- Email: [email protected]
A novel point mutation in the mitochondrial tRNA(Trp) gene produces late-onset encephalomyopathy, plus additional features
Journal of the Neurological Sciences 297 (2010) 105–108
Contents lists available at ScienceDirect
Journal of the Neurological Sciences j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j n s
Short communication
A novel point mutation in the mitochondrial tRNA(Trp) gene produces late-onset encephalomyopathy, plus additional features Edoardo Malfatti a, Elena Cardaioli a, Carla Battisti a, Paola Da Pozzo a, Alessandro Malandrini a, Alessandra Rufa a, Raffaele Rocchi b, Antonio Federico a,⁎ a b
Department of Neurological, Neurosurgical and Behavioural Sciences, University of Siena, Siena, Italy Department of Neurosciences, Section of Neurology, University of Siena, Italy
a r t i c l e
i n f o
Article history: Received 12 March 2010 Received in revised form 28 April 2010 Accepted 7 June 2010 Available online 13 August 2010 Keywords: Mitochondrial diseases mtDNA Transfer RNATrp
a b s t r a c t Background: Mitochondrial diseases due to mitochondrial tRNA genes mutations are usually multisystem disorders with infantile or adult onset. Objective: To identify the molecular defect underlying a mitochondrial encephalomyopathy. Methods/Patients: Case report of a 51 year-old woman presenting with late-onset myoclonic epilepsy plus additional features. Proband's mother presented hypothyroidism and diabetes. Results: Muscle biopsy showed mitochondrial changes. Respiratory chain activities were reduced. The novel G5538A mutation was identified in different tissues DNAs from the proband and from her mother. Conclusion: We were able to identify a novel mtDNA tRNA(Trp) gene pathogenic mutation. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Mitochondrial encephalomyopathies (MIM 251900) include a diverse group of disorders of mitochondrial function [1]. More than 50% of pathogenic mtDNA mutations are concentrated in tRNA genes [2]. We describe a novel, maternally inherited mtDNA point mutation in the tRNA(Trp) gene, associated with unusual clinical features. The proband developed late-onset encephalomyopathy, her mother had hypothyroidism and diabetes mellitus. 2. Methods 2.1. Patients The proband, a 51-year-old woman, had a normal childhood, and two uneventful pregnancies at ages 20 and 27. At age 40, she developed myoclonic jerks. At age 42, she manifested major weakness and hair loss; blood tests revealed hypothyroidism. Retinal examination showed pigmentary changes. Visual evoked response was delayed in the left eye. EMG showed myopathic changes. Brain CT showed calcification in the left lenticular nucleus (Fig. 1B). EEG showed a burst of high amplitude 4–5 Hz multispike and wave activity. Skeletal muscle biopsy revealed RRFs (Ragged Red Fibers) and cytochrome C oxidase (COX)⁎ Corresponding author. Dept of Neurological, Neurosurgical, and Behavioural Sciences, University of Siena, viale Mario Bracci 2, 53100, Siena, Italy. Tel.: + 39 0577585763; fax: + 39 057740327. E-mail address: [email protected] (A. Federico). 0022-510X/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jns.2010.06.009
negative fibers (Fig. 2A). The proband's mother, aged 74, had a history of hypothyroidism and diabetes mellitus; neurological examination was unremarkable. Skeletal muscle biopsy revealed mitochondrial abnormalities (Fig. 2B). The proband's daughter and son were unavailable for study. 2.2. Analysis Morphological analysis of skeletal muscle and biochemical assays of individual respiratory chain complexes were carried out on muscle homogenate, as described [3]. Enzyme activities were normalized to that of citrate synthase, an index of mitochondrial mass. Total DNA was extracted from different tissues by standard procedures. The entire mtDNA molecule was PCR-amplified and direct sequencing was performed as reported [4]. Screening for the G5538A mutation of mtDNA was done by (RFLP)-PCR analysis of a 165 bp fragment amplified by modified primers that create a recognition site for the endonuclease HhaI. The presence and frequency of G5538A was verified by mismatch RFLP of the PCR product. The oligonucleotides used were FW (nt. 5408–5428) AAAATGACAGTTTAGGTCTAC, and RV modified (nt. 5573–5539) TTAAGTATTGCAACTTACTGAGGGCTTTGAAGGCG with one mismatch (in bold). The RV modified primer contains a mismatch at n. 5539 that creates a novel HhaI recognition site (nt. 5538–5542 3′ C/ GCG 5′). The 165 bp fragment is cleaved by the endonuclease into two fragments of 131 and 34 bp (not shown). The presence of m. G5538A abolishes the HhaI site so that mutant mtDNA remains uncut. Digestion products were separated on 4% MS agarose gel. Bands were visualized
106
E. Malfatti et al. / Journal of the Neurological Sciences 297 (2010) 105–108
Fig. 1. (A) Genealogical tree. Individuals with G5538A mutation are indicated with solid black symbols. (B) CT scan of proband showing calcification of left lenticular nucleus. (C) PCR/RFLP analysis. MM, molecular marker; C, control; B, blood; M, muscle; U, urine, EB buccal epithelium. Quantitation of relative amounts of mutant and wild-type mitochondrial DNA by polymerase chain reaction–restriction fragment length polymorphism analysis in different tissues.
Fig. 2. (A) (B) Histochemical demonstration of combined cytochrome-c oxidase (COX) and succinate dehydrogenase activities, revealing COX-negative (blue-stained) fibers and evidence of mitochondrial proliferation. A—proband, B—proband's mother C—proband's daughter. (C) Graphic representation of single-muscle-fiber polymerase chain reaction analysis showing segregation of the mutation with a biochemical defect in COX-negative muscle fibers. (D) Schematic representation of mitochondrial transfer RNATrp cloverleaf structure showing position of mutation in the anticodon stem.
E. Malfatti et al. / Journal of the Neurological Sciences 297 (2010) 105–108
107
Table 1 Activitiesa of respiratory chain enzymes in muscle extract from the proband's and from her mother.
Patient Proband's mother Controls's mean (n.35) a
NADH-CoQ1 red (complex I)
Succ-CoQ1 red
DBH2 Cyt c red (complex III)
COX (complex IV)
ATPase (complex V)
CS
7.6 11 15.3 ± 5.8
23 19 22.5±6.5
140 218 127.8 ± 41
105 197 154 ± 51
241 278 200 ± 70
230 322 174±61
The activities are expressed as nmol/min mg protein and normalized to that of citrate synthase (CS). Controls values ± s.d.
under ultraviolet (UV) using ethidium bromide staining. Densitometric analysis of bands was performed using a Biorad Gel Doc 2000 image analyzer. Single-fiber PCR analysis was performed according to Sciacco et al. [5]. 3. Results Histochemistry of the patient's muscle revealed 13% RRFs, and 45% COX-fibers (Fig. 2A). Histochemistry on muscle from the mother showed 7% RRFs and 20% COX-fibers (Fig. 2B). Biochemical analysis of the patient's muscle homogenate revealed complex I and IV deficiency (60% and 40% of mean of controls, respectively) (Table 1). MRC activities in muscle homogenate of the proband's mother revealed complex I deficiency (30% of mean of controls). Direct sequencing of the entire mtDNA molecule showed a G N A transition at nucleotide position 5538 (Fig. 3A) in heteroplasmic state that destroys a conserved G–C base coupling in the anticodon stem of the tRNATrp molecule at position 28 according to Sprinzl numbering (Fig. 3B). PCR-RFLP analysis and densitometry confirmed that 65% of muscle mtDNA carried the mutation, which was present in a minor percentage (around 5%) in mtDNA from lymphocytes, mouth and urinary tract epithelium of the proband and in 20% of mother's muscle mtDNA. G5538A was present in traces in proband's mother lymphocytes, mouth, and urinary tract epithelium (Fig. 1C). Single muscle fiber analysis showed substantially higher percentages of the G5538A mutation in COX-negative fibers (mean 89.37%; n = 8 fibers) than in COX-positive fibers (mean 7.87% n = 8 fibers) (P = 2.65E-11, 2-tailed t test), confirming segregation of the G5538A genotype with respiratory chain dysfunction (Fig. 2C).
4. Comment Diagnosis of mitochondrial disease in our patient was based on a clinical phenotype showing a multisystemic involvement. Identification of muscular mitochondrial changes and combined MRC suggested a mtDNA mutation. PCR amplification and successive direct sequencing led to identification of a novel mitochondrial tRNA gene mutation. Different lines of evidence support the pathogenicity of the RNA(Trp) mutation G5538A: 1) it is heteroplasmic in all the analyzed tissues of the proband and of her mother; 2) this change disrupts a highly conserved G-C base pair in the anticodon stem of tRNA(Trp); 3) the mutation is not a recognized neutral polymorphic variant, as it was not found in either of the large public databases of human mtDNA sequences [6–8]; 4) the G5538A mutation segregates with the phenotype, as it was much more frequent in COX-negative muscle fibers of the proband than COX-positive fibers (Fig. 3); 5) the tRNA mutation is consistent with the proband's phenotype of encephalomyopathy with additional features, as reported in many other mitochondrial tRNA mutations; 6) different mutational loads encountered in the muscle of the proband and her mother are probably correlated with the different clinical and biochemical expression of the mutation. Mutations in tRNA(Trp) have only been found in 9 patients who manifested an extremely wide range of phenotypes including MILS [9], spinocerebellar ataxia with sensoryneural deafness [10], late-onset mitochondrial myopathy [11,12], gastrointestinal pseudo-obstruction [13], dementia with chorea [14], and late-onset mitochondrial encephalomyopathy [15]. The mutation identified by us (G5538A in tRNA(Trp)) in our 51 year-old proband manifesting a complex phenotype including myoclonic epilepsy,
Fig. 3. (A) Identification of the G5538A mutation by direct sequencing of mitochondrial tRNATrp gene showing heteroplasmic G-A transition at position 5538 in muscle mtDNA. (B) Phylogenetic analysis of this region of the transfer RNATrp gene reveals that the base pair involving the nucleotide at position 5538 is strictly conserved throughout the species.
108
E. Malfatti et al. / Journal of the Neurological Sciences 297 (2010) 105–108
bilateral cataracts, pigmentary retinopathy, hypothyroidism and mild myopathy, is therefore a novel familial mtDNA point mutation. Mutation at position 28 of the mtDNA tRNA(Trp) has never been reported before. The proband's mother presented hypothyroidism and diabetes mellitus. Her muscle biopsy revealed mitochondrial alteration suggesting the G5538A mutation. The marked difference in mutant load between muscle and other tissues encountered in the proband and her mother may be because the deleterious mitochondrial tRNA mutation may be actively eliminated in rapidly dividing cells [16]. In conclusion, this report expands the clinical spectrum of pathogenic mutations in the mitochondrial tRNA(Trp) gene. This heteroplasmic mutation is clearly pathogenic because it disrupts a highly conserved base pair, altering tRNA secondary structure, and genetic data was correlated with a biochemical defect. Our report highlights the importance of molecular dissection of mtDNA in adult patients presenting with atypical syndromes and clinical and biochemical evidence suggesting mitochondrial disorders. Acknowledgements Research supported by a grant from the Regione Toscana and University of Siena to AF. References [1] Shoffner JM, Scriver CR, Beaudet AL, Sly WS, Valle D. Oxidative phosphorylation diseases. The metabolic and molecular bases of inherited disease, 2. New York: McGraw-Hill; 2001. p. 2367–423. [2] Zifa E, Giannouli S, Theotokis P, Stamatis C, Mamuris Z, Stathopoulos C. Mitochondrial tRNA mutations: clinical and functional perturbations. RNA Biol 2007;4:38–66. [3] Bugiani M, Invernizzi F, Alberio S, Briem E, Lamantea E, Carrara F, et al. Clinical and molecular findings in children with complex I deficiency. Biochim Biophys Acta 2004;1659:136–47.
[4] Da Pozzo P, Cardaioli E, Radi E, Federico A. Sequence analysis of the complete mitochondrial genome in patients with mitochondrial encephaloneuromyopathies lacking the common pathogenic DNA mutations. Biochem Biophys Res Commun 2004;324:360–4. [5] Sciacco M, Bonilla E, Schon EA, Di Mauro S, Moraes CT. Distribution of wild-type and common deletion form of mtDNA on normal and respiration deficient musclefibers from patients with mitochondrial myopathy. Hum Mol Genet 1994;3:13–9. [6] Ruiz-Pesini E, Lott MT, Procaccio V, et al. An enhanced MITOMAP with a global mtDNA mutational phylogeny. Nucleic Acids Res 2007;35:D823–8. [7] Ingman M, Gyllensten U. mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical sciences. Nucleic Acids Res 2006;34: D749–51. [8] Putz J, Dupuis B, Sissler M, Florentz C. Mamit-tRNA, a database of mammalian mitochondrial tRNA primary and secondary structures. RNA 2007;13:1184–90. [9] Santorelli FM, Tanji K, Sano M, Shanske S, El-Shahawy M, Kranz-Eble P, et al. Maternally inherited encephalopathy associated with a single-base insertion in the mitochondrial tRNA(Trp) gene. Ann Neurol 1997;42:256–60. [10] Silvestri G, Mongini T, Odoardi F, Moroni A, De Rosa G, Doriguzzi C, et al. A new mtDNA mutation associated with a progressive encephalopathy and cytochrome c oxidase deficiency. Neurolgy 2000;54:1693–6. [11] Silvestri G, Rana M, Di Muzio A, Uncini A, Tonali P, Servidei S. A late onset mitochondrial myopathy is associated with a novel mitochondrial point mutation in the tRNA(Trp) gene. Neuromuscol Disord 1998;8:291–5. [12] Anitori R, Manning K, Quan F, Weleber RG, Buist NR, Shoubridge EA, et al. Contrasting phenotypes in three patients with novel mutations in mitochondrial tRNAs genes. Mol Genet Metab 2005;84:176–88. [13] Maniura-Weber K, Taylor RW, Johnson MA, Chrzanowska-Lightowlers Z, Morris A, Charlton CP, et al. A novel point mutation in the mitochondrial tRNA (Trp) gene produces a neurogastrointestinal syndrome. Eur J Hum Genet 2004;12:509–12. [14] Nelson I, Hanna MG, Alsanjari N, Scaravilli F, Morgan-Hughes JA, Harding AE. A new mitochondrial DNA mutation associated with progressive dementia and chorea: a clinical, pathological, and molecular genetic study. Ann Neurol 1995;37: 400–3. [15] Sanaker PS, Nakkestad HL, Downham E, Bindoff LA. A novel mutation in the mitochondrial tRNA for tryptophan causing a late-onset mitochondrial encephalomyopathy. Acta Neurol Scand 2010;121:109–13. [16] Rahman S, Poulton J, Marchington D, Suomalainen A. Decrease of 3243 A_G mtDNA mutation from blood in MELAS syndrome: a longitudinal study. Am J Hum Genet 2001;68:238–40.
Contents lists available at ScienceDirect
Journal of the Neurological Sciences j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j n s
Short communication
A novel point mutation in the mitochondrial tRNA(Trp) gene produces late-onset encephalomyopathy, plus additional features Edoardo Malfatti a, Elena Cardaioli a, Carla Battisti a, Paola Da Pozzo a, Alessandro Malandrini a, Alessandra Rufa a, Raffaele Rocchi b, Antonio Federico a,⁎ a b
Department of Neurological, Neurosurgical and Behavioural Sciences, University of Siena, Siena, Italy Department of Neurosciences, Section of Neurology, University of Siena, Italy
a r t i c l e
i n f o
Article history: Received 12 March 2010 Received in revised form 28 April 2010 Accepted 7 June 2010 Available online 13 August 2010 Keywords: Mitochondrial diseases mtDNA Transfer RNATrp
a b s t r a c t Background: Mitochondrial diseases due to mitochondrial tRNA genes mutations are usually multisystem disorders with infantile or adult onset. Objective: To identify the molecular defect underlying a mitochondrial encephalomyopathy. Methods/Patients: Case report of a 51 year-old woman presenting with late-onset myoclonic epilepsy plus additional features. Proband's mother presented hypothyroidism and diabetes. Results: Muscle biopsy showed mitochondrial changes. Respiratory chain activities were reduced. The novel G5538A mutation was identified in different tissues DNAs from the proband and from her mother. Conclusion: We were able to identify a novel mtDNA tRNA(Trp) gene pathogenic mutation. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Mitochondrial encephalomyopathies (MIM 251900) include a diverse group of disorders of mitochondrial function [1]. More than 50% of pathogenic mtDNA mutations are concentrated in tRNA genes [2]. We describe a novel, maternally inherited mtDNA point mutation in the tRNA(Trp) gene, associated with unusual clinical features. The proband developed late-onset encephalomyopathy, her mother had hypothyroidism and diabetes mellitus. 2. Methods 2.1. Patients The proband, a 51-year-old woman, had a normal childhood, and two uneventful pregnancies at ages 20 and 27. At age 40, she developed myoclonic jerks. At age 42, she manifested major weakness and hair loss; blood tests revealed hypothyroidism. Retinal examination showed pigmentary changes. Visual evoked response was delayed in the left eye. EMG showed myopathic changes. Brain CT showed calcification in the left lenticular nucleus (Fig. 1B). EEG showed a burst of high amplitude 4–5 Hz multispike and wave activity. Skeletal muscle biopsy revealed RRFs (Ragged Red Fibers) and cytochrome C oxidase (COX)⁎ Corresponding author. Dept of Neurological, Neurosurgical, and Behavioural Sciences, University of Siena, viale Mario Bracci 2, 53100, Siena, Italy. Tel.: + 39 0577585763; fax: + 39 057740327. E-mail address: [email protected] (A. Federico). 0022-510X/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jns.2010.06.009
negative fibers (Fig. 2A). The proband's mother, aged 74, had a history of hypothyroidism and diabetes mellitus; neurological examination was unremarkable. Skeletal muscle biopsy revealed mitochondrial abnormalities (Fig. 2B). The proband's daughter and son were unavailable for study. 2.2. Analysis Morphological analysis of skeletal muscle and biochemical assays of individual respiratory chain complexes were carried out on muscle homogenate, as described [3]. Enzyme activities were normalized to that of citrate synthase, an index of mitochondrial mass. Total DNA was extracted from different tissues by standard procedures. The entire mtDNA molecule was PCR-amplified and direct sequencing was performed as reported [4]. Screening for the G5538A mutation of mtDNA was done by (RFLP)-PCR analysis of a 165 bp fragment amplified by modified primers that create a recognition site for the endonuclease HhaI. The presence and frequency of G5538A was verified by mismatch RFLP of the PCR product. The oligonucleotides used were FW (nt. 5408–5428) AAAATGACAGTTTAGGTCTAC, and RV modified (nt. 5573–5539) TTAAGTATTGCAACTTACTGAGGGCTTTGAAGGCG with one mismatch (in bold). The RV modified primer contains a mismatch at n. 5539 that creates a novel HhaI recognition site (nt. 5538–5542 3′ C/ GCG 5′). The 165 bp fragment is cleaved by the endonuclease into two fragments of 131 and 34 bp (not shown). The presence of m. G5538A abolishes the HhaI site so that mutant mtDNA remains uncut. Digestion products were separated on 4% MS agarose gel. Bands were visualized
106
E. Malfatti et al. / Journal of the Neurological Sciences 297 (2010) 105–108
Fig. 1. (A) Genealogical tree. Individuals with G5538A mutation are indicated with solid black symbols. (B) CT scan of proband showing calcification of left lenticular nucleus. (C) PCR/RFLP analysis. MM, molecular marker; C, control; B, blood; M, muscle; U, urine, EB buccal epithelium. Quantitation of relative amounts of mutant and wild-type mitochondrial DNA by polymerase chain reaction–restriction fragment length polymorphism analysis in different tissues.
Fig. 2. (A) (B) Histochemical demonstration of combined cytochrome-c oxidase (COX) and succinate dehydrogenase activities, revealing COX-negative (blue-stained) fibers and evidence of mitochondrial proliferation. A—proband, B—proband's mother C—proband's daughter. (C) Graphic representation of single-muscle-fiber polymerase chain reaction analysis showing segregation of the mutation with a biochemical defect in COX-negative muscle fibers. (D) Schematic representation of mitochondrial transfer RNATrp cloverleaf structure showing position of mutation in the anticodon stem.
E. Malfatti et al. / Journal of the Neurological Sciences 297 (2010) 105–108
107
Table 1 Activitiesa of respiratory chain enzymes in muscle extract from the proband's and from her mother.
Patient Proband's mother Controls's mean (n.35) a
NADH-CoQ1 red (complex I)
Succ-CoQ1 red
DBH2 Cyt c red (complex III)
COX (complex IV)
ATPase (complex V)
CS
7.6 11 15.3 ± 5.8
23 19 22.5±6.5
140 218 127.8 ± 41
105 197 154 ± 51
241 278 200 ± 70
230 322 174±61
The activities are expressed as nmol/min mg protein and normalized to that of citrate synthase (CS). Controls values ± s.d.
under ultraviolet (UV) using ethidium bromide staining. Densitometric analysis of bands was performed using a Biorad Gel Doc 2000 image analyzer. Single-fiber PCR analysis was performed according to Sciacco et al. [5]. 3. Results Histochemistry of the patient's muscle revealed 13% RRFs, and 45% COX-fibers (Fig. 2A). Histochemistry on muscle from the mother showed 7% RRFs and 20% COX-fibers (Fig. 2B). Biochemical analysis of the patient's muscle homogenate revealed complex I and IV deficiency (60% and 40% of mean of controls, respectively) (Table 1). MRC activities in muscle homogenate of the proband's mother revealed complex I deficiency (30% of mean of controls). Direct sequencing of the entire mtDNA molecule showed a G N A transition at nucleotide position 5538 (Fig. 3A) in heteroplasmic state that destroys a conserved G–C base coupling in the anticodon stem of the tRNATrp molecule at position 28 according to Sprinzl numbering (Fig. 3B). PCR-RFLP analysis and densitometry confirmed that 65% of muscle mtDNA carried the mutation, which was present in a minor percentage (around 5%) in mtDNA from lymphocytes, mouth and urinary tract epithelium of the proband and in 20% of mother's muscle mtDNA. G5538A was present in traces in proband's mother lymphocytes, mouth, and urinary tract epithelium (Fig. 1C). Single muscle fiber analysis showed substantially higher percentages of the G5538A mutation in COX-negative fibers (mean 89.37%; n = 8 fibers) than in COX-positive fibers (mean 7.87% n = 8 fibers) (P = 2.65E-11, 2-tailed t test), confirming segregation of the G5538A genotype with respiratory chain dysfunction (Fig. 2C).
4. Comment Diagnosis of mitochondrial disease in our patient was based on a clinical phenotype showing a multisystemic involvement. Identification of muscular mitochondrial changes and combined MRC suggested a mtDNA mutation. PCR amplification and successive direct sequencing led to identification of a novel mitochondrial tRNA gene mutation. Different lines of evidence support the pathogenicity of the RNA(Trp) mutation G5538A: 1) it is heteroplasmic in all the analyzed tissues of the proband and of her mother; 2) this change disrupts a highly conserved G-C base pair in the anticodon stem of tRNA(Trp); 3) the mutation is not a recognized neutral polymorphic variant, as it was not found in either of the large public databases of human mtDNA sequences [6–8]; 4) the G5538A mutation segregates with the phenotype, as it was much more frequent in COX-negative muscle fibers of the proband than COX-positive fibers (Fig. 3); 5) the tRNA mutation is consistent with the proband's phenotype of encephalomyopathy with additional features, as reported in many other mitochondrial tRNA mutations; 6) different mutational loads encountered in the muscle of the proband and her mother are probably correlated with the different clinical and biochemical expression of the mutation. Mutations in tRNA(Trp) have only been found in 9 patients who manifested an extremely wide range of phenotypes including MILS [9], spinocerebellar ataxia with sensoryneural deafness [10], late-onset mitochondrial myopathy [11,12], gastrointestinal pseudo-obstruction [13], dementia with chorea [14], and late-onset mitochondrial encephalomyopathy [15]. The mutation identified by us (G5538A in tRNA(Trp)) in our 51 year-old proband manifesting a complex phenotype including myoclonic epilepsy,
Fig. 3. (A) Identification of the G5538A mutation by direct sequencing of mitochondrial tRNATrp gene showing heteroplasmic G-A transition at position 5538 in muscle mtDNA. (B) Phylogenetic analysis of this region of the transfer RNATrp gene reveals that the base pair involving the nucleotide at position 5538 is strictly conserved throughout the species.
108
E. Malfatti et al. / Journal of the Neurological Sciences 297 (2010) 105–108
bilateral cataracts, pigmentary retinopathy, hypothyroidism and mild myopathy, is therefore a novel familial mtDNA point mutation. Mutation at position 28 of the mtDNA tRNA(Trp) has never been reported before. The proband's mother presented hypothyroidism and diabetes mellitus. Her muscle biopsy revealed mitochondrial alteration suggesting the G5538A mutation. The marked difference in mutant load between muscle and other tissues encountered in the proband and her mother may be because the deleterious mitochondrial tRNA mutation may be actively eliminated in rapidly dividing cells [16]. In conclusion, this report expands the clinical spectrum of pathogenic mutations in the mitochondrial tRNA(Trp) gene. This heteroplasmic mutation is clearly pathogenic because it disrupts a highly conserved base pair, altering tRNA secondary structure, and genetic data was correlated with a biochemical defect. Our report highlights the importance of molecular dissection of mtDNA in adult patients presenting with atypical syndromes and clinical and biochemical evidence suggesting mitochondrial disorders. Acknowledgements Research supported by a grant from the Regione Toscana and University of Siena to AF. References [1] Shoffner JM, Scriver CR, Beaudet AL, Sly WS, Valle D. Oxidative phosphorylation diseases. The metabolic and molecular bases of inherited disease, 2. New York: McGraw-Hill; 2001. p. 2367–423. [2] Zifa E, Giannouli S, Theotokis P, Stamatis C, Mamuris Z, Stathopoulos C. Mitochondrial tRNA mutations: clinical and functional perturbations. RNA Biol 2007;4:38–66. [3] Bugiani M, Invernizzi F, Alberio S, Briem E, Lamantea E, Carrara F, et al. Clinical and molecular findings in children with complex I deficiency. Biochim Biophys Acta 2004;1659:136–47.
[4] Da Pozzo P, Cardaioli E, Radi E, Federico A. Sequence analysis of the complete mitochondrial genome in patients with mitochondrial encephaloneuromyopathies lacking the common pathogenic DNA mutations. Biochem Biophys Res Commun 2004;324:360–4. [5] Sciacco M, Bonilla E, Schon EA, Di Mauro S, Moraes CT. Distribution of wild-type and common deletion form of mtDNA on normal and respiration deficient musclefibers from patients with mitochondrial myopathy. Hum Mol Genet 1994;3:13–9. [6] Ruiz-Pesini E, Lott MT, Procaccio V, et al. An enhanced MITOMAP with a global mtDNA mutational phylogeny. Nucleic Acids Res 2007;35:D823–8. [7] Ingman M, Gyllensten U. mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical sciences. Nucleic Acids Res 2006;34: D749–51. [8] Putz J, Dupuis B, Sissler M, Florentz C. Mamit-tRNA, a database of mammalian mitochondrial tRNA primary and secondary structures. RNA 2007;13:1184–90. [9] Santorelli FM, Tanji K, Sano M, Shanske S, El-Shahawy M, Kranz-Eble P, et al. Maternally inherited encephalopathy associated with a single-base insertion in the mitochondrial tRNA(Trp) gene. Ann Neurol 1997;42:256–60. [10] Silvestri G, Mongini T, Odoardi F, Moroni A, De Rosa G, Doriguzzi C, et al. A new mtDNA mutation associated with a progressive encephalopathy and cytochrome c oxidase deficiency. Neurolgy 2000;54:1693–6. [11] Silvestri G, Rana M, Di Muzio A, Uncini A, Tonali P, Servidei S. A late onset mitochondrial myopathy is associated with a novel mitochondrial point mutation in the tRNA(Trp) gene. Neuromuscol Disord 1998;8:291–5. [12] Anitori R, Manning K, Quan F, Weleber RG, Buist NR, Shoubridge EA, et al. Contrasting phenotypes in three patients with novel mutations in mitochondrial tRNAs genes. Mol Genet Metab 2005;84:176–88. [13] Maniura-Weber K, Taylor RW, Johnson MA, Chrzanowska-Lightowlers Z, Morris A, Charlton CP, et al. A novel point mutation in the mitochondrial tRNA (Trp) gene produces a neurogastrointestinal syndrome. Eur J Hum Genet 2004;12:509–12. [14] Nelson I, Hanna MG, Alsanjari N, Scaravilli F, Morgan-Hughes JA, Harding AE. A new mitochondrial DNA mutation associated with progressive dementia and chorea: a clinical, pathological, and molecular genetic study. Ann Neurol 1995;37: 400–3. [15] Sanaker PS, Nakkestad HL, Downham E, Bindoff LA. A novel mutation in the mitochondrial tRNA for tryptophan causing a late-onset mitochondrial encephalomyopathy. Acta Neurol Scand 2010;121:109–13. [16] Rahman S, Poulton J, Marchington D, Suomalainen A. Decrease of 3243 A_G mtDNA mutation from blood in MELAS syndrome: a longitudinal study. Am J Hum Genet 2001;68:238–40.