimichi G, Sugahara T, et al. Novel angiogenic inhibitor DN-9693 that inhibits posttranscriptional induction of connective tissue growth factor (CTGF/CCN2) by vascular endothelial growth factor in human endothelial cells. Mol Cancer Ther 2006;5:129–37. [47] Lam S, van der Geest RN, Verhagen NA, van Nieuwenhoven FA, Blom IE, Aten J, et al. Connective tissue growth factor and igf-I are produced by human renal fibroblasts and cooperate in the induction of collagen production by high glucose. Diabetes 2003;52:2975–83. [48] Ruperez M, Lorenzo O, Blanco-Colio LM, Esteban V, Egido J, Ruiz-Ortega M. Connective tissue growth factor is a mediator of angiotensin II-induced fibrosis. Circulation 2003;108:1499–505.